摘要:

S CH CH2 COOH COOH Au SH CH CH2 COOH COOH Gold thiomalate Thiomalate Rheumatoid arthritis and metal compounds—perspectives on the role of oxygen radical detoxification† Jan Aaseth*a, Margaretha Haugenb and Øystein Førreb a Medical Department, Kongsvinger Hospital, 2200 Kongsvinger, Norway b Rikshospitalet, The National Hospital of Norway, Oslo Sanitetsforening Rheumatism Hospital, Oslo, Norway Rheumatoid arthritis (RA) is characterised by migration of activated phagocytes and other leukocytes into synovial and periarticular tissue.Activated oxygen species and other mediating substances from triggered phagocytes appear to exacerbate and perpetuate the rheumatoid condition. Iron excesses are capable of aggravating the arthritic inflammation, probably through their pro-oxidant potentials. In contrast, therapeutically given gold salts, through a lysosomal loading of the metal, inhibit the triggered cells, thereby reducing the toxic oxygen production. Pharmacological doses of zinc also may immobilise macrophages. Furthermore, the copper–zinc-containing enzyme SOD (superoxide dismutase) can act as a scavenger of toxic oxygen in the tissues.Therapeutic remission of RA has been obtained following intraarticular administration of SOD. Intramuscular administration of copper complexes has induced remission in about 60% of RA patients in open studies. Another drug, penicillamine, that protects cellular membranes against toxic oxygen in vitro, is presumed to act as an antirheumatic via the SOD mimetic activity of its copper complex.Thiomalate and other thiols may possess similar activities. Selenium compounds also may act as oxygen radical scavengers. A significant alleviation of articular pain and morning stiffness was obtained following selenium and vitamin E supplementation in a double-blind study on RA patients. The observations reviewed here indicate that metal compounds and other antioxidants can reduce the rheumatic inflammation by reducing the cellular production and/or concentration of toxic oxygen species.Keywords: Copper; zinc; selenium; gold; thiols; trace elements; phagocytes; leukocytes; macrophages; rheumatoid arthritis The pathological hallmark of rheumatoid arthritis (RA) is a persistent inflammation in synovial membranes of joints. This leads to a gradual destruction of the supporting structures of the joints, such as bone and cartilage, a process that ceases only if a remission occurs.It is surprising that active RA can be brought to remission by treatment with metal compounds such as gold or copper complexes or with metal-complexing agents such as penicillamine or 5-aminosalicylate. In some way, the remissioninducing agents must interfere with crucial mechanisms underlying the chronicity of the disease. Recent research indicates that activated tissue macrophages and blood monocytes invading the synovial tissue play a central role in the early steps of pathogenesis and chronification of RA.1 Important signal substances derived from the activated macrophages are the free oxygen radicals (superoxide and hydrogen peroxide) and the cytokines such as tumour necrosis factor-a (TNF-a).Apparently, these mediating substances play key roles in the progression of the rheumatoid inflammation.2 Another possible source of free oxygen radicals is related to the anoxic reperfusion reactions that may accompany excessive motions of affected joints.3 The aim of this paper is to discuss traditional and new pharmacological approaches that makes use of metal compounds and chelators that are presumed to interact with the generation or toxicity of activated oxygen species.Gold compounds The first clinical tests of gold around 1925 were precipitated by in vitro studies of the bacteriostatic effect towards bacilli of gold and other metals. Since RA was assumed to be an infectious disease, some patients suffering from RA were included in a programme of clinical testing of the heavy metals.These open studies led to the introduction of gold complexes as remission inducing agents by a French physician, Forestier.4 However, it was not until over 30 years later, in a report of the British Rheumatism Council in 1960, that gold therapy was shown to be clinically efficient in a controlled study.5 Nevertheless, already in the early 1930s it was observed that the most applicable gold compounds consisted of gold and sulfurcontaining complexing agents.The compound most used in clinical medicine has been gold thiomalate (Myocrisin) (Fig. 1). Astonishingly, these gold(i) complexes have only a weak or negligible anti-inflammatory action in animal models, although their antirheumatic effect has now been documented. This indicates that gold has a specific action in RA, perhaps on some basic mechanism underlying the perpetuating nature of this disease.However, the clinical use of sulfur–gold has been limited, to some extent, by its toxic reactions. Further, it has to be given by weekly intramuscular injections, which may be inconvenient for patients. This has led to the introduction of the lipophilic gold compound auranofin, which can be administered orally. After absorption the gold complex is not stable in vivo, the gold cation being released from the complexing agent. We have found that gold(i) thiomalate dissociates rapidly in blood plasma, gold being chelated by albumin and thiomalate being liberated in the free thiolate form.6 † Presented at The Sixth Nordic Symposium on Trace Elements in Human Health and Disease, Roskilde, Denmark, June 29–July 3, 1997.Fig. 1 Formulae of gold thiomalate and thiomalate. Analyst, January 1998, Vol. 123 (3–6) 3In vivo, thiomalate and gold have different metabolic behaviours, and it has been suggested that gold thiomalate injections, in fact, involve simultaneous treatment with two different drugs, viz., the thiol moiety in addition to gold itself.6 After repeated administration, gold is concentrated in the kidneys, liver, spleen and synovial tissue.7 It is easily taken up by the macrophages, and ultrastructural studies have shown that gold is deposited almost exclusively in the lysosomes.8 Subsynovial macrophages in untreated RA are characterised by a remarkable increase in the number of lysosomes, explaining the striking accumulation of gold in these cells in RA.9 Such activated macrophages characterising RA are reported to generate superoxide and peroxides that are discharged along with the cytokines.The activity of synovial macrophages and granulocytes of RA patients appears to be lowered in the presence of gold salts.10 Presumably, such immobilisation of cells and lysosomes can decrease the discharge of toxic oxygen and cytokines. Also, it has been reported that auranofin can inhibit the induction of TNF-a from the macrophages.11 Selenium Low selenium levels have previously been reported in blood plasma and cells from patients with RA.12,13 The most important biological function of selenium is attributed to its presence in the enzyme glutathione peroxidase (GSH-Px), which is a crucial factor in the cellular defence against toxic free radicals. Although oxygen radical formation may be of significance in the pathogenesis of RA, no significant clinical improvement was obtained when using nutritionally adequate or moderate doses of selenium supplementation, up to about 250 mg d21.14 We have undertaken a double blind clinical study to test if higher doses of selenium might exert diseasemodifying efficacy in RA.Forty-seven patients with classical or definite RA (ARA criteria) were randomly allocated to a treatment or placebo group (Table 1). The study was double-blind. In the treatment group all patients received 600 mg d21 of selenium, as a selenomethionine-containing yeast, for 8 months.The control group received placebo tables for the first 4 months, and the following 4 months they received 600 mg d21 of selenium, the same as in the selenium group. All tablets were enriched with vitamin E because this vitamin has been reported to protect against toxicity of high selenium doses.15 The patients were examined at the start of the study and after 4 and 8 months of treatment. To assess the disease activity, the following clinical variables were measured: articular index,16 grip strength in right and left hands, morning stiffness in minutes, number of swollen joints and ESR. The Wilcoxon two-sided paired test was used for longitudinal intra-group comparisons and Wilcoxon rank sum test for intergroup comparisons.Statistical analyses of clinical and laboratory parameters of disease activity after the first 4 month period of the selenium treatment revealed no signs of improvement or deterioration (5% significance level) compared with the control group.The same result was found in the control group after 4 months with 600 mg d21 of supplementation with selenium. A significant improvement in articular pain index (modified Ritchie test), grip strength of left hand and morning stiffness were, however, seen after 8 months with supplementation (Table 2). No signs of serious toxic side effects were seen, clinically or biochemically. 17 The concentrations of selenium in serum and whole blood were significantly raised by the treatment.Serum Se values reached a plateau around 500 mg l21, whereas whole blood selenium continued to increase above 600 mg l21 (Fig. 2). This double-blind clinical study indicates that long-term treatment with pharmacologically high doses of selenium (600 mg d21) reduces the articular pain index and morning stiffness in cases of RA. The lack of response following treatment with lower doses or a shorter treatment period indicate that the apparent clinical efficacy is related to an intracellular accumulation of unphysiologically high selenium amounts and not only a simple restoration of the antioxidant potential of the cells.It has been reported that pharmacological doses of organic selenium have cytostatic properties in leukaemia diseases.18 Hence it is tempting to speculate whether an immunomodulating effect of the present doses of selenium results from pharmacological interferences with cellular processes in white blood cells, presumably in the macrophages and/or granulocytes.It is not likely that the E-vitamin enrichment contributed to the results observed in this study owing to the relatively low doses involved. As suggested in recent review by Tarp,19 not only the macrophages but also the polymorphonuclear leukocytes might be important target cells for oxygen radical scavengers such as selenium compounds. Table 1 Patients’ characteristics at inclusion Control Selenium group Number of patients 25 22 Female/male 20/5 17/5 Age/years (mean and range) 51.9 52.1 (20–66) (21–77) Disease duration/months (mean and range) 80 142 (3–360) (6–480) Table 2 Clinical and laboratory variables recorded at inclusion and after 8 months of treatment [mean and (in parentheses) SEM] Selenium group Control group At 8 At 8 Variable inclusion months inclusion months Articular index 17.2 (1.8) 9.8* (1.7) 15.7 (1.7) 12.0 (2.1) Grip strength, right hand/ mmHg 57 (7) 80 (9) 63 (8) 81 (11) Grip strength, left hand/ mmHg 50 (7) 68* (6) 66 (9) 78 (11) Morning stiffness/min 76 (10) 38* (8) 86 (10) 71 (13) Number of swollen joints 8.8 (1.2) 7.3 (1.3) 9.5 (1.5) 10.9 (2.4) Erythrocyte sedimentation rate 38 (4) 44 (6) 34 (4) 39 (6) * Compared with the value at the start of the study, p < 0.01.Fig. 2 Selenium concentrations (mean values) in A, whole blood; B, serum; and C, placebo, during the study. 4 Analyst, January 1998, Vol. 123SH C CH COOH CH3 SeCH3 C C CH Penicillamine Selenomethionine CH3 NH2 H H H H COOH NH2 Copper Forestier20 was among the first to report that a copper complex, Cupralene, was effective in the treatment of rheumatoid arthritis. Based on open studies, he concluded in 1949 that ‘Copper salts are effective in the treatment of rheumatoid arthritis. They give better results than gold salts in the early stages of the disease. In cases of longer standing, they must be used if there is gold intolerance or gold resistance, but whenever gold salts are tolerated they are to be preferred’.These positive results with copper complexes were supported by the studies of other workers.21,22 Hangarter and Lubke22 treated more than 600 patients suffering from RA with copper salicylate and reported that 65% became symptom free, 23% improved and 12% of the patients remained unchanged. No serious toxic disturbances were recorded in association with the treatment.Their studies were not controlled, however, and their reports are difficult to evaluate. Although extensive evaluations of copper complexes in animal models have been undertaken,23 double-blind clinical studies on copper complexes in rheumatoid arthritis are still lacking. When discussing clinical treatment with copper-containing agents, the clinical use of the anti-inflammatory copperdependent metalloenzyme superoxide dismutase (SOD), should also be commented upon. Bovine SOD has been shown to reduce inflammation when given intra-articularly into the joints of RA patients.The discovery and evaluation of this agent may provide insights into the biochemical mechanisms of actions for all copper compounds.24 It is found that RA is usually associated with decreased intracellular SOD activity.25 This is interesting since SOD has anti-inflammatory activity. It is known that the cytosolic SOD is a copper/zinc-containing enzyme. Ceruloplasmin and therapeutic copper complexes have been shown to possess SOD-like activity.23 Hence the demonstrated physiological rise of ceruloplasmin in RA is suggested to represent a protective response. Consistent with this, a lack of rise of ceruloplasmin may increase the risk of chronic disease, as seen in copper-deficient animals with adjuvant arthritis.23,26 Biochemically, SOD can act protectively by detoxifying superoxide radicals discharged from activated phagocytes.The less toxic product H2O2 thus formed can be further degraded by glutathione peroxidase in the presence of glutathione.The clinical use of bovine SOD has, however, been abandoned because it is considered to induce antibody formation. Other metal complexes The well documented antirheumatic efficacy of the chelating agent penicillamine27 is still of theoretical interest, although the practical usefulness of this drug is limited by its pronounced tendency to induce toxic side reactions. It is noteworthy that the chemical structure of penicillamine, and also its clinical effect profile, resemble those of gold thiomalate.Selenomethionine, which was used in our clinical study described above, is structurally related to penicillamine (Fig. 3). Penicillamine is also presumed to mediate its antirheumatic effects via an inhibiting effect on synovial tissue macrophages, analogues to the proposed mechanism of action of gold complexes. It inhibits macrophage migration and stabilises the lysosomal membrane,28,29 thus reducing the induction of proinflammatory cytokines and oxygen free radicals.Being a strong copper chelator, it rapidly ties up free copper ions, forming a complex that acts as an efficient superoxide dismutating catalyst.23 Another strong copper-binding agent with anti-inflammatory properties is 5-aminosalicylate, which is delivered into tissues on the degradation of the antirheumatic drug sulfasalazine. Again, the superoxide dismutase mimetic activity of the copper chelate may contribute to its therapeutic potency.23 In addition, aminosalicylate is capable of chelating free iron(iii) cations.This property is relevant since the presence of catalytic amounts of free metal ions in an extracellular mixture of H2O2 and superoxide leads to a spontaneous interaction that gives rise to the extremely reactive hydroxyl radical. Thus, the ultimate consequences of the radical release accompanying respiratory bursts of invading leukocytes depend on the iron status in the tissue.High doses of zinc salts led to significant improvements in symptoms of rheumatoid arthritis in a clinical trial,30 but controversial results have been reported.31. When reaching into the intracellular space, zinc is a potent inductor of metallothionine, which is a protein tying up both copper and zinc, and which is also reported to act as an oxygen radical scavenger in biological systems.23 Conclusion Rheumatoid arthritis is characterised by increased activity of macrophages, which in cooperation with other inflammatory cells infiltrates the synovial tissue.The activated macrophages, monocytes and granulocytes generate reactive forms of oxygen which have been suggested to be mediators of inflammation, together with the pro-inflammatory cytokines, particularly TNF-a. It is tempting to hypothesise that TNF-a is an enzyme inhibitor acting on SOD and GSH-Px in RA. Recently, administration of TNF-a antibodies has been used therapeutically with good results.2 Gold is accumulated in the lysosomes of the macrophages, which are thereby immobilised, causing an arrest of the pro-inflammatory signaling.Zinc in high doses can also immobilise macrophages. Gold, zinc and copper can induce synthesis of the sulfhydryl-rich protein metallothionein. Copper is a component of the cytosolic enzyme SOD, and several copper-containing molecules including ceruloplasmin possess SOD activity.The anti-inflammatory activity of pharmacological copper complexes is attributed to their SOD activity. The therapeutic effects of penicillamine, may also be related to an antioxidative or membrane-protecting action. Increased intracellular levels of the selenium-containing enzyme GSH-Px can also accelerate the breakdown of reactive oxygen. Further research to evaluate the possible therapeutic effects of oxygen radical detoxification and of selenium supplementation in high doses in RA is of interest.References 1 Mulherin, D., Fitzgerald, O., and Bresnihan, B., Arthritis Rheum., 1996, 39, 115. 2 Feldmann, M., Brennan, F. M., and Maini, R. N., Annu. Rev. Immunol., 1996, 14, 397. 3 Singh, D., Nazhat, N. B., Fairburn, K., Sahinoglu, T., Blake, D. R., and Jones, P., Ann. Rheum. Dis., 1995, 54, 94. 4 Forestier, J., Bull. Soc. M�ed. H�op. Paris, 1929, 53 323. 5 Research Subcommittee, Ann. Rheum. Dis., 1960, 19, 55. 6 Jellum, E., Munthe, E., Guldahl, G., and Aaseth, J.Ann. Rheum. Dis., 1980, 39, 155. 7 Johnsen, A. C., Wibetoe, G., Langmyhr, F. J., and Aaseth, J., Anal. Chim. Acta, 1982, 135, 243. 8 Ghadially, F. N., J. Rheumatol., 1979, 6, 25. Fig. 3 Formulae of penicillamine and selenomethionine. Analyst, January 1998, Vol. 123 59 Nakamura, H., and Garashi, M. I., Ann. Rheum. Dis., 1977, 36, 209. 10 Lipsky, P. E., and Ziff, M., J. Clin. Invest., 1977, 59, 455. 11 Bondeson, J., PhD Thesis, Lund University, 1996. 12 Aaseth, J., Munthe, E., Førre, Ø., and Steinnes, E., Scand. J. Rheumatol., 1978, 7, 237. 13 Tarp, U., Br. J. Rheumatol, 1990, 29,158. 14 Tarp, U., Hansen, J. C., Overvad, K., Thorling, E. B., Tarp, B. D., and Graudal, H., Arthritis Rheum., 1987, 30, 1162. 15 Levander, O. A., and Morris, V. C., J. Nutr., 1970, 100, 1111. 16 Ritchie, D. M., Boyle, J. A., McInnes, J. M., Jasani, M. K., Dalakos, T. G., Grieveson, P., and Buchanan, W. W., Q. J. Med., 1968, 37, 393. 17 Yang, G. Q., and Xia, Y. M., Biomed. Environ. Sci., 1995, 8, 187. 18 Weisberger, A. S., Sutherland, L. G., and Seifer, J., Blood, 1956, 11, 1. 19 Tarp, U., Analyst, 1995, 120, 877. 20 Forestier, J., Ann. Rheum. Dis., 1949, 8, 132. 21 Kuzell, W. C., Schaffarzick, R. W., Mankle, E. A., and Gardner, G. M., Ann. Rheum. Dis., 1951, 10, 336. 22 Hangarter, W., and Lubke, A., Dtsch. Med. Wochemschr., 1952, 77, 870. 23 Inflammatory Diseases and Copper, ed. Sorenson, J. R. J., Humana Press, Clifton, NJ, 1982, pp. 483–490. 24 Lund-Olesen, K., and Menander, K. B., Agents Actions, 1974, 9, 333. 25 Rister, M., Bauermeister, K., Gravert, U., and Gladtke, E., Lancet, 1978, i, 1094. 26 Denko, C. W., Agents Actions, 1979, 9, 333. 27 Multicentre Trial Group, Lancet, 1973, i, 280. 28 Chvapil, M., Ryen, J. N., and Brada, Z., Biochem. Pharmacol., 1972, 21, 1079. 29 Carevic, O., Biochem. Pharmacol., 1979, 28, 2181. 30 Simkin, P. A., Lancet, 1977, 310, ii, 539. 31 Peretz, A., Neve, J., Jeghers, O., and Pelen, F., Am. J. Clin. Nutr., 1993, 57, 690. Paper 7/04840H Received July 8, 1997 Accepted October 13, 1997 6 Analyst, January 1998, Vol.

