ISIS 2302 (INXC ICAM1, Oligo-TCS®) is a novel anti-inflammatory agent which acts by inhibiting the synthesis of intercellular adhesion molecule-1 (ICAM-1), a surface glycoprotein which promotes leucocyte adhesion during immune and inflammatory responses. ISIS 2302 is a human antisense phosphorothioate oligonucleotide composed of 20 bases (GCCCAAGCTGGCATCCGTCA) which targets the RNA of ICAM-1, thus inhibiting its translation from RNA to peptide. ISIS 2302 is the analogue of a murine ICAM-1 inhibitor, ISIS 3082, a research tool used to test the effects of inhibiting ICAM-1 in animal models and that has demonstrated the ability to prolong cardiac graft survival in mice.ISIS 2302 is in phase II trials for a variety of inflammatory diseases with Isis Pharmaceuticals in the USA and with Boehringer Ingelheim, a licensee company, in Europe. These studies cover 5 disease areas: renal transplant rejection prophylaxis, ulcerative colitis, Crohn's disease, psoriasis and rheumatoid arthritis. The pivotal-quality phase IIb trial of ISIS 2302 for the treatment of Crohn's disease has been initiated in 300 patients with steroid-dependency in about 40 clinical sites in North America and in Europe. An aerosol formulation of ISIS 2302 is being explored in preclinical studies as a potential therapy for asthma.Intravenous ISIS 2302 resulted in some clinical improvement in patients with psoriasis, but this effect was only short-lived. The company is now conducting preclinical investigation of topical ISIS 2302 for the treatment of psoriasis.Isis Pharmaceuticals is working with Inex Pharmaceuticals on the development of a transmembrane carrier systems (TCS) formulation of ISIS 2302, called INXC ICAM1, for intracellular delivery to endothelial cells. TCS is a proprietary delivery system developed by Inex. It aims to fully encapsulate drugs and carry them to disease sites and into cells. In preclinical studies, high levels of encapsulation into the TCS have been achieved, with a significant increase in drug accumulation at sites of inflammation. At present the TCS formulation is being investigated in the US as an anti-inflammatory agent.