ISSN:0003-2654    

DOI:10.1039/a704840h

出版商:RSC    

年代:1998

数据来源: RSC

摘要:

Trends in quality assurance of metal determination in clinical chemistry† K. Byrialsen*, J. Kristiansen and J. M. Christensen National Institute of Occupational Health, Lersø Parkall�e 105, DK-2100 Copenhagen, Denmark A summary is given of the main strategies that can be used to obtain high quality results in the determination of metals in clinical chemistry. The trends in quality assurance of metal analyses are discussed. Keywords: Quality assurance; metals; clinical chemistry; human health Many decisions in a modern society are based on measurement results.For example, traded goods must meet certain quality requirements, industrial and agricultural pollution must be below certain limits, occupational exposure limits must not be exceeded, etc. Compliance with the desired quality or limit may be decided by measurement. Furthermore, actions to be taken in relation to risk assessment and human health and diseases are often related to measured changes in biomarker concentrations.Thus, measurement results have large economic, social and political impact on people and on society, and the reliability of measurement results is of crucial importance. Determination of metals is important in both the environmental and occupational health field and in clinical chemistry. Moreover, metal analysis has a long tradition in the fields mentioned and strategies for demonstrating the reliability of the results have been originated and matured within this type of analytical work.State-of-the-art Traditionally, measurement results are considered to be of high quality if the accuracy (i.e., trueness and precision) of the results is high.1 Determination of elements in trace amounts in clinical and environmental specimens poses special problems with respect to accuracy. For example, trueness may be affected by contamination or by inappropriate blank correction. Losses and contamination may occur during the sample pre-treatment procedure, and matrix interferences may significantly reduce precision and also affect trueness.Moreover, the matrix of calibration standards may not match that of the samples or the calibration standards may be subject to contamination or element loss during storage. In both cases, trueness of the measurement results will decrease. In addition, results are also affected by ‘blunders’ (gross errors). This type of error is often underestimated in daily laboratory work, and it is seldomly subject of systematic investigation.The need for laboratory personnel to be sufficiently trained and motivated is another important factor as up to 25% of all operating deficiencies are directly attributable to operating personnel.2 Laboratories aiming at high quality work must demonstrate that their measurement results meet the required level of trueness and precision. Several established quality control practices are available for the realisation of this goal and most of them have been thoroughly described in the literature and/or in standards and guidelines for quality assurance.For example, the applicability of a given analytical method must be assured on the basis of a well designed and carefully performed method validation study, as described by, e.g., Wernimont3 and Christensen et al.4 Biased measurement results have to be corrected on the basis of a method evaluation study, and inappropriate procedures may be improved resulting in reduced bias and higher precision.5 Another example of a well-established quality control practice is internal quality control which includes analysis of control samples and blank samples.Several standards describe control charts for data on control samples, for example, the ISO standards 7870,6 7873,7 79668 and 8258,9 and the IUPAC guideline on internal quality control procedures.10 The appropriate use of internal quality control serves to detect and correct large non-random changes in accuracy.Such changes will inevitably arise from changing environmental conditions, wear of the measuring instrument or parts of it, change of reagents used in the measurement process, human and technical errors, etc. The analysis of certified reference materials (CRMs) can also be used to demonstrate trueness and precision but because of the high cost of CRMs and the limited supply, the use of CRMs should be analysed less often than control samples.Because of the high degree of trust that can be put in the certified value, CRMs are particularly valuable in demonstrating the trueness of measurement results. In this context, the ISO guide 33 describes how to use CRMs.11 As the understanding and prediction of the impact of trace elements in the human body has increased, it has become evident that determination of total element concentrations may not be adequate. The determination of the abundance, distribution and toxicity of elements can be understood only in terms of trace element species.The key to successful determination of separate trace elements species is preservation of the species during all acts from sampling to the detection of the analyte. Therefore, availability of CRMs with certified values of trace metal species is of crucial importance to improve the analytical quality. However, great difficulties arise when speciation CRMs are produced as documentation of all critical parameters (e.g., homogeneity and stability) must be determined for each certified species.12 Test results should be mutually agreed across frontiers in favour of the users, and international cooperation between national accreditation bodies serves to achieve mutual recognition of test results.Therefore, test results must be comparable and participation in external quality assessment (EQA) schemes serves as an important tool for obtaining comparability. Laboratories seeking accreditation according to EN 45001 are requested to participate in EQA schemes.13 In view of use of EQA results for purposes of accreditation, methods of evaluation of laboratory performance should be comparable and wherever appropriate harmonized.Unfortunately, at present a laboratory can be judged differently by different EQA schemes as a result of differences in performance evaluation procedures. 14 The quality control practices mentioned above have been available in trace element analysis for several years.It is indisputable that, in general, implementation of good quality control practices in a laboratory lead to improvement of the † Presented at The Sixth Nordic Symposium on Trace Elements in Human Health and Disease, Roskilde, Denmark, June 29–July 3, 1997. Analyst, January 1998, Vol. 123 (7–12) 7quality of the results produced by the laboratory. However, as the needs of society are changing, so are the demands on the laboratories and so must the demands on quality control procedures. Metrological trend The most noteworthy trend in quality assurance within the field of analytical chemistry is the ongoing activities aiming at establishing a sound metrological basis for analytical measurements.This trend includes introduction of ‘new’ concepts, such as traceability and uncertainty. Quality requirements for the production, certification and use of certified reference materials are examples of practical implementation of this strategy.15,16 Another example is the International Measurement Evaluation Programme (IMEP) promoted by the Institute for Reference Materials and Measurements.17 Traceability and certified reference materials Traceability means that the result of a measurement (or a value of a calibrator) can be related to a stated reference, usually a national or international standard, through an unbroken chain of comparisons all having stated uncertainties.18 In analytical chemistry, the preferred standard of reference would be the SI base unit mole or alternatively, the SI base unit kilogram.Each step in the comparison chain involves a measurement procedure which contributes some uncertainty. Hence, the total uncertainty is a quantitative indication of the strength of the traceability chain . Certified reference materials (CRMs) play an important role in the practical establishment of traceability. The definition of a M as stated in the international vocabulary of basic and general terms in metrology (VIM)18 implies that CRMs in the context of traceability are valid standards of reference.The problems involved in application of CRMs such as the availability and representativity with respect to matrix and reference value are well known. Production of well defined CRMs with expected long-term stability often puts severe restrictions on the physical form of the material. The necessary processing of the material runs against the demand for CRMs with representative matrix and analyte form. For example, solid materials are often ground and filtered to assure homogeneity, while liquid materials sometimes are lyophilized to improve the stability. Sterile filtration is a possible alternative method to preserve biological fluids, and a CRM for trace elements in sterile filtered liquid serum is under production.19 The representativity of the CRM is not the only area for improvement. The database COMAR contains information of more than 9000 certified reference materials.20 A recent REMCO status report shows that about 1500 reference materials are under certification.21 At present, there are no general requirements to CRM producers to demonstrate their competence, and therefore it cannot be guaranteed that all CRMs in the COMAR register warrant the definition of a CRM and to the demands for strict documentation, as required by, e.g., the ISO guides 31,22 3423 and 35.24 Guidelines for production and certification of reference material issued by, e.g., the Standards, Measurement and Testing Programme (SM&T, formerly the BCR)15 and the National Institute of Standards and Technology (NIST)25 may serve as a practical reference for other minor certifying bodies.The process of certifying a BCR CRM includes strict adherence to these guidelines and scrutiny of the certification report by a certification committee consisting of a panel of expert scientists.This procedure ensures that CRMs issued by BCR are of high quality with respect to documentation and with respect to metrological quality, i.e., traceability and uncertainty. It has been suggested that the ISO guides and other guidelines (e.g., the BCR guide)15 could be implemented in PC-programs which may be valuable tools in the certification process, in particular for small certifying bodies.26 A PC-program specific for statistical evaluation of certified values and uncertainties on the basis of data from interlaboratory studies have been developed for that purpose. The program will generate standardized reports with full documentation of the evaluation procedure in accordance with the BCR guide.26 Uncertainty It is impossible to talk about traceability without referring to uncertainty, and vice versa.Uncertainty (of measurement) is defined as parameter, associated with the result of a measurement that characterized the dispersion of the values that could reasonably be attributed to the measurand.18 In analytical chemistry, the measurand typically is the molar (or mass) concentration of a substance in a given sample.The wording ‘dispersion of values that could reasonably be attributed to the measurand’ implies that a standard deviation based on repeated measurements does not, in general, satisfy the definition of uncertainty. A standard deviation, e.g., derived under repeatability or reproducibility conditions, is a measure of the laboratory (or a group of laboratories) ability to repeat the measurement.However, because the result of the measurement may be influenced by effects beyond the control of the laboratory (or a group of laboratories), a standard deviation is, in general, an underestimate of the uncertainty. In evaluating the uncertainty, the laboratory must assign a value to all relevant uncertainty components and combine the uncertainty components to yield an estimate of the uncertainty of the result.27 The principle is illustrated in Fig. 1, where Laboratory A does not consider the quality of the calibrators purchased from Company A or the systematic effects associated with the measurement Fig. 1 Uncertainty estimation. Laboratory A ignores uncertainty associated to the calibrator and the measurement principle and produces analytical results far from the true value. Laboratory B takes the uncertainty into account and, therefore, the true value is included in the confidence interval associated with the analytical result. 8 Analyst, January 1998, Vol. 123principle used by the laboratory when evaluating the ‘uncertainty’. As shown in the figure, the laboratory produces results far from the given reference value, and the deviation from the reference value is not accounted for by the reproducibility standard deviation reported by the laboratory. Moreover, the low reproducibility standard deviation may give the laboratory’s customers a false impression of the laboratory’s performance.On the other hand, Laboratory B is concerned with all aspects of the measurement. The laboratory concludes that the values assigned to the calibrators purchased from Company A are exact, and that bias from the measurement principle is absent. As no corrections are introduced, Laboratory B arrives at the same result of measurement as Laboratory A. However, Laboratory B estimated the calibrators values to be exact and the measurement principle to be free of bias with some uncertainty.These uncertainty components are combined with the laboratory’s reproducibility to yield a combined uncertainty of the result of measurement. Contrary to the reproducibility standard deviation, the uncertainty describes the deviation from the reference value. The results produced by Laboratory B will be in agreement with results produced by other laboratories following the same principles of uncertainty estimation.An example of uncertainty evaluation of a method for determination of cobalt in urine is shown in Fig. 2. More examples of practical applications of the uncertainty concept within the field of analytical chemistry are becoming available27,28 and more are needed. The introduction of the concept of uncertainty (as defined in the VIM18) in analytical chemistry is not a straightforward task. One important question is how to handle uncertainty components that cannot be evaluated by statistical treatment of data from repeated measurements, i.e., the so-called Type B uncertainty components.The uncertainty of defining the measurand, a significant problem in, e.g., determination of proteins, cannot easily be attacked by statistical means. Moreover, in environmental analyses the matrix may differ very much between samples, and in practice it is difficult to estimate the matrix interference for all types of samples, although such an influence is presumed to exist.The uncertainty of such components can only be evaluated by taking all available information in consideration. This information could be literature data, data from a manual, data obtained by other assays, or judgement carried out by an expert.27 This may seem forbidden to the chemist who clings to scientific objectivity, but one must recall that such ‘less objective’ procedures are already in use in other scientific fields, e.g., in risk analysis of chemicals, which involves extrapolation between species and application of a variety of safety factors in the process. The scientist must recognize, that the doubt about the exactness of a measurement result (i.e., the uncertainty) cannot always be quantified with the same scientific objectivity as the result itself.This situation may be acceptable as long as the evaluation of uncertainty is clearly documented. In the discussion of uncertainty it must be remembered that the measurement result is the primary outcome of a measurement and the uncertainty is a secondary (but not insignificant) outcome.International measurement evaluation programme Demonstrating the need for reference measurements, the Institute for Reference Materials and Measurement (IRMM) in 1988 set up the International Measurement Evaluation Programme (IMEP). In IMEP the results from the participating laboratories are compared with a reference range that contains a value that is traceable to SI system of measurements in order to give an objective picture of the state-of-the-art practice of measurements in field.The reference values are either ‘certified’ or ‘assigned’, and to qualify as a certified reference value measurements must have been performed with a primary method of measurements yielding reference values traceable to international system of units (SI). All reference values in IMEP are accompanied by combined uncertainties taking into account all known sources of uncertainty.With the reference values traceable to SI, a transparent realisation of international comparability of results has been performed and presently IRMM is making preparations for a large study scheduled for 1997–1998. The starting point is to establish traceable values for as many of the following inorganic components as possible: Ca, Cu, Fe, K, Li, Mg, Na, Se, Zn, in human liquid serum. Furthermore, future rounds of IMEP are planned to evaluate measurements of Pb and Cd in whole blood, Cd in urine and Al in serum.17 Trends in standardization In 1997 the guidance document EAL-G25 was released by European Cooperation for Accreditation of Laboratories (EAL).30 The document is a supplement to ISO/IEC Guide 2521 with special emphasis on the accreditation of medical laboratories.As in the ISO/IEC Guide 25 validation of analytical methods is required. It is stressed that standard or published methods shall not be taken for granted and their implementation in the laboratory shall be validated.Validation of new, original or in-house methods and procedures shall necessary be more comprehensive. For a measurement procedure, validation shall include, as appropriate, calibration function, analytical specificity, and sensitivity. It shall also include investigation of useable calibration materials (e.g., their traceability), estimation of the uncertainty of measurements (after corrections for known systematic deviations and based on within and between run variations) and suitable control systems (control materials, internal quality control and external quality assessment).Moreover, the laboratory will have to demonstrate the usefulness of the results, e.g., by establishing reference intervals, by participation in EQA schemes based on human samples and by establishing the clinical sensitivity and specificity. The total uncertainty of measurements (including sampling) should be in accordance with the clinical requirements for accuracy.30 Recognizing the value of intercomparison studies in external quality control, both ISO and IUPAC have issued guidelines focusing on interlaboratory studies.32,33 A fertile ground for harmonization and collaboration among EQA scheme organizers already exists: in 1996, the European Committee for EQA Programmes in Laboratory Medicine (EQALM), was established. EQALM is a forum for cooperation and exchange of knowledge about quality-related matters, especially with regard to external quality assessment.Among other activities, EQALM intends to organise meetings with scientific or practical themes Fig. 2 Example of uncertainty evaluation of a method for the analysis of cobalt in urine. The relation between the total uncertainty, RSDtot, and the single uncertainty components, RSDi, is calculated using the equation (RSDtot )2 = S (RSDi )2 . Major contributions to the total uncertainty in this example are recovery and matrix effects.Analyst, January 1998, Vol. 123 9for members and other interested parties, to establish working groups related to specific scientific matters and to issue scientific publications. Only organizations or regional EQA schemes with more than 100 participants can become full members.34 Serious errors may occur at the state of sampling. Therefore, sample collection guidelines (technical report) for trace elements in blood and urine have been issued by IUPAC.35 The guidelines include the most important elements measured in occupational and clinical chemistry and embraces harmonized procedures for collection, preparation, analysis and quality control. Recently, it has been decided that the coming revison of ISO/ IEC Guide 25 will be upgraded to international standard and, in addition to this, the coming revision of EN 45001 will be in concordance with the revised ISO/IEC Guide 25.36 However, standardization by itself will not result in improvements of the quality of output.The classical quality management is focused on corrective actions to be made in order to secure continuous conformity to the proper standards. A new trend is gradually introduced in the field of analytical chemistry: total quality management (TQM) which focuses on continuous quality improvements. The motivation for improvements will not arise from standard-regulated activities. Improvements occur when the analysts are constantly on the lookout for problems, and have sufficient energy and vitality to improve the quality of their work.In this context, TQM puts greater weight on attitudes towards quality than does classical quality management. As a consequence of the increasing use of laboratory management systems (LIMS) the U.S. Environmental Protection Agency, EPA, has developed Good Automated Laboratory Practices (GALP) which provide the users with principles and guidance for regulations to assure data integrity in automated laboratory operations.37 The document includes a guidance for implementation.The GALPs are developed to assure the reliability of data prepared by laboratories using LIMS to acquire, record, manipulate, store and archive data. Discussion The reliability and usefulness of any test result depends critically on the competence of the laboratory carrying out the test. Laboratory accreditation provides the laboratory with an independent evaluation and recognition of technical competence to perform specific tests.The evaluation covers all aspects of the laboratory operations and is made by technical experts and quality professionals. In the near future, accreditation will provide users of test results with a network of serious and well recognized clinical laboratories where quality control is a matter of daily routine. Furthermore, accreditation will increasingly become a demand from legal authorities as a great advantage from accreditation is the mutual recognition of test results. ISO 900138 or ISO 900239 certification of A laboratories and certification of personnel are not expected to attract laboratories performing routine analyses, but it may be an interesting alternative for laboratories working with research (ISO 9001).Nomination and accreditation of national reference laboratories in the field of clinical chemistry may serve as an enforcing factor to introduce a greater extent of traceability.Reference laboratories can provide traceability by participation in international EQA schemes, the IMEP programme and by production of CRMs with matrices relevant for clinical laboratories. The production of speciation CRMs may be another challenge for the national reference laboratories. Today most EQA schemes covering metal analyses are not operated on a metrological basis. Most of the schemes provide the participants with an evaluation based on consensus values, trimmed means, etc., which can be sensitive to group bias among participants.The consensus mean value (if necessary after exclusion of outliers) may be deemed very reliable if the EQA scheme involves many laboratories and with representation of many different methods including definitive methods. However, the use of an assigned value obtained from concurrent results from a number of expert laboratories is preferable. Only few schemes offer traceability together with the assigned value.This problem should not be solved by using CRMs as control samples in EQA schemes as stocks of the CRMs soon would run out. However, the concept of the IMEP programme is a valuable possibility for obtaining traceability in a EQA scheme and further initiatives must be encouraged. The expression of the uncertainty of a result allows comparison of results with reference values given in specifications and standards. The accreditation standard EN 45001 and the ISO Guide 25 call for uncertainty to be reported for measurement results.Although this demand represents a significant progress because it recognizes that the quality of measurement results is important for the use of the data, this progress is not reflected, in general, in the design of external quality control schemes or in the guidelines for holding interlaboratory studies. In other words, the performance of a laboratory is still judged on the basis of the distance between the result reported by the laboratory and the target value (calculated by the scheme organizer).The distance may be deemed acceptable or not acceptable according to some limits common to all laboratories. However, these limits do not reflect the individual uncertainties of the laboratories and it may happen that a result is denoted ‘unacceptable’ although it is satisfactory viewed from the perspective of the laboratory (see Fig. 3). Introduction of measurement uncertainty in EQA schemes will allow a more harmonized and up-to-date comparison of the test result obtained by the laboratories with the target values and acceptability limits: if the confidence interval of the laboratory result overlaps the acceptance interval in the EQA evaluation, the performance should be considered as acceptable.On the other hand, if the interval is not overlapping, a discrepancy exists which must be investigated and explained by the laboratory. The benefit gained from interlaboratory studies like EQA schemes depends on the design of the scheme.Critical subjects are estimation of the target value, sample distribution, communication and feedback among participants and scheme organizer and the internal politics of the participating laboratory (Are the results reviewed and discussed? If necessary, are improvements initiated?).40 Participation of the laboratories in EQA schemes is required by the accreditation bodies. In this context, it is important that scoring results from participation on EQA schemes are transparent to the laboratories and the accreditation bodies. Poor performance must be subject to a careful Fig. 3 Performance evaluation in external quality assessment. When the laboratory result is outside the acceptance range (shaded area) the laboratory performance will traditionally be deemed ‘unacceptable’. However, if the EQA evaluation takes notice of the uncertainty of the laboratory result (illustrated by the normal distribution) the laboratory performance should rightfully be deemed ‘acceptable’. 10 Analyst, January 1998, Vol. 123examination by the laboratory in order to explain what caused the bad result. The importance of harmonization of existing schemes with respect to performance score must be stressed as this factor imposes a major instigation for improvement of laboratory performance. Further steps in the harmonization of EQA schemes covering trace elements in clinical chemistry should involve harmonization of acceptability limits for results and expected standard deviation for analytes of major concern, i.e., those for which biological exposure indices have been established.In view of the importance of EQA schemes in relation to the accreditation process, the need for organizers of EQA schemes to adhere to an internationally accepted protocol and to become either accredited or certified will be adressed in the future. Today numerous national EQA schemes exist covering e.g., the parameter lead in blood.41 Collaboration among EQA scheme organizers would possibly reduce the number of EQA schemes with a small number of participants leaving resources for EQA schemes to cover less common parameters like different element species.The visible effect of the quality work applied to analytical chemistry is unfortunately affected by the unacceptable high number of human errors. In a recent interlaboratory study we experienced that approximately 5% out of 2462 reported results were affected by human errors, mostly simple calculation errors and reporting of wrong units of measurement.Blunders were reported by 25% of the participating laboratories. In this context, the underlying philosophy of continuous quality improvement from TQM seems to be a valuable step forward. It may be expected that the number of blunders occurring in analytical measurements will decrease if the analytical laboratories implement TQM Conclusion Future demands of laboratories working in the field of clinical chemistry are implementation of traceability and uncertainty, the two indispensable concepts in metrology.Measurement results are no longer acceptable without a statement of a standard uncertainty. Participation in EQA is required in accreditation and, therefore, EQA scheme organizers should adhere to an internationally recognized and harmonized protocol thus providing more transparency in the results to the laboratories and accreditation bodies.With the implementation of traceability and uncertainty and with revised evaluation of laboratory performance in EQA schemes, the field of clinical chemistry will be entering a new era based on sound metrology rather than just comparability. References 1 International Standards Organisation, Accuracy (Trueness and Precision) of Measurement Methods and Results. Part 1: General Principles and Definitions, ISO Standard 5725-1, ISO, Geneva, 1994. 2 Broderick, B. E., Cofino, W. P., Cornelis, R., Heydorn, K., Horwitz, W., Hunt, D. T. E., Hutton, R. C., Kongston, H. M., Muntau, H., Baudo, R., Rossi, D., vaan Raaphorst, J. G., Lub, T. T., Schramel, P., Smyth, F. T., Wells, D. E., and Kelly, A. G., Mikrochim. Acta, 1991, II, 523. 3 Wernimont, G. T., Use of Statistics to Develop and Evaluate Analytical Methods, ed. Spindley, W., Association of Official Analytical Chemists, Arlington, VA, 1985. 4 Christensen, J. M., Poulsen, O. M., and Anglov, T., in Handbook on Metals in Clinical and Analytical Chemistry, ed. Seiler, H. G., Sigel, A., and Sigel, H., Marcel Dekker, New York, 1994, pp. 45–46. 5 Christensen, J. M., Mikrochim. Acta, 1996, 123, 231. 6 International Standards Organisation, Control Charts - General Guide and Introduction, ISO 7870, ISO, Geneva, 1993. 7 International Standards Organisation, Control Charts for Arithmetic Means and Warning Limits, ISO 7873, ISO, Geneva, 1993. 8 International Standards Organisation, Acceptance Control Charts, ISO 7966, ISO, Geneva, 1993. 9 International Standards Organisation, Shewhart Control Charts, ISO 8258, Geneva, 1991. 10 Thompson, M., and Wood, R., Pure Appl. Chem., 1995, 67, 649. 11 International Standards Organisation, Uses of Certified Reference Materials, ISO Guide 33, ISO, Geneva, 1989. 12 Cornelis, R., Mikrochim. Acta, 1991, III, 37. 13 General criteria for the operation of testing laboratories, Committ�e Europ�een de Normalisation/Committ�e Europ�een de Normalisation Electrotechnique, Brussels, EN 45001, 1989. 14 Christensen, J. M., and Olsen, E., Ann. Ist. Super. Sanit`a, 1996, 32, 285. 15 European Commission, Guidelines for the Production and Certification of BCR Reference Materials, Doc. BCR/48/93, Commission of the European Community, Brussels, 1994. 16 Taylor, B. N., and Kuyatt, C. E., Guidelines for evaluating and expressing the uncertainty of NIST measurement results.NIST Technical Note 1297, 1994 edn., United States Department of Commerce, National Institute of Standards and Metrology, Gaithersburg, MD. 17 Lamberty, A., Van Nevel, L., Moody, J. R., and De Bievre, P., Accred. Qual. Assur., 1996, 1, 71. 18 Bureau International des Poids et Mesures, International Electrochemical Commision, International Federation of Clinical Chemistry, International Organization for Standardization, International Organization for Pure and Applied Chemistry, International Organization for Pure and Applied Physics and International Organization of Legal Metrology, International Vocabulary of Basic and General Terms in Metrology, ISO, Geneva, 1993. 19 Christensen, J. M., Kristiansen, J., Heydorn, K., Damsgaard, E., and Cornelis, R., IAEA meeting report, in the press. 20 Klich, H., in Quality Assurance and TQM for Analytical Laborato. Parkany, M., The Royal Society of Chemistry, Cambridge, 1995, pp. 80–85. 21 Rasberry, S., ISO/REMCO, ISO, Geneva, 1995. 22 International Standards Organisation, Contents of Certificates of Reference Materials, ISO Guide 31, ISO, Geneva, 1981. 23 International Standards Organisation, International Organization for Standardization, ISO Guide 34, ISO, Geneva, 1996. 24 International Standards Organisation, Certification of Reference Materials—General and Statistical Principles, ISO Guide 35, ISO, Geneva, 1989. 25 Taylor, J. K., Handbook for SRM Users, ed. Trahey, N. M, United States Department of Commerce, National Institute of Standards and Metrology, Gaithersburg, MD, 1993. 26 Kristiansen, J., Christensen, J. M., Lillemark, L., Linde, S. A., Merry, J., Nyeland, B., and Petersen, O., Fresenius’ J. Anal. Chem., 1995, 352, 157. 27 Bureau International des Poids et Mesures, International Electrochemical Commission, International Federation of Clinical Chemistry, International Organization of Standardization, International Union of Pure and Applied Chemistry, International Union of Pure and Applied Physics and International Organization of Legal Metrology, Guide to the Expression of Uncertainty in Measurement, ISO, Geneva, 1993. 28 Kristiansen, J., Christensen, J. M., and Nielsen, J. L., Mikrochim. Acta, 1996, 123, 241. 29 Kristiansen, J., and Christensen, J. M., Ann. Clin. Biochem., in the press. 30 European cooperation for Accreditation of Laboratories, European Confederation of Laboratory Medicine, Publication EAL-G25, Accreditation for Medical Laboratories, EAL/ECLM, 1997. 31 International Standards Organisastion, General Requirements for the Competence of Testing and Calibration laboratories, ISO/IEC Guide 25, ISO, Geneva, 1990. 32 Proficiency Testing by Interlaboratory Intercomparisons—Part 1: Development and Operation of Proficiency Testing Schemes—Part 2: Selection and Use of Proficiency Testing Schemes by Laboratory Accreditation Bodies, ISO, Geneva, 1996. 33 Thompson, M., and Wood, R., Pure Appl. Chem., 1993, 65, 2123. 34 Uldall, A., EQAnews, 1996, 8, 3. Analyst, January 1998, Vol. 123 1135 Cornelis, R., Heinzow, B., Herber, R. F. M., Molin Christensen, J., Poulsen, O. M., Sabbioni, E., Templeton, D. M., Thomassen, Y., Vahter, M., and Vesterberg, O., Pure Appl. Chem., 1995, 67, 1575. 36 van de Leemput, P. J. H. A. M., Accred. Qual. Assur., 1997, 2, 263. 37 Good Automated Laboratory Practices, U.S. Environmental Protection Agency, North Carolina, 1995. 38 International Standards Organisation, Quality Systems—Model for Quality Assurance in Design, Development, Production, Installation and Servicing, ISO 9001, ISO, Geneva, 1994. 39 International Standards Organisation, Quality Systems—Model for Quality Assurance in Production, Installation and Servicing, ISO 9002, ISO, Geneva, 1994. 40 Taylor, A., Mikrochim. Acta, 1996, 123, 251. 41 Taylor, A., Patriarca, M., Menditto, A., and Morisi, G., Ann. Ist. Super Sanit`a, 1996, 32, 295. Paper 7/06358J Received September 1, 1997 Accepted October 29, 1997 12 Analyst, January 1998, Vol. 123

ISSN:0003-2654    

DOI:10.1039/a706358j

出版商:RSC    

年代:1998

数据来源: RSC

摘要:

Chemical speciation of arsenic in serum of uraemic patients† Xinrong Zhanga, Rita Cornelis*a, Louis Meesa, Raymond Vanholderb and Norbert Lameireb a Laboratory for Analytical Chemistry, Institute for Nuclear Sciences, University of Ghent, Proeftuinstraat 86, B-9000 Ghent, Belgium b Renal Division, Department of Medicine, University Hospital, De Pintelaan 185, B-9000 Ghent, Belgium Chemical speciation of arsenic was carried out in serum of a total of 51 uraemic patients: 19 non-dialysis (ND), 18 haemodialysis (HD) and 14 continuous ambulatory peritoneal dialysis (CAPD) patients.The low molecular mass As species were separated by ion-exchange liquid chromatography and measured on-line by hydride generation atomic absorption spectrometry (HGAAS). The high molecular mass As species were separated by fast protein liquid chromatography, either size-exclusion, ion-exchange or affinity chromatography, and the fractions were digested and measured off-line with HGAAS.The mean total As concentrations in the serum of the three groups of the uraemic patients were significantly higher than the reference value (6.47 ± 4.28, 5.12 ± 5.58 and 4.67 ± 5.41 mg l21 for HD, ND and CAPD patients, respectively, versus the reference value of 0.96 ± 1.52 mg l21). The major As species in serum of the patients were dimethylarsinic acid (DMA) and arsenobetaine. The HD patients showed a significantly higher mean DMA level than ND and CAPD patients. No selective removal of different As species in serum of HD patients was observed after 4 h of haemodialysis.The inorganic As species in serum were bound to proteins, mainly transferrin (about 5–6% of total As in serum). This binding may play an important role in arsenic detoxification. Keywords: Speciation; serum arsenic; uraemic patients; dialysis; liquid chromatography; hydride generation atomic absorption spectrometry It is well known that the kidneys act as filters to remove toxic waste products from the blood via glomerular filtration.Reabsorption and secretion processes on plasma membranes of the epithelial cells allow useful metabolites and electrolytes to be conserved and waste products to be excreted. For patients who suffer from chronic renal diseases, toxic waste products cannot be excreted efficiently, and increased concentrations of trace elements in the blood of such patients has been documented. 1–9 Zhang et al.3 reported a threefold increase in the mean arsenic concentration in serum and a twofold increase in that in packed cells of uraemic patients compared with controls.3 Similar results were also reported by Giovannetti et al.8 in uraemic plasma.A higher accumulation of arsenic in plasma and packed blood cells of haemodialysis and haemodiafiltration patients have been found by De Kimpe et al.,4 Brune et al.9 and Van Renterghem et al.5 A relationship between arsenic levels and the concentration of serum creatinine in the serum of the patients has also been reported.3 Although considerable efforts have been made to study arsenic accumulation in chronic renal patients, the toxic effects of arsenic are still not entirely understood because most publications give information only about total arsenic concentrations in body fluids.3–9 The toxicology of arsenic is complicated by its ability to convert between oxidation states and different organometallic forms.10,11 These processes cause differences in the relative affinity of the various arsenic species bound to tissues, and they determine both the intoxication and detoxification mechanisms.For instance, the transformation of arsenate into dimethylarsinic acid is very important because this process is believed to be the principal detoxification mechanism. 12 It has also been suggested that during the methylation process, intermediates of arsenite and As–protein molecules are formed that, if allowed to accumulate, could be more (for arsenite) or less (for As–protein molecules) toxic than arsenate. 13,14 In order to understand the mechanism of arsenic intoxication and detoxification more clearly, speciation studies are obviously the primary and necessary step. The purpose of this work was to use different types of liquid chromatographic techniques coupled to hydride generation atomic absorption spectrometry (HGAAS) for the speciation of As species in serum of three types of uraemic patients: nondialysis (ND), haemodialysis (HD) and continuous ambulatory peritoneally dialysis (CAPD) patients.This is expected to provide a better insight into the accumulation of the different As species. Moreover, this study will allow one to compare the levels of toxic As species between patients with and without dialysis treatment. These data may be helpful in evaluating the risk of As accumulation for patients with chronic renal insufficiency. Experimental Sample collection and pre-treatment Blood samples from 19 uraemic ND, 18 HD and 14 CAPD patients were collected at the Nephrology Department of the University Hospital, Ghent.The patients gave their informed consent. They were requested to abstain from sea-food intake during the 3 d before the blood collection. The first 25 ml of blood were preserved for routine clinical laboratory tests. The subsequent samples for As analysis were collected in carefully cleaned high-purity quartz tubes, which were immediately covered with Teflon stoppers, returned to an air-tight plastic transport container and transported to a dust-free room (class 100). After clotting, serum and packed cells were separated by centrifugation of the tubes at 1000 g.Deproteinization was carried out by ultrafiltration on membranes with a 10 kDa molecular mass cut-off (Filtron Microsep, Filtron Technology, Northborough, MA, USA). The ultrafiltrate was submitted to speciation of low molecular mass (LMM) As species.The high molecular mass (HMM) As species were determined in the original serum samples without undergoing deproteinization. † Presented at The Sixth Nordic Symposium on Trace Elements in Human Health and Disease, Roskilde, Denmark, June 29–July 3, 1997. Analyst, January 1998, Vol. 123 (13–17) 13Reagents and apparatus Arsenic species standards of monomethylarsonic acid (MMA), dimethylarsinic acid (DMA), arsenobetaine (AsB) and arsenocholine (AsC) were provided by the Commission of the European Union, DGXII, Measurements and Testing Programme (Brussels, Belgium).Sodium arsenite and arsenate were obtained from Merck (Darmstadt, Germany). A 2% m/v solution of sodium tetrahydroborate (Janssen Chimica, Beerse, Belgium) in 0.05% m/v NaOH (UCB, Leuven, Belgium) was freshly prepared every day and filtered prior to use. A 2 mol l21 HCl solution was prepared from concentrated HCl (32% m/v) purified under sub-boiling conditions.Two types of HPLC columns were used for the separation of LMM anionic and cationic As species:15,16 a silica-based anionexchange column (Supelcosil LC-SAX, 250 3 4.6 mm id). (Supelco, Bellefonte, PA, USA) and a polystyrene–divinylbenzene- based cation-exchange column (Ionpac) CS 10, 250 3 4 mm id) (Dionex, Sunnyvale, CA, USA). A low-pressure UV lamp (6 W, 12 3 3 cm id) (Philips, Eindhoven, The Netherlands) was applied for on-line sample digestion. A fast protein liquid chromatographic (FPLC) system (Pharmacia, Uppsala, Sweden) with three types of columns was used for the separation and identification of As–protein binding:17 sizeexclusion (SEC) (Superose HR 10/30 analytical column and Sephadex G-50 XK 50/30 preparative column); anion-exchange (IEC) (MonoQ HR 16/10) and affinity (NHS-activated HiTrap Superose HR 10/2, coupled with goat anti-human transferrin).The HPLC mobile phase for the separation of LMM As species by cation exchange was prepared with an aqueous solution of 100 mmol l21 HCl and 50 mmol l21 NaH2PO4·H2O (Merck).The mobile phase for the separation of LMM As species in anionic form was prepared with an aqueous solution of 30 mmol l21 NaH2PO4 without pH adjustment. The mobile phases for the separation of HMM As species were 0.025 mol l21 TRIS–HCl (pH 7.4) for SEC and 0.025 mol l21 TRIS– HCl (pH 8.0) in a linear NaCl gradient (0–0.5 mol l21) for IEC. The buffer solutions used for affinity chromatography were as follows: buffer A, 0.2 mol l21 NaHCO3–0.5 mol l21 NaCl (pH 8.3) for ligand coupling; buffer B, 1 mol l21 ethanolamine in buffer A for deactivation of excess NHS groups; buffer C, 75 mmol l21 TRIS–HCl (pH 8) for affinity absorption; and buffer D, 0.5 mol l21 glycine–HCl (pH 2.0) for desorption of transferrin from the column.A Perkin-Elmer (Norwalk, CT, USA) Model 3030 atomic absorption spectrometer with an arsenic electrodeless discharge lamp, operating at a power of 8 W, was used throughout for the detection of arsenic signals.The wavelength was set at 193.7 nm with a spectral slit-width of 0.7 nm. A FIAS 200 flowinjection system (Perkin-Elmer) was used to generate the hydride. The temperature of the quartz tube atomizer was set at 900 °C. Commercial reagents (Boehringer, Mannheim, Germany) and a Model 747 analyser (Hitachi, Tokyo, Japan) were used for the determination of serum creatinine. The serum creatinine levels in individuals with normal renal function range from 57 to 93 mmol l21 (n = 63, 95% range) and from 50 to 80 mmol l21 (n = 55, 95% range) for men and women, respectively.Statistics Three determinations were performed for each sample. Reagent blanks were processed with the samples. Analytical results were obtained by calculating the mean values of three blank corrected analyses of each sample. Values lower than the detection limits were statistically considered as zero. The differences between the results were analysed by Student’s t-test (normal distribution) and the Mann–Whitney U-test (distribution-free), using the p-value as a judgment of significance.The Shapiro–Wilk test was used for goodness of fit. Stated values were considered significantly different for p < 0.05. Correlation was calculated and tested by the Pearson test. All these statistics were executed by the program UNITSTAT. Quality controls The accuracy for total As determination was tested by the determination of arsenic in a certified freeze-dried reference serum from the University of Ghent.18 The accuracy for As speciation was tested by the determination of arsenic in the BCR candidate Reference Material CRM 526 tunafish tissue.Table 1 summarizes the arsenic concentrations in the reference materials obtained in this work and the certified values. No significant differences were established by the paired t-test at the 95% confidence level for all three reference materials.The results demonstrate that the proposed method is accurate for the determination of the arsenic concentrations. The detection limits, estimated as three times the standard deviation of the blank, were 0.031 (total As), 1.0 (AsIII), 1.5 (AsV), 1.0 (MMA), 1.3 (DMA), 1.5 (AsB) and 1.5 mg l21 (AsC) in serum. The blank obtained by injection of a blank digested solution gave a mean signal of 0.003 absorbance, which corresponds to a concentration of 0.05 mg l21 total As.Results and discussion Speciation of LMM As species Mean concentrations The mean (±s) total As levels in the 19 uraemic ND, 18 HD and 14 CAPD patients are 5.12 ±5.58, 6.47 ±4.28 and 4.67 ±5.41 mg l21, respectively, all significantly higher (p < 0.001) than the reference values of 0.96 ±1.52 mg l21 in serum of healthy subjects (n = 23), indicative of a significant accumulation of arsenic in the serum of the uraemic patients. The mean (±s) DMA concentrations in serum of ND and CAPD patients are 0.82 ±1.05 mg l21 (16.0% of total As) and 0.71 ±1.05 mg l21 (15.2% of total As), respectively, but a significantly higher DMA value of 1.93 ±1.51 mg l21 (29.8% of total As) was observed in the serum of HD patients (p < 0.02), indicative of the accumulation of this As species.DMA is a methylated metabolite of inorganic As, which is less toxic than inorganic As species. The methylation of inorganic As in mammals is a detoxification mechanism. Normally, DMA is rapidly excreted in the urine through the kidney.For HD patients, this function is only partially replaced by the HD treatment. The higher DMA level in HD patients compared with ND and CAPD patients apparently indicates that this treatment is of more limited effect for the removal of this As species from the blood of HD patients. The mean (±s) AsB concentrations in serum of ND, HD and CAPD patients are 3.55 ±4.58, 3.47 ±2.89 and 3.56 ±4.27 mg l21, respectively. Compared with the level of 0.96 mg l21 of total As in healthy subjects, the mean levels of AsB in the serum Table 1 Arsenic concentrations measured in certified reference materials Mean ± CI, 95% Reference As species Reference material and units This work (n = 5) values Certified freezedried reference serum Total/mg kg21 17.5 ± 2.2 19.6 ± 4.0 CRM-526 tunafish tissue Total/mg g21 4.7 ± 0.1 4.8 ± 0.3 AsB/mmol kg21 53.3 ± 2.6 51.5 ± 2.1 DMA/mmol kg21 2.19 ± 0.14 2.04 ± 0.27 14 Analyst, January 1998, Vol. 123of the three groups were markedly increased. However, we did not observe any differences between them. These results may indicate that AsB species in the serum of uraemic patients is affected by food intake, which may be sea-food but also fish derivatives in processed food or meat of animals fed on fishmeal. All this was difficult to control in the present survey. Table 2 summarizes the results for different As species in the serum of uraemic ND, HD and CAPD patients. Unfortunately, the concentrations of As species in the serum of a reference group of healthy subjects could not be measured in the present study because they lie below the detection limits of the present coupled technique.To our knowledge, no As speciation in serum of healthy controls has ever been published. A further improvement in the methodology of As speciation is obviously needed in the future. Correlations To establish whether the accumulation of As species in serum of uraemic patients proceeds in parallel with the progression of renal failure, the correlations between As species and creatinine levels in the serum of the 51 patients were studied.As shown in Fig. 1, the concentrations of creatinine are correlated with the concentrations of DMA species (r = 0.46, p = 0.004). No correlation was observed, however, between the creatinine levels and AsB species concentrations (r = 0.065, p = 0.33). This is because the AsB concentration in serum of an individual at any given moment is related to two factors: the amount of AsB intake from foodstuffs and the rate of AsB excretion from the kidney.A very high concentration of AsB species can be detected in blood samples of an individual with normal renal function, just after ingestion of sea-food high in As. It is difficult, therefore, to obtain the correlation between serum creatinine and AsB concentration. The effects of sex and age on the As accumulation were also studied.No significant sex-specific variations in arsenic concentrations can be observed for DMA, AsB and total As (p > 0.05). Table 3 lists the mean As levels and p-values for males and females. On dividing the patients according to age, most patients belonged to the age groups 40–60 (n = 19) and 60–80 years (n = 29). Only three patients were in the group 20–40 years. No significant age-specific variations in arsenic concentrations could be observed for DMA, AsB and total As in the two major groups (p > 0.05).Table 3 lists the mean As levels and p-values in these two groups. From these data, we can conclude that As accumulation is dependent on the degree of renal insufficiency but not on sex or age. As concentration changes before versus after dialysis To evaluate whether the selective accumulation of DMA in HD patients is dependent on the selective removal of this species, the percentage removal of the different As species by haemodialysis was determined. The results show that 4 h of dialysis removed a mean (±s) of 67.7 ±4.78% of total As, 66.5 ±8.18% of AsB and 66.8 ±4.27% of DMA.No significant differences (p > 0.05) were observed among the efficiencies of removal of total As, AsB and DMA as a result of the HD treatment. As no selective removal of different As species occurs, a possible hypothesis about the DMA accumulation in HD patients could be the longer residence time of inorganic As, because HD treatment is only an intermittent process.This longer residence time of inorganic As in patients’ bodies may increases the amount of in vivo methylation and so result in increased serum DMA concentrations, as illustrated in Fig. 2, where V1 is the rate of DMA formation by the methylation of inorganic As species, V2 is the rate of renal excretion of DMA and Vt is a sum of DMA formation rates. As no renal excretion but only an intermittent treatment can be carried out for the removal of DMA in the serum of HD patients, V2?minimum and Vt?maximum.A long residence of the inorganic As species in HD patients causes an accumulation of the DMA species. Fig. 1 Correlation between DMA concentrations and creatinine levels in the serum of 51 uraemic patients. Table 2 Concentrations of As species in serum of uraemic patients (n = 51) As concentration/mg l21 Uraemic non-dialysis patients Haemodialysis patients Continuous ambulatory peritoneal (n = 19) (n = 18) dialysis patients (n = 14) As species DMA AsB Total As DMA AsB Total As DMA AsB Total As Range < DL–2.60 < DL–20.3 0.50–24.8 < DL–6.9 < DL–9.4 1.6–17.5 < DL–4.16 < DL–15.4 0.3–20.6 Median < DL 2.50 3.90 1.60 2.80 4.60 < DL 1.87 2.65 Mean 0.82 3.55 5.12 1.93 3.47 6.47 0.71 3.56 4.67 s 1.05 4.58 5.58 1.51 2.89 4.28 1.05 4.27 5.41 As (%) 16.0 69.3 100 29.8 53.6 100 15.2 76.2 100 Table 3 Comparisons of As species in the serum of male and female patients and in the serum of the two major age groups of patients Mean ± s Total DMA/mg l21 AsB/mg l21 As/mg l21 Males (n = 22) 1.23 (1.23) 4.16 (5.17) 6.12 (6.31) Females (n = 29) 1.15 (1.44) 3.04 (2.66) 4.99 (4.05) p 0.72 0.86 0.70 60–80 years (n = 29) 1.13 (1.17) 3.49 (4.85) 5.26 (5.97) 40–60 years (n = 19) 1.34 (1.65) 3.46 (2.29) 5.54 (3.92) p 0.84 0.18 0.13 Analyst, January 1998, Vol. 123 15As-inorganic As-protein via intermediate of As(lll) DMA DMA V1 V1 V2 V2 = V1– V2 Vt minimum maximum When (Vt: Sum of DMA formation rates) By comparing the efficiency of As removal from serum with that from packed cells, we found that HD treatment was of very limited clinical effectiveness for As in packed cells.Compared with a mean of 67.7% for total As removal from serum, only 15.7% of total As was removed from packed cells of six patients after 4 h of HD treatment. Speciation results were not achieved in packed cells, however, as only 5–10-fold diluted packed cells lysate could be processed on the column.The concentration of the As species in most samples became lower than the detection limit after this dilution. For this reason, it is still unclear whether DMA was selectively accumulated or removed from packed cells. A more sensitive method suitable for the speciation of As species in packed cells is obviously needed for future work. The changes in total As, AsB and DMA in the dialysate of CAPD patients before versus after 24 h dialysis treatment were also studied.A very low As level was found in fresh dialysate (0.04 mg l21). The mean (±s) concentrations were, however, increased to levels of 3.98 ±4.91 mg l21 total As, 0.59 ±0.87 mg l21 DMA and 3.06 ±3.96 mg l21 AsB in 24 h dialysate. No significant differences in As levels were found between serum and drained dialysate after 24 h of dialysis (p = 0.45, 0.60 and 0.58 for total As, DMA and AsB, respectively). Analyses for total As and As species were carried out on each of the four exchanges of CAPD dialysate.No significant differences in concentrations were observed during the day for the same patient. The calculation of the distribution of the total amount of arsenic in serum, packed cells, dialysate and urine shows that 53% of the total amount of arsenic was removed into dialysate in 24 h, but only 10% into urine in 24 h. Failure of renal function causes a dramatic decrease in urinary As excretion. Speciation of HMM As species To identify the As species that bind to proteins in the serum of uraemic patients, three sera from CAPD patients were further studied. CAPD is a continuous treatment and therefore more similar to the clearing by the human kidney compared with HD treatment.The number of patients is limited because of the difficult and delicate nature of the experiments, excluding even the feasibility of a large survey for all kinds of patients. Determination of As–protein concentration by ultrafiltration The LMM As species in the serum of the 14 CAPD patients was preliminarily separated from the serum matrix by ultrafiltration.The As–protein concentrations were calculated by subtracting the concentrations of LMM As species from the total As concentrations. The mean concentration (±s) of As bound to protein molecules was 0.26 ±0.38 mg l21, accounting for 5.57% of total As in the serum (4.67 mg l21). Speciation of As–protein binding by SEC Considering that the results obtained by ultrafiltration are based on an indirect calculation, further identification of the As– protein binding in the serum of three patients with higher As concentrations was carried out by SEC.After SEC separation, arsenic was distributed into two peaks. The first peak contained HMM As species with a molecular mass of about 80 kDa and the second peak contained the LMM As species with a molecular mass of < 1 kDa. We assumed that the protein molecules and the As, detected in the same fraction, are associated with one another.The concentrations (±s) of As bound to proteins in serum for the three patients were 0.44 ±0.12, 0.19 ±0.09 and 0.59 ±0.09 mg l21, respectively. In vitro incubation of the five As species, i.e., AsIII, AsV, MMA, DMA and AsB, with serum showed that As–protein binding can only take place between inorganic As and serum proteins. On incubating 10 ng of inorganic As species with 1 ml of serum at 37 °C for 24 h, the extents of As–protein binding were 6.5 and 5.3% for AsV and AsIII, respectively. Speciation of the proteins bound to As species by IEC The SEC used in the present study is sufficient for the separation of LMM from HMM As species, but this method does not allow an adequate separation of proteins with small differences in molecular mass.The identification of the serum proteins bound to As species was therefore carried out on an anion-exchange column (MonoQ HR 16/10), because this column shows a high resolution for the separation of serum proteins. As the LMM AsIII species, carrying the same apparent charges as the macromolecules, eluted together with the protein molecules on this column, a pre-separation of the LMM As species from HMM As species by SEC was carried out before submitting the sample to anion-exchange chromatography.This separation removes the interference of AsIII with As–protein molecules. The chromatograms showed nine distinct protein regions (Fig. 3). Isoelectric focusing of the protein peaks revealed the nature of the different proteins in each peak. Peaks 4 and 5 are transferrin which may exist in two different forms: asialo- and sialo-transferrin, with iron in different sites of the molecules. Albumin is mainly situated in peaks 6 and 7, and to a lesser extent also in peaks 8 and 9. The arsenic distribution over the different fractions containing proteins was measured by Fig. 2 Schematic illustration of DMA accumulation in the serum of uraemic patients.V1 = the rate of DMA formation from inorganic As molecules and V2 = the rate of renal excretion of DMA. For HD patients, V2 ? 0 and the DMA concentration was therefore increased in the serum. Fig. 3 Chromatogram for the separation of human serum using an anionexchange column (MonoQ HR 16/10; eluent 0.025 mol l21 TRIS–HCl at pH 8 in a linear NaCl gradient from 0 to 0.5 mol l21). Peaks 4 and 5 contain transferrin; peaks 7 and 8 contain albumin. 16 Analyst, January 1998, Vol. 123HGAAS. Almost all of the As molecules were distributed over the fractions containing transferrin (peaks 4 and 5). No arsenic was detected in the fractions containing albumin. Identification of As–transferrin binding by affinity chromatography Considering the occurrence of arsenic together with transferrin in the same fractions, it was useful to look for further proof of the statement that arsenic is bound to serum transferrin. Therefore, affinity chromatography based on the immunoassay of transferrin–antitransferrin was applied.As expected, only transferrin and As–transferrin molecules were absorbed on the columns. After desorption, the fractions obtained from five repetitive elutions were collected in quartz tubes and digested and As was measured. The results showed that arsenic is indeed bound to serum transferrin. As no arsenite and arsenate were detected in the LMM fractions in serum from uraemic patients, serum transferrin may play a role as a biological storage site or reservoir in human blood to prevent arsenite-inhibitable metabolic reactions and arsenate-substitutable reactions in ATP formation prior to methylation. It is also possible that the toxic inorganic As species, transported by transferrin, go to the target sites including bone marrow, causing adverse effects. Further study is obviously needed to understand the detoxication/intoxication of As–transferrin molecules in the serum of uraemic patients.References 1 Zhang, X., Cornelis, R., De Kimpe, J., Mees, L., and Lameire, N., Clin. Chem., 1997, 43, 406. 2 Zhang, X., Cornelis, R., De Kimpe, J., Mees, L., Vanderbiesen, V., De Cubber, A., and Vanholder, R., Clin. Chem., 1996, 42, 1231. 3 Zhang, X., Cornelis, R., De Kimpe, J., Mees, L., Vanderbiesen, V., and Vanholder, R., Fresenius’ J. Anal. Chem., 1995, 353, 143. 4 De Kimpe, J., Cornelis, R., Mees, J., Van Lierde, S., and Vanholder, R., Am. J. Nephrol., 1993, 13, 429. 5 Van Renterghem, D., Cornelis, R., and Vanholder, R., J. Trace Elem. Electrolytes Health Dis., 1992, 6, 169. 6 Astrug, A., Kuleva, V., Kiriakov, Z., Tomov, A., and Djingova, R., Trace Elem. Med., 1984, 1, 65. 7 Alvadeo, A., Minoia, C., Segagni, S., and Villa, G., Int. J. Artif. Organs, 1977, 2, 17. 8 Giovannetti, S., Maggiore, Q., and Malvano, R., Nuclear Activation Techniques in the Life Sciences, IAEA Vienna, 1967, pp. 511–515. 9 Brune, D., Samsahl, K., and Wester, P. O., Clin. Chim. Acta, 1966, 13, 285. 10 Vahter, M., in Biological Monitoring of Toxic Metals, ed. Clarkson, T. W., Friberg, L., Nordberg, G. F., and Sager, P. R., Plenum Press, New York, 1988, pp. 303–321. 11 Shiomi, K., in Arsenic in the Environment, Part II: Human Health and Ecosystem Effects, ed. Nriagu, J. O., Wiley, New York, 1994, pp. 261–282. 12 Thompson, D. J., Chem. Biol. Interact., 1993, 88, 89. 13 Vahter, M., and Envall, J., Environ. Res., 1983, 32, 14. 14 Vahter, M., and Marafante, E., in The Biological Alkylation of Heavy Elements, ed. Craig, P. J., and Glockling, F., Special Publication No. 66, Royal Society of Chemistry, London, 1988, pp. 105–119. 15 Zhang, X., Cornelis, R., De Kimpe, J., and Mees, L., J. Anal. At. Spectrom., 1996, 11, 1075. 16 Zhang, X., Cornelis, R., De Kimpe, J., and Mees, L., Anal. Chim. Acta, 1996, 319, 177. 17 Zhang, X., Cornelis, R., De Kimpe, J., Mees, L., and Lameire, N., Clin. Chem., in the press. 18 Versieck, J. Vanballenberghe, L., De Kesel, A., Hoste, J., Wallaeys, B., Vandenhaute, J., Baeck, N., Steyaert, H., Byrne, A. R., and Sunderman, F. R., Jr., Anal. Chim. Acta, 1988, 204, 63. Paper 7/04841F Received July 8, 1997 Accepted September 9, 1997 Analyst, January 1998, Vol. 123 17

ISSN:0003-2654    

DOI:10.1039/a704841f

出版商:RSC    

年代:1998

数据来源: RSC

摘要:

Risk assessment in relation to neonatal metal exposure† Agneta Oskarssona, Ira Palminger Hall�enb, Johanna Sundbergc and Kierstin Petersson Graw�ec a Department of Food Hygiene, Faculty of Veterinary Medicine, Swedish University of Agricultural Sciences, Box 7009, SE-75007 Uppsala, Sweden b Safety Assessments 681/RSR, Astra AB, SE-15185 S�odert�alje, Sweden c Toxicology Division, National Food Administration, Box 622, SE-75126 Uppsala, Sweden Rapid changes in organ development and function occur during the neonatal period.During this period the central nervous system is in a rapid growth rate and highly vulnerable to toxic effects of, e.g., lead and methylmercury. Furthermore, the kinetics of many metals is age-specific, with a higher gastrointestinal absorption, less effective renal excretion as well as a less effective blood-brain barrier in newborns compared to adults. Due to their low body weight and high food consumption per kg of body weight, the tissue levels of contaminants can reach higher levels in newborns than in adults.Generally, there is a low transfer of toxic metals through milk when maternal exposure levels are low. However, knowledge is limited about the lactational transport of metals and the potential effects of metals in the mammary gland on milk secretion and composition. There are some data from rodents on the lactational transfer and the uptake in the neonate of inorganic mercury, methylmercury, lead and cadmium.Metal levels in human breast milk and blood samples from different exposure situations can give information on the correlation between blood and milk levels. If such a relationship exists, milk levels can be used as an indicator of both maternal and neonatal exposure. Better understanding of the neonatal exposure, including kinetics in the lactating mother and in the newborn, and effects of toxic metals in different age groups is needed for the risk assessment.Interactions with nutritional factors and the great beneficial value of breast-feeding should also be considered. Keywords: Lead; mercury; cadmium; neonate; infant; developmental effects; breast milk; risk assessment As an end-point of risk assessment of food additives and contaminants, the acceptable or tolerable daily intake is established. The definition by the Joint FAO/WHO Expert Committee on Food Additives of acceptable daily intake1 is ‘an estimate of the amount of a food additive, expressed on a body weight basis, that can be ingested daily over a lifetime without appreciable health risk’.For toxic metals the concept of ‘provisional tolerable weekly intake’ (PTWI) is used to express that these compounds have no intended function, are accumulated over time and the evaluation is tentative due to the paucity of reliable data.1 For risk assessment of metals during infancy it is important to recognise that the child is not a small adult. The early postnatal period is characterized by rapid growth and development, the child has unique metabolic and physiological pathways and has a different exposure pattern than the adult.2,3 With this in mind, it is surprising that newborns and lactating women are generally not recognized as risk groups in risk assessment in a similar way as fetuses and pregnant women are.The susceptibility to toxic agents depends on the substance, the exposure and the age. For risk assessment of a particular substance it would be preferable to differentiate between age groups for exposure assessment, kinetics and adverse health effects. WHO2 has recommended the following definitions for infants and young children: the neonatal period extends from birth to 4 weeks, infancy from 4 weeks to 1 year and young childhood from 1 to 5 years.The present review will focus on exposure patterns and biological differences between neonates/infants and adults with impact on risk assessment (Table 1).Results, mainly from our own studies on the toxic metals lead, mercury and cadmium, will be used as examples. It should be kept in mind, that also other elements, such as arsenic, copper and aluminium, are of concern regarding exposure and effects in neonates and infants. Neonatal exposure to toxic elements The main source of exposure during the neonatal and first part of infancy periods is breast milk. Thus, it is important to study the lactating mother and the special conditions determining the kinetics and transport of toxic elements into breast milk.Kinetics of metals during lactation Lactation represents a stage of altered physiological conditions. The disposition and clearance of chemicals during lactation are major factors determining the breast milk concentration. We have studied the influence of lactation on the kinetics of lead during 10 days after a single intravenous injection in lactating and non-lactating mice.4 The elimination from plasma was more rapid in lactating mice than in those non-lactating.Half lives in plasma were 26 h in lactating and 65 h in non-lactating mice during the terminal phase. Significant differences were revealed with the mean plasma clearance and the volume of distribution being about 3 times higher in lactating mice. Partly, the higher clearance can be explained by an additional route of excretion, namely milk. About 30% of the administered dose † Presented at The Sixth Nordic Symposium on Trace Elements in Human Health and Disease, Roskilde, Denmark, June 29–July 3, 1997.Table 1 Biological characteristics in neonates/infants with implication to risk assessment Exposure— Milk Lacting mother Infant formula/drinking water Kinetics— Absorption Distribution Elimination Effects— CNS Other effects Analyst, January 1998, Vol. 123 (19–23) 19was excreted in milk; however, this accounts only for 1/3 of the total plasma clearance. Increased excretion via the bile during lactation is suggested as a possible explanation.The increase in mammary gland and blood volume probably contributes to the increase in plasma volume of distribution in lactating mice, as well as the exchangeable pool of lead in the bone. In whole blood there was no difference in half lives, demonstrating that more useful data, revealing the kinetic characteristics, are obtained from lead in plasma than from whole blood. In the epidemic of methylmercury poisoning in Iraq, blood clearance half-times of total mercury were significantly shorter in lactating women than in non-lactating females or in males.5 Kinetic parameters for mercury in mice have been determined after intravenous injection of either methylmercuric chloride or inorganic mercuric chloride.6 The demethylation of methylmercury was taken into consideration when estimating the toxicokinetic parameters by determination of the ratio between mercury in plasma and whole blood.Preliminary results indicate that the kinetics can be described by a three compartment model. Significant differences between lactating and non-lactating mice were present for methylmercury, with a higher plasma clearance and a larger volume of distribution in lactating than in non-lactating mice. This may be explained by increased biliary excretion, increased blood/plasma volume and lower content of plasma proteins during lactation. For inorganic mercury there were no evident differences in the kinetics between lactating and non-lactating females.The milk excretion of mercury in mice during 9 days was approximately 4 and 8%, of the administered dose of methylmercury and inorganic mercury, respectively.6 Transport of metals to milk Milk production and secretion is a complex process. Even if the composition of milk differs from one species to another, the mechanisms by which the various milk components are secreted seems to be remarkably similar. There are mainly five pathways for the secretion of milk components.7 1.The exocrine pathway is quantitatively the most important and is similar to other secretory cells. The major milk proteins casein, lactabumin and possibly lactoferrin are synthesized on ribosomes and inserted across the membranes of the rough endoplasmic reticulum and transferred to the Golgi system. Casein combines with calcium and phosphah stabilizes the molecule, and form large aggregates, micelles.The Golgi vesicles with micelles migrate to the apical membrane and release the micelles into the milk alveoli via exocytosis. Lactose, milk citrate and phosphate are also secreted via this pathway. 2. Milk lipids are secreted via this pathway, unique to the mammary gland, involving triglyceride synthesis from precursor fatty acids transported from the plasma or synthesized within the alveolar cell. The triglycerides form large lipid droplets surrounded by a membrane in a complex known as the milk fat globuli, which are extruded from the cell. 3. Small molecules, including sodium, potassium, chloride and glucose can pass across the apical membrane. 4. Immunoglobulins bind to a receptor at the basolateral membrane and are transported by a transcytotic pathway. Probably this pathway also is responsible for the secretion of peptide hormones (prolactin and insulin) and some plasma proteins. 5. Some components may enter the milk via a paracellular pathway, which is tightly closed during full lactation.The transport of xenobiotics into milk is supposed to follow the same pathways as do milk components. However, except for medical drugs, few data are available on the transport of chemicals into milk.8,9 For many drugs, passive diffusion is believed to be the major transport mechanism but also binding to carrier proteins in plasma may play a role. Small, uncharged molecules as well as high lipid solubility and low plasma protein binding are factors that generally favour the transport of chemicals into milk.We have investigated the binding of radioactively labelled lead, cadmium and mercury in milk fractions after administration to rats and mice (Table 2). Each metal is distributed in a characteristic way between the milk fractions. Lead is almost exclusively found in the casein fraction in rat milk, while the highest proportions of cadmium and methylmercury are found in fat whilst inorganic mercury is found mostly in whey fractions.10–12 Toxic elements could be expected to enter milk in a similar way as essential trace elements, but there is limited information available also on the transport of essential elements in milk.13 Iron and copper are believed to be excreted in breast milk by binding to specific or non-specific carrier proteins in plasma.About one-third of the iron in human milk is associated with the low molecular mass fraction, one-third with the milk fat, mainly the outer fat globule membrane and of the remainder, about 10% is found in the casein fraction and a fraction with the unique milk glycoprotein, lactoferrin.14 Zinc and copper in human milk are approximately 75% associated to the whey fraction, 15% to fat and the rest present in casein micelles. The major copper- and zinc-binding protein in whey appears to be serum albumin and some may also be associated with citrate and free amino acids.A pathway, by which lead is transported into milk through the mammary gland has been suggested.15 Studies by X-ray microanalysis of mouse mammary cells showed that lead was associated with casein micelles both inside the secretory cells and in the milk alveolar lumen.Lead has a high affinity to casein and in rat milk 95% and in human milk 60–80% of the lead was bound to casein.10 It is known that calcium is secreted into milk within casein micelles by exocytosis of secretory vesicles derived from the Golgi secretory system and lead is probably transported in a similar way as calcium.The high binding of lead to casein may also explain the differences in the milk excretion of lead between different species. Thus, there is a high excretion of lead in the casein-rich milk from rats and mice and a low excretion in human milk with a low content of casein. Breast milk normally contains trace levels of metals but elevated levels are found after high maternal exposure.16 Blood and milk levels of lead, mercury and cadmium were determined at six weeks after delivery in women living in the surroundings of a copper and lead smelter and in a control area in the north of Sweden (Table 3).In general, the levels were low and for lead and cadmium there was no significant correlation between the levels in milk and blood.17 However, significant relationships Table 2 Distribution of metals in milk fractions after administration of metal salts to lactating rats or mice10–12 Metal Fat (%) Casein (%) Whey (%) Pb 2 96 2 Cd 49 43 7 Hg, inorganic 15 31 41 MeHg 39 11 34 Table 3 Concentrations* of Pb, Cd and Hg in milk and blood in women at 6 weeks after delivery (mg l21)17,18 Milk Blood Pb 0.7 ± 0.4 32 ± 8 Cd 0.06 ± 0.04 0.9 ± 0.3 Hg 0.6 ± 0.4 2.3 ± 1.0 * Mean ± s, n = 75 for Pb and Cd; n = 30 for Hg. 20 Analyst, January 1998, Vol. 123were found for both total and inorganic mercury, but not for organic mercury, in milk and blood.18 The average total mercury level in milk was 27% of the level in whole blood and for inorganic mercury the average level in milk was 55% of the levels in blood.Total and inorganic mercury in blood and milk were correlated with the number of amalgam fillings. The concentrations of total and organic mercury in blood (but not in milk) were correlated with the estimated recent intake of methylmercury via fish consumption. The results indicate an efficient transfer of inorganic mercury from blood to milk and even if the levels in milk were low the exposure to the nursing infant corresponds to approximately one-half the TDI for adults recommended by WHO.19 At higher exposure levels of methylmercury, as in a population in the Faroe Islands, the hair mercury concentrations in infants were found to increase with duration of nursing period.20 Other sources of neonatal exposure to metals For infants that are not breastfed, exposure to toxic metals may occur from infant formula and drinking water.Any toxicant present in water used to make up infant formula will be taken in by an infant in larger quantities per unit body weight than by an older child or adult using the same water supply. Water may be contaminated at the source, during treatment and transport. Lead in drinking-water from lead pipes in combination with corrosive water is a problem in many areas in Europe. Also, the occurrence of high copper levels from domestic piping has recently been recognized and evaluated for health effects especially in infants.21 There are also possibilities of dermal exposure, e.g., some cosmetics and folk medicine used on newborns in some parts of the world.A high skin absorption may occur especially under occlusive conditions, such as is the case for diapers. The cadmium intake in infants from breast milk and infant formula has been compared. Calculated for a 4 months old infant, with a body weight of 6.6 kg and a daily intake of 1000 ml, the cadmium intake from infant formula powder (not including the contribution from drinking water) is 6 times higher than the intake from breast milk.17,22 Cadmium intake from soya based formula, which is recommended for infants with cow milk allergy, is about 20 times higher than the intake from breast milk.The bioavailability of cadmium in these diets in the newborn is not known. Low-dose effects of cadmium in the developing CNS have been shown (see under Toxic effects). Kinetics in the newborn There are significant differences in absorption, distribution, metabolism and excretion demonstrated in neonates and adults.23 In the newborn, gastric pH is high (pH 6–8).Adult values are reached by 3 months of age. The difference in distribution between children and adults are mainly determined by the relative proportion of total body water, that decreases from approximately 75% in infants to about 55% by 12 years of age and by the low levels of plasma proteins, resulting in a higher amount of unbound chemicals in the newborn.Most metabolic enzymes are present at birth and their activities increase with age. Adult levels of most enzyme systems are achieved in humans by 2–3 months of age. Renal function increases over the first year of life. At birth glomerular filtration is 30–40% of adult and tubular filtration is also lower in infants than in adults. The ability to concentrate urine is initially low and may be associated with lower sensitivity to nephrotoxic agents compared to adults.Newborns, as shown in laboratory animals, also have a lower capacity to excrete compounds in the bile. The age-related differences in excretion result in decreased body clearance in the newborn. This has been shown for cadmium, mercury and lead in animals and for lead also in humans. Newborns of all species absorb metals to a higher extent than adults. Thus, the bioavailability of lead ranges from 10% in adults to 40% in children below the age of 6 years.24 The uptake of metals in neonates is dependent on the bioavailability of the metals from milk diets.Most infants are breastfed during the first months but the availability from infant formula is also of importance. There is conflicting evidence in the literature concerning the effect of milk on the absorption of lead in sucklings with some studies reporting an inhibiting effect of milk on lead absorption in the sucklings25 whereas others have seen a stimulating effect.26 We have found the highest and most rapid absorption of lead in suckling rats from diets with a low casein content, that is human milk.10 These rats also had the highest accumulation of lead in the duodenum, which is the principal absorption site for lead in adults.Lead in casein-rich milk, like rat and mice milk, was absorbed to a lower extent and more slowly with the highest accumulation in the ileal mucosa.A delayed absorption of lead was shown in suckling pups, which can be explained by pinocytosis of the retained caseinbound lead in the ileum.27 The maximal concentrations in tissues of the sucklings were not reached until 2 to 3 days after oral administration. The delay in absorption and measurements at different timepoints after administration may partly explain the contradictory results on the effect of milk on lead absorption. Thus, when measurements are performed after short periods of time, there is a lower absorption of lead from milk, whereas after very long periods of time even higher absorption may be reached from milk diets.There are indications of higher bioavailability of lead from human milk than from infant formula in the Glasgow duplicate study, where similar blood levels were found in breastfed infants as in bottle-fed, although the dietary intake of lead was much lower in breastfed infants.28 Methylmercury is well absorbed in the gastrointestinal tract of infants and in adults.In experimental animals there is a low demethylating ability of the intestinal microflora and a low excretion rate before weaning.29 Thus, it seems likely that there is a higher retention of methylmercury in young infants than in older children and adults. The blood-brain barrier is not fully developed until around 6 months after birth in man. Metals are retained in the brain more readily during infancy than during adulthood. This has been shown in rats for lead,30 cadmium31,32 and mercury.33 Toxic effects Animal studies have shown that toxic effects of certain chemicals are different at different stages of development.In addition, a perinatal exposure of a chemical may produce delayed effects later on in life. Age-dependent differences in toxicological response can be due to differences in kinetics and be both quantitative and qualitative. Also the toxicological response can depend on the development of receptors to various chemicals, that are developed at various stages.The brain is especially vulnerable during the brain growth spurt, that is the period when the brain undergoes several fundamental changes, like dendritic and axonal growth, synaptogenesis, rapid myelination, etc.34 In many species, such as mice, rats, dogs and man this period is postnatal. In humans, the full number of neurons is not reached until about 2 years of age and myelination is not complete until adolescence.The CNS toxicity of lead and methylmercury in early developmental stages is well known. High dose exposure causes pronounced effects whereas the effects in the low dose range are subtle and many confounding factors such as socio-economic status, intellectual stimulation and nutrition, have to be taken into account when evaluating the effects. For lead, the effect on Analyst, January 1998, Vol. 123 21cognitive ability seems to have no threshold and the most likely size of the effect is a decrement of between 1 and 3 IQ points for each 10 mg per 100 ml increment in blood lead.35 For methylmercury there are conflicting evidence from the studies in the Seychelles and Peru, where there were no significant developmental effects in children36,37 and the studies from the Faroe Islands, where significant effects recently have been reported.38 A few studies in experimental animals have shown neurotoxic and behavioural effects after early cadmium exposure.39,40 Relatively high doses and single administrations have been used.In a recent study with a continuous low dose cadmium exposure (5 ppm) via drinking water to lactating dams, we found neurochemical disturbances of the serotonergic system in the offspring.41 There were no detectable levels of cadmium in the brain of the suckling pups. Either the serotonergic system is very sensitive to cadmium during this period or the effects are indirectly caused by a disturbance on milk production and composition.The kidney function is immature in the newborn and there are indications that some compounds are less toxic to the immature kidney than to the mature. We found an effect on plasma urea nitrogen in offspring exposed to cadmium via drinking water after weaning but not in the pups exposed both during lactation and postweaning.41 This may be explained by induction of metallothionein in the pups that were continuously exposed to low doses during lactation resulting in a protection of kidney function.Newborns do not have a fully competent immune defence system. Profound effects on the immune system have been induced after exposure of chemicals during the development of the lymphoid system. No specific data are available for human infants. We studied the immunomodulating effects in mice after perinatal exposure to methylmercury (prior to mating, during gestation and lactation). There was an effect on thymocyte development and a stimulation of certain mitogen- and antigeninduced lymphocyte activities.42 Effects on the developing endocrine system is a subject of high concern for chemicals, e.g., those with androgenic or estrogenic activity such as chlorinated environmental pollutants.Not much is known about metals in this respect. Benefits of breastfeeding Breastfeeding is the most ideal form of infant nutrition. Among the benefits are protection against infection and prevention of development of allergic disease.43 Recently it was reported that a certain component of milk, multimeric alfa-lactalbumin, is a potent apoptosis-inducing agent with a selective activity on transformed, embryonic and lymphoid cells, thereby possibly contributing to mucosal immunity.44 Several studies have shown that children who were breastfed gain higher scores on intelligence tests than those who were bottlefed.The suggested explanation is a higher content in breast milk of essential fatty acids, essential for brain development.45 However, the interpretation of such studies is complicated due to the current association between breastfeeding and higher social class.46 Thus, it was shown in a Danish study that 79% of the well educated women but only 29% of the less-educated women were still breastfeeding their infants six month after parturition. 47 Conclusions and recommendations From this work the following conclusions can be drawn.Neonates, infants and lactating women should be considered as unique groups for risk assessment. Exposure, kinetics and toxic effects should be characterized in the the various age groups. Qualitative as well as quantitative differences in response to a toxic metal should be studied at various stages of development. The great beneficial effects of breastfeeding and the influence of nutritional status on toxicity should also be taken into account. References 1 IPCS, Environmental Health Criteria 70, Principles for the Safety Assessment of Food Additives and Contaminants in Food, World Health Organization, Geneva, 1987. 2 IPCS, Environmental Health Criteria 59, Principles for Evaluating Health Risks From Chemicals During Infancy and Early Childhood: The Need for a Special Approach, World Health Organization, Geneva, 1986. 3 Similarities and Differences Between Children and Adults. Implications for Risk Assessment, ed. Guzelian, P. S., Henry, C. J., and Olin, S.S., ILSI Press, Washington, DC, 1992. 4 Palminger Hall�en, I., J�onsson, S., Karlsson, M. O., and Oskarsson, A., Toxicol. Appl. Pharmacol., 1996, 136, 342. 5 Greenwood, M. R., Clarkson, T. W., Doherty, R. A., Gates, A. H., Amin-Zaki, L., Elhassani, S., and Majeed, M. A., Environ. Res., 1978, 16, 48. 6 Sundberg, J., J�onsson, S., Karlsson, M. O., Palminger Hall�en, I., and Oskarsson, A., unpublished work. 7 Lactation: Physiology, Nutrition and Breast-feeding, ed.Neville, M. C., and Neifert, M. R., Plenum Press, New York, 1983. 8 Wilson, J. T., Drug Metab. Rev., 1983, 14, 619. 9 WHO Working Group in Drugs and Human Lactation, ed. Bennett, P. N., Elsevier, Amsterdam, 1988, pp. 27–48. 10 Palminger Hall�en, I., and Oskarsson, A., Biometals, 1995, 8, 231. 11 Petersson, K., and Oskarsson, A., unpublished work. 12 Sundberg, J., Ersson, B., and Oskarsson, A., unpublished work. 13 Casey, C. E., Smith, A., and Zhang, P., in Handbook of Milk Composition, ed.Jensen, R. G., Academic Press, San Diego, California, 1995, pp. 622–674. 14 Fransson, G.-B., and L�onnerdal, B., Ped. Res., 1983, 17, 912. 15 Palminger Hall�en, I., Norrgren, L., and Oskarsson, A., Arch. Toxicol., 1996, 70, 237. 16 Oskarsson, A., Palminger Hall�en, I., and Sundberg, J., Analyst, 1995, 120, 765. 17 Palminger Hall�en, I., Jorhem, L., Json Lagerkvist, B., and Oskarsson, A., Sci. Total Environ., 1995, 166, 149. 18 Oskarsson, A., Sch�utz, A., Skerfving, S., Palminger Hall�en, I., Ohlin, B., and Json Lagerkvist, B., Arch.Environ. Health, 1996, 51, 234. 19 WHO/FAO, Toxicological Evaluation of Certain Food Additives and Contaminants, World Health Organization Food Additives Series: 24, Cambridge University Press, 1989. 20 Grandjean P., Jørgensen, P. J., and Weihe, P., Environ. Health Perspect., 1994, 102, 74. 21 IPCS, Environmental Health Criteria, Copper, World Health Organization, Geneva, in the press. 22 Eklund, G., Helmersson, S., and Oskarsson, A., unpublished results. 23 Milsap R. L., Hill, M. R., and Szefler, S. J., in Applied Pharmacokinetics: Principles of Therapeutic Drug Monitoring, ed. Evans, W. E., Scentag, J. J., and Jusko, W. J., Applied Therapeutics, Vancouver, Washington, 3rd edn., 1992, pp. 10-1-32. 24 Davis, J. M., and Grant, L. D., in Similarities and Differences Between Children and Adults. Implications for Risk Assessment, ed. Guzelian, P. S., Henry, C. J., and Olin, S. S., ILSI Press, Washington, DC, 1992, pp. 150–162. 25 Henning, S. J., and Cooper, L. C., Proc. Soc. Exp. Biol. Med., 1988, 187, 110. 26 Kello, D., and Kostial, K., Environ. Res., 1973, 6, 355. 27 Palminger Hall�en, I., J�onsson, S., Karlsson, M. O., and Oskarsson, A., Toxicol. Appl. Pharmacol., 1996, 140, 13. 28 Department of the Environment Central Directorate on Environmental Pollution, The Glasgow Duplicate Diet Study (1979/80), Pollution Report No. 11, 1982. 29 Rowland, I. R., Robinson, R.D., Doherty, R. A., and Landry, T. D., in Reproductive and Developmental Toxicity of Metals, ed. Clarkson, T. W., Nordberg, G. F., and Sager, P. R., Plenum Press, New York, 1983, p. 745. 30 Momcilovic, B., and Kostial, K., Environ. Res., 1974, 8, 214. 22 Analyst, January 1998, Vol. 12331 Kostial, K., Kello, D., Jugo, S., Rabar, I., and Maljkovic, T., Environ. Health Perspect., 1978, 25, 81. 32 Wong, K. L., and Klaassen, C., Toxicol. Appl. Pharmacol., 1980, 53, 343. 33 Jugo, S., Environ. Res., 1980, 21, 336. 34 Davison, A. N., and Dobbing, J., in Applied Neurochemistry, ed. Davison, A. N., and Dobbing, J., Blackwell Scientific Publications, Oxford, 1968, pp. 253–282. 35 IPCS, Environmental Health Criteria 165, Lead, World Health Organization, Geneva, 1995. 36 Myers, G. J., Davidson, P. W., Cox, C., Shamlaye, C. F., Tanner, M. A., Marsh, D. O., Cernichiari, E., Lapham, L. W., Berlin, M., and Clarkson, T. W., Neurotoxicol., 1995, 16, 711. 37 Marsh, D. O., Turner, M. D., Crispin Smith, J., Allen, P., and Richdale, N., Neurotoxicol., 1995, 16, 717. 38 Grandjean, P., Weihe, P., White, R. F., Debes, F., Araki, S., Yokoyama, K., Murata, K., Sørensen, N., Dahl, R., Budtz- Jørgensen, E., and Jørgensen, P. J., Abstract presented at the International Conference on Human Health Effects of Mercury Exposure, T�orshavn, Faroe Islands, June 22–26, 1997. 39 Wong, K. L., and Klaassen, C. D., Toxicol. Appl. Pharmacol., 1982, 63, 330. 40 Smith, M. J., Pihl, R. O., and Farrell, B., Neurobehav. Toxicol. Teratol., 1985, 7, 19. 41 Andersson, H., Petersson-Graw�e, K., Lindqvist, E., Luthman, J., Oskarsson, A., and Olson, L., Neurotoxicol. Teratol., 1997, 19, 105. 42 Thuvander, A., Sundberg, J., and Oskarsson, A., Toxicology, 1997, 114, 163. 43 Forsyth, J. S., Proc. Nutr. Soc., 1995, 54, 407. 44 Håkansson, A., Zhivotovsky, B., Orrenius, S., Sabharwal, H., and Svanborg, C., Proc. Natl. Acad., Sci., 1995, 92, 8064. 45 Uauy, R., and Andraca, I., J. Nutr. 1995, 125, 2278S. 46 Gale, C. R., and Martyn, C. N., Lancet, 1996, 347, 1072. 47 Michaelsen, K. F., Larsen, P. S., Thomsen, B. L., and Samuelson, G., Acta Paed., 1994, 83, 565. Paper 7/05136K Received July 17, 1997 Accepted October 1, 1997 Anal

ISSN:0003-2654    

DOI:10.1039/a705136k

出版商:RSC    

年代:1998

数据来源: RSC

摘要:

O HO H H H OH H OH CH2OH H HOCH2 C H OH C H O C OH H C H OH CH2 N CH2 C S–Na+ S Effect of cadmium chelating agents on organ cadmium and trace element levels in mice† Vladislav Eybl*a, Dana Kotyzov�aa, Jaroslav Koutenskya, V�era M�ý�ckov�aa, Mark M. Jonesb and Pramod K. Singhb a Department of Pharmacology and Toxicology, Charles University Faculty of Medicine, 30166 Pilsen, Czech Republic b Department of Chemistry and Center in Molecular Toxicology, Vanderbilt University, Nashville, TN 37235, USA In experiments performed on male mice (CD-1, Charles River), the mobilizing effects of repeated administration of the carbodithioate analogue BLDTC [N-benzyl-4-O-(b-D-galactopyranosyl)-D-glucamine- N-carbodithioate] and CaDTPA (calcium trisodium pentetate) on cadmium deposits in the liver, kidneys, brain and testes were compared.The antidotes were injected alternately every 48 h over a period of 16 d (8 doses in total) following a previous loading with 20 doses of CdCl2·2.5 H2O (single doses of 3 mg kg21 i.p.). The experiments confirmed BLDTC to be one of the most effective cadmium mobilizing agents.The administration of CaDTPA, which is known as a useful antidote in acute cadmium intoxication, increased the mobilizing effect of BLDTC. Cadmium elevated the concentration of zinc in all organs examined and the level of copper in the liver, kidneys and testes. This accumulation of trace elements was only partially corrected by the chelators.The antidotes administered alone exert only a negligible effect on the trace element levels in the organs. Keywords: N-Benzyl-4-O-(b-d-galactopyranosyl)-dglucamine- N-carbodithioate; cadmium; chelators; DTPA; essential elements; dithiocarbamates In previous papers,1–8 the cadmium mobilizing effect of various carbodithioate analogues was studied. Among the most effective agents of this group is BLDTC [N-benzyl-4-O-(b-dgalactopyranosyl)- d-glucamine-N-carbodithioate].6 In this study, the influence of BLDTC on the cadmium deposits is compared with the effect of CaDTPA (calcium trisodium pentetate).The protective effect of this chelator in cadmium intoxication has been described previously.1 In this study the effect of combined treatment with BLDTC and DTPA was also studied. Both agents had to be given parenterally because BLDTC is unstable upon oral administration and CaDTPA is almost non-absorbable. Since the essential elements may be chelated unspecifically by metal antidotes, the effects of these compounds on the levels of zinc and copper in the tissues were examined.Experimental The experiments were performed on male mice (CD-1, Charles River; 25–30 g body mass). The following substances were administered: CdCl2·2.5 H2O (analytical-reagent grade; Lachema, Brno, Czech Republic), the dithioate analogue BLDTC [N-benzyl-4-O-(b-d-galactopyranosyl)- d-glucamine-N-carbodithioate sodium salt] (synthesized by M. M.J. and P. K. S.) (Fig. 1) and CaDTPA [calcium trisodium pentetate (Ditripentat-Heyl; DTPA)]. The animals were divided into two groups. The first group of 33 animals were injected i.p. with CdCl2·2.5 H2O at a dose of 3 mg kg21 daily for 6 d per week. A total of 20 doses were administered. The animals in the second group served as controls, receiving saline. On the 25th day of the experiment (48 h after the last injection of Cd), five animals from both groups were killed by diethyl ether anesthesia and decapitation.The liver, kidneys, brain and testes were removed, rinsed in cold saline, blotted dry and stored frozen (220 °C) until analysed. The remaining control and Cd-intoxicated animals were divided into groups of seven animals each (see tables). The chelators CaDTPA and/or BLDTC were injected s.c. alternately every 48th hour over a period of 16 days (eight doses in total) starting on the 25th day of the experiment. A single dose of the chelators corresponded to a single dose of Cd at an antidote-to- Cd molar ratio of 25 : 1.The animals were killed on the 41st day of the experiment (24 h after the eighth injection of antidotes) and tissues were removed and stored as described above. For elemental analyses the tissues were weighed, placed in platinum crucibles and dry-ashed in a muffle furnace at 460–500 °C for 18–24 h. The ash was solubilized with 3 m HCl. Appropriately diluted samples were analyzed by atomic absorption spectrometry (AAS) using a Model AAS-30 instrument (Zeiss, Jena, Germany).Tissues were analyzed for Zn and Cu using an air–acetylene flame. Electrothermal AAS was applied for Cd determination. The results were statistically evaluated using the unpaired ttest. The values in the tables are means ± s. Results and discussion The influence of chelators on cadmium concentrations in the tissues is summarized in Table 1. The levels of cadmium in the liver, testes and brain decreased from the 25th to the 41st day.However, the level of cadmium in the kidneys increased. BLDTC lowered the concentration of cadmium in the liver and kidneys. Similarly, the amount of cadmium in the liver decreased after the administration of CaDTPA. The best results were attained after treatment with both chelators together. However, neither of the agents induced cadmium mobilization from the testes. † Presented at The Sixth Nordic Symposium on Trace Elements in Human Health and Disease, Roskilde, Denmark, June 29–July 3, 1997.Fig. 1. BLDTC [N-benzyl-4-O-(b-d-galactopyranosyl)-d-glucamine-Ncarbodithioate]. Analyst, January 1998, Vol. 123 (25–26) 25The concentration of zinc in the liver, kidneys and testes was significantly elevated after the administration of cadmium. This effect was diminished in the liver on administration of CaDTPA. The concentration of copper in the liver, kidneys and testes also increased on cadmium administration. The chelators were able to correct this change only partially in the liver (Table 2).The chelators administered alone exerted no effect on the concentration of zinc in the liver, testes and brain. The level of zinc in the kidneys increased after the administration of CaDTPA and also after a combination of BLDTC and CaDTPA. The concentration of copper was enhanced in the testes after the administration of BLDTC alone and in combination with CaDTPA. This combination decreased the level of copper in the kidney and testes.BLDTC alone increased the content of Cu in the testes. No changes in trace element concentrations were found in the brain (Table 3). The results obtained in this study confirm those of our previous investigation on the effect of BLDTC in cadmium intoxication.6 Moreover, we have found that CaDTPA might increase the effect of this dithioate. This effect was especially notable in the kidneys. The carbodithioates have a higher affinity for cadmium than does metallothionein, as has been demonstrated in experiments in vitro.9 The elevation of zinc concentration in the kidneys of control animals following CaDTPA administration appears to be a consequence of the increased excretion of zinc from the body (Table 3).The increase in concentration of zinc in the liver and kidneys after the administration of cadmium was corrected to a similar extent to that given by a related drug, MeBLDTC, in previous work.6,8 However, BLDTC alone, in contrast to MeBLDTC, exerts only a negligible effect on zinc and copper level in the organs.As discussed in a previous paper,8 a systematic study of the influence of chelators on the levels of essential elements during treatment of metal poisoning is needed. Carbodithioates represent a promising group of cadmium mobilizing agents. Even though their acute toxicity is relatively low, basic pre-clinical research is needed before they could be recommended for human administration.This research was supported by grant No. 07/96 from Charles University. References 1 Eybl, V., S�ykora, J., Koutensk�y, J., Caisov�a, D., Schwartz, A., and Mertl, F., Environ. Health Perspect., 1984, 54, 267. 2 Jones, M. M., Singh, P. K., Jones, S. G., and Holscher, M. A., Pharmacol. Toxicol. (Copenhagen), 1991, 68, 115. 3 Jones, M. M., Singh, P. K., Gale, G. R., Smith, A, L. M., Pharmacol. Toxicol. (Copenhagen), 1992, 70, 336. 4 Eybl, V., Jones, M. M., Koutensk�a, M., Koutensk�y, J., S�ykora, J., Drobn�ýk, F., and � Svec, F., Arch.Toxicol., 1988, Suppl. 12, 438. 5 Eybl, V., Jones, M. M., Koutensk�a, M., Koutensk�y, J., S�ykora, J., and Smol�ýkov�a, V., Plze�n. L�ek. Sb., 1991, Suppl. 64, 25. 6 Eybl, V., Kotyzov�a, D., Koutensk�y, J., Singh, P. K., and Jones, M. M., Plze�n. L�ek. Sb., 1993, Suppl. 68, 15. 7 Eybl, V., Kotyzov�a, D., Koutensk�y, J., Jones, M. M., and Singh, P. K., Plze�n L�ek. Sb., 1996, Suppl. 70, 65. 8 Eybl, V., Kotyzov�a, D., Koutensk�y, J., Jones, M. M., and Singh, P. K., Analyst, 1995, 120, 855. 9 Gale, G. R., Smith, A. B., Atkins, L. M., and Jones, M. M., Res. Commun. Chem. Pathol. Pharmacol., 1985, 49, 423. Paper 7/04894G Received July 9, 1997 Accepted September 22, 1997 Table 1 Cadmium concentrations in the tissues after pre-treatment with Cd on the 25th day of the experiment and after treatment with chelators on the 41st day of the experiment. Results in mg g21 (means ± s) 41st day 25th day Cd + BLDTC Cd + CaDTPA Cd + BLDTC + Tissue Cd (n = 5) Cd (n = 6) (n = 6) (n = 6) CaDTPA (n = 6) Liver 81.8 ± 16.8 71.5 ± 6.7 64.1 ± 3.6* 64.9 ± 3.2* 61.8 ± 2.4** Kidneys 76.0 ± 7.9 81.0 ± 7.7 70.3 ± 6.5* 76.9 ± 6.5 64.4 ± 3.33** Testes 35.9 ± 7.3 27.1 ± 4.4 30.3 ± 5.0 27.6 ± 4.9 23.7 ± 3.6 Brain 1.0 ± 0.1 0.8 ± 0.1 0.9 ± 0.1 0.9 ± 0.1 0.7 ± 0.1* * p < 0.05 versus control.** p < 0.01 versus control. Table 2 Zinc and copper concentrations in the tissues after treatment with Cd and chelators on the 41st day of the experiment.Results in mg g21 (means ± s, n = 7) Liver Kidneys Testes Brain Treatment Zn Cu Zn Cu Zn Cu Zn Cu Control 21.4 ± 1.1 3.7 ± 0.3 18.5 ± 1.0 3.7 ± 0.2 24.8 ± 1.7 1.3 ± 0.1 14.9 ± 0.5 3.3 ± 0.1 Cd 41.9 ± 2.8** 6.5 ± 0.4** 23.2 ± 2.1** 4.2 ± 0.5** 55.7 ± 20.4** 2.9 ± 0.9** 15.6 ± 0.8 3.3 ± 0.2 Cd + BLDTC 45.0 ± 1.9** 5.3 ± 1.0** 30.5 ± 1.8** 4.9 ± 0.6** 79.7 ± 19.3** 4.0 ± 0.9** 14.9 ± 0.9 3.2 ± 0.4 Cd + CaDTPa 37.5 ± 1.4** 6.9 ± 1.3** 27.4 ± 3.0** 4.4 ± 0.3** 47.7 ± 20.7** 2.8 ± 0.5** 16.1 ± 0.8** 3.5 ± 0.4 Cd + BLDTC + CaDTPA 41.1 ± 3.2** 6.6 ± 0.6** 33.8 ± 2.3** 4.5 ± 0.3** 42.9 ± 7.9** 3.2 ± 0.8** 15.8 ± 0.7** 3.5 ± 0.3 ** p < 0.01 versus control. Table 3 Zinc and copper concentrations in the tissues after treatment with chelators on the 41st day of the experiment. Results in mg g21 (means ± s, n = 7) Liver Kidneys Testes Brain Treatment Zn Cu Zn Cu Zn Cu Zn Cu Control 21.4 ± 1.1 3.7 ± 0.3 18.5 ± 1.0 3.7 ± 0.2 24.8 ± 1.7 1.3 ± 0.1 14.9 ± 0.5 3.3 ± 0.1 BLDTC 20.8 ± 1.1 3.3 ± 0.5 18.6 ± 0.5 3.7 ± 0.1 24.5 ± 1.2 1.5 ± 0.2* 15.0 ± 1.5 3.5 ± 0.4 CaDTPA 21.0 ± 0.9 3.8 ± 0.7 20.2 ± 0.4** 3.7 ± 0.2 26.0 ± 2.4 1.4 ± 0.2 14.6 ± 1.2 3.4 ± 0.2 BLDTC + CaDTPA 22.6 ± 1.7 4.0 ± 0.9 19.7 ± 0.8** 3.5 ± 0.1* 25.1 ± 1.4 1.5 ± 0.1* 15.1 ± 1.3 3.3 ± 0.2 * p < 0.05 versus control. ** p < 0.01 versus

ISSN:0003-2654    

DOI:10.1039/a704894g

出版商:RSC    

年代:1998

数据来源: RSC

摘要:

Urinary arsenic species in Devon and Cornwall residents, UK. A pilot study† P. Kavanagha, M. E. Faragoa, I. Thorntona, W. Goesslerb, D. Kuehneltb, C. Schlagenhaufenb and K. J. Irgolicb a Environmental Geochemistry Research Group, Imperial College Centre for Environmental Technology, Royal School of Mines, Imperial College of Science, Technology and Medicine, London, UK SW7 2BP b Institute for Analytical Chemistry, Karl Franzens University, Graz Universitatplatz 1, 40810 Graz, Austria First void urine samples were collected from 24 residents in an area of past intense mining and smelting activity of arsenical ores.Seven samples were also taken from a control village. The arsenic species in the urine were separated and quantified with an HPLC–ICP-MS system equipped with a hydraulic high-pressure nebulizer. The detection limit for arsenic in urine using this system is 0.05 mg dm23. Creatinine was also determined for all samples to remove the influence of urine density and all results were expressed in mg As g21 creatinine.The results showed elevated levels of both organic and inorganic arsenic compounds in the ‘exposed’ population’s urine when compared with those of the control group. The total As concentrations (less arsenobetaine) in the ‘exposed’ population were in the range 2.7–58.9 mg g21 creatinine (mean 13.4, median 9.2 mg g21) compared with the control group data range 2.5–5.3 mg g21 (mean 4.2, median 4.7 mg g21). Keywords: Arsenic; urine; speciation; high-performance liquid chromatography; inductively coupled plasma mass spectrometry; soil; house dust; mine waste It is now accepted that chronic exposure to inorganic arsenic (Asi) can result in several dose-related health effects. Inhalation of Asi is known to cause lung cancer and ingestion of Asi can cause skin cancer.1 Recent studies have shown that ingestion of Asi is associated with increased risk of lung, liver, bladder and kidney cancer.2,3 Epidemiological studies have also shown a relationship between ingestion of Asi and skin keratoses and hyperpigmentation and with peripheral vascular disease.4,5 Several recent studies have shown that young children are at higher risk from arsenic exposure as measured by either arsenic in urine or intake rates.6,7 Urinary arsenic has been considered to be a good biological measure of exposure; about 60–75% of ingested Asi is excreted in the urine.8,9 It is not clear whether high As exposure within a narrow age range, especially for children of pre-school age, translates to lifelong increased noncancer and cancer risks.10 It has been shown that accidental exposure of children in Japan to As has led to persistent damage to the central nervous system.7 In the southwest region of England, the counties of Cornwall and Devon are the most susceptible region to arsenic exposure through the long history of mining and smelting of both local and imported arsenical ores and associated metals.This region reached its mining and smelting acme during the mid-nineteenth century, leading to widespread Asi contamination of the surrounding agricultural land, gardens, house dust and stream sediments.11–14 Table 1 shows the range of concentrations of As in soils (including mine wastes) and house dust in this area. Cargreen was selected as a control area on the basis that it has similar geology and no history of the mining and smelting of metalliferous or arsenical ores.It has been shown that there is the potential for high daily intakes of As by ingestion of contaminated soils and dusts.15 Since the bioavailability of As to humans in these media is unknown, the aim of this pilot study was to assess urinary As concentrations and species as an indication of As exposure. Experimental Sample collection First void urine samples were collected in polypropylene sterile Sterilin bottles from 31 Cornwall and Devon residents living in Gunnislake village (n = 17) and in the vicinity of the Devon Consols Mine (n = 7) north of Plymouth, UK.Of these, seven were collected, for comparison, from Cargreen. Adult male and boy volunteers were asked to complete a questionnaire outlining their occupation, how long they had lived in the area, source of their vegetables, etc., and were also asked to keep a dietary diary documenting the precise foods and drinks ingested over a 4 d period prior to giving the urine sample.A division of 8 years of age was made as it was considered that any child above this age would not be likely to indulge in the characteristic hand to mouth ‘pica’ activity of younger children with its associated risk of transferring toxic elements picked up from soil or house dust.16 Upon collection, samples were placed in an ice-cool box (4 °C), transferred to the laboratory and then frozen at 220 °C. Sample preparation The samples were analysed for arsenic species at the Institute of Analytical Chemistry, Karl Franzens University, Graz, Austria. Prior to analysis, the urine samples were warmed to room temperature.The precipitate that had formed was removed by centrifugation for 15 min at 2500 rpm. Immediately before the chromatography the supernatants were filtered through 0.2 mm † Presented at The Sixth Nordic Symposium on Trace Elements in Human Health and Disease, Roskilde, Denmark, June 29–July 3, 1997. Table 1 Concentrations and ranges of arsenic (mg g21) in soil and house dusts Soils Dusts Location n Mean* Range n Mean* Range Cargreen 18 37 16–198 4 49 20–114 Gunnislake 71 365 120–1695 9 217 33–1160† Devon Great Consols 15‡ 4499 345–52600 13 1167 24–3740 * Geometric mean.† Outlying value of 16 700 omitted. ‡ Contain mine waste. Source: ref. 14. Analyst, January 1998, Vol. 123 (27–29) 27cellulose nitrate filters (Sartorius, G�ottingen, Germany). Aliquots (100 mm3) of the undiluted supernatants were chromatographed.Equipment The methodology used here for the determination of As compounds in human urine by HPLC–ICP-MS has been described in detail previously, including quality control procedures and the use of standard reference materials for total As.17 For the separation of the arsenic compounds, a Hewlett- Packard (Avondale, PA, USA) Model 1050 solvent-delivery unit and the 100 mm3 injection loop of a Rheodyne (Cotati, CA, USA) Model 9125, six-port injection valve were used.The arsenic compounds were separated at a flow rate of 1.5 cm3 min21 on a Supelcosil LC-SAX anion-exchange column (250 3 4.6 mm id; spherical, 5 mm particles of silica with quaternary aminopropyl exchange sites) with 30 mm aqueous ammonium phosphate buffer (pH 5.1) as the mobile phase. The ammonium phosphate buffer was used in order to overcome the problems of residue deposition on the cones as reported by Berndt.18 No blockage was observed during the 6 h of continuous operation.The exit of the column was connected to a hydraulic highpressure nebulizer (HHPN) (Knauer, Berlin, Germany) via a 300 mm, 1/16 in PEEK (polyether ether ketone) capillary tube (0.25 mm id). A VG PlasmaQuad 2 Turbo Plus inductively coupled plasma mass spectrometer (VG Elemental, Winsford, UK) served as an arsenic-specific detector. The elbow that normally connects the spray chamber to the torch was replaced by a 40 3 5 mm id quartz tube tapered at one end and carrying a female ball-joint at the other end.The outlet of the HHPN was connected with a 600 310 mm id Tygon tube to the tapered end of the quartz tube, which in turn provided the connection to the plasma torch via the ball-joint. The Supelcosil LC-SAX strong anion-exchange column separated six species [arsenocholine (AC), arsenite, dimethylarsinic acid (DMAA), arsenobetaine (AB), monomethylarsonic acid (MAA) and arsenate] in 6 min with the mobile phase at pH 3.75.The retention times increased in the sequence AC < arsenite < DMAA < AB < MAA < arsenate. After 50–70 chromatographic runs the separation efficiency decreased and merging of the peaks for the last three species occurred. Adjustment of the pH of the ammonium phosphate buffer solution to pH 4.4 restored the desed separation efficiency. For quantification, the chromatograms were exported, peak areas determined and the concentrations calculated with external calibration curves using ‘in house’ software.17 Analytical data quality There are no certified standard reference materials for As species in urine.The method was validated by using solutions containing AsIII, AsV, AB, MMA and DMA at 1, 5, 10 and 50 ng cm23.17 Total As was determined in the standard reference material SRM 2670 (NIST, Gaithersburg, MD, USA).17 Creatinine determination Creatinine was determined in all urine samples with a Synchron CX Systems P/N 443340 creatinine kit (Beckman Instruments, Galway, Ireland) based on the Jaffe rate method.19 Results and discussion As this was a pilot study and the sample size was small, the results were grouped according to area and not age.The results (Table 2) suggest higher levels of the total arsenic (AsT, sum of arsenite, arsenate, methylarsonic acid and dimethylarsinic acid) in urine samples from volunteers living in the high-arsenic areas in comparison with those from the control area. In this pilot study, the statistically verified outlier of 32.7 mg g21 creatinine As cannot be explained.Student t-tests showed that for both the Gunnislake and Devon Great Consols areas, concentrations of AsT (creatinine corrected) were significantly higher from those from the control area (outlier excluded) (P = 0.01). There is also a difference in speciation; almost no inorganic arsenic was detected in the control samples, whereas AsIII was detected in 14 out of 17 samples from Gunnislake and in all seven samples from the Devon Great Consols Mine.Similarly, AsV was detected in 13 and six of these samples, respectively. There were no observed significant differences in diet between the study populations. Soluble Asi compounds are usually well absorbed by the oral and pulmonary routes mainly when the element is in the trivalent state.20 After exposure to Asi, the only arsenic species excreted, especially after the first few hours of exposure, are MMA and DMA.DMA is usually the dominant metabolite. Buchet and Lauwerys20 demonstrated, under experimental conditions, that whereas the excretion of Asi and MMA is linearly related to the dose administered, the excretion of DMA levels off at the highest dose, indicating possible saturation of Table 2 Concentration ranges of arsenic species detected in urine samples Cargreen Gunnislake Devon GC (n = 7): (n = 17): (n = 7): Ages 4–7 years Ages 3–8 years Ages 4 years (4 boys); (8 boys); (1 boy); 45–56 years 30–43 years 18–65 years Species (3 adults) (9 adults) (6 adults) AsT (Asi + DMAA MMAA)/mg g21 creatinine* Range 2.5–32.7 (2.5–5.3)† 2.7–58.9 5.1–17.6 Mean 8.26 (4.2)† 14.4 11.02 Median 4.7 (4.5)† 9.2 10.0 Arsenite AsIII)/ mg g21 creatinine Range BDL‡–0.6 (BDL–0.6)† BDL–8.5 0.6–1.8 Median BDL (BDL)* 1.7 0.9 Number detected 1 14 7 Arsenate (AsV)/ mg g21 creatinine Range BDL‡ (BDL)† BDL–2.95 BDL–2.06 Median BDL (BDL) 0.9 1.34 Number detected 13 6 DMAA/mg g21 creatinine Range 2.5–32.7 (2.5–5.4)† 1.9–54.3 3.3–15.5 Median 4.7 (4.2)† 5.6 8.5 Number detected 7 17 7 MMAA/mg g21 creatinine Range BDL‡ BDL–3.8 BDL–0.9 Median BDL (BDL)† 0.3 0.7 Number detected 2 2 MMA/DMA ratios 0.05 0.08 * Student’s t-test shows that control data are significantly different from both Gunnislake and Devon Great Consols data (P = 0.01).† Indicates that statistics based on data with outlier omitted. ‡ Where As in urine was below detection limit (BDL) of 0.05 mg dm23, the value was taken as zero, i.e., not detected). 28 Analyst, January 1998, Vol. 123the methylation capacity. In these experiments,20 volunteers were acutely exposed to known concentrations of Asi, as As2O3, and the proportion of the three species of urinary As changed markedly over time. In the first 48–96 h after ingestion, arsenic was excreted mainly as the unmetabolised Asi, but this was quickly followed by a progressive increase in the proportion excreted as MMA and DMA.The period at which the organic metabolites of arsenic are excreted is dependent on the severity of the dose but in all cases > 95% of the excreted As in the organic form was found to be DMA after 216 h. In this study the percentage of DMA in samples from Cargreen was 99.9% compared with 86% for Devon Great Consols. Mushak21 suggested that because the percentage of Asi excreted in the urine often does not vary with increasing exposure (as reviewed by Hopenhayn-Rich et al.),22 the hypothesis that the methylation of Asi becomes saturated at high As doses is implausible.Several studies have reported higher MMA/DMA ratios in exposed populations compared with control groups, indicating that humans may not be able to convert MMA into DMA as efficiently at higher Asi doses and suggesting saturation of the methylation at higher exposures.23–28 In our study, the MMA/ DMA ratios were higher for the samples of the Devon Great Consols residents than those of the Gunnislake residents (Table 2) and may reflect the difference in exposure to Asi.From our results and those of Johnson and Farmer16 and del Razo et al.,24 it can be concluded that with chronic exposure, not only does the total arsenic in the urine increase, but also the percentage of inorganic arsenic increases whereas that of the dimethylated arsenic species decreases. These results show that the study populations in the Gunnislake and Devon Great Consols areas are chronically exposed to inorganic As.The data also indicate that chronic exposure results from soil and dust ingestion of As in a partially available form, since no other As exposure route is possible.15 Further work is being carried out to assess the mineralogical constraints on the bioavailability of the inorganic arsenic in this area of southwest England. This project was funded by the Economic and Social Research Council (ESRC), UK. References 1 International Agency for Research on Cancer, IARC Monograph on the Evaluation of the Carcinogenic Risk of Chemicals to Humans.Some Metals and Metallic Compounds, IARC, Lyon, 1980, vol. 23, pp. 83–141. 2 Chen, C. J., Kuo, T. L., and Wu, M. M., Lancet, 1988, i, 414. 3 Bates, M. N., Smith, A. H., and Hopenhayn-Rich, C., Am. J. Epidemiol., 1992, 135(5), 462. 4 Tseng, W. P., Chu, H. M., How, S. W., Fong, J. M., Lin, C. S., and Yeh, S., J. Natl. Cancer Inst., 1968, 40, 453. 5 Chen, C. J., Wu, M.M., Lee, S. S., Wang, J. D., Cheng, S. H., and Wu, H. Y., Arterioscelrosis, 1988, 8, 452. 6 Polissar, L., Lowry-Coble, K., Kalman, D. A., Hughes, J. P., Van Belle, G., Covert, D. S., Burbacher, T. M., Bolgiano, D., and Mottet, K., Environ. Res., 1990, 53, 29. 7 US Environmental Protection Agency, Health Assessment Document for Inorganic Arsenic (EPA-600/8-83-021F), EPA, Washington, DC, 1984. 8 Tam, G. K. H., Charbonneau, S. M., Bryce, F., Pomoroy, C., and Sandi, E., Toxicol.Appl. Pharmacol., 1979, 50, 319. 9 US Environmental Protection Agency, Risk Assessment Forum, Special Report on Ingested Arsenic. Skin Cancer, Nutrional Essentiality (EPA-625/3-87-013), EPA, Washington, DC, 1988. 10 Mushak, P., in Arsenic Exposure and Health, ed. Chappell, W. R., Abernathy, C. O., and Cothern, C. R., Science and Technology Letters, Northwood, Middlesex, 1994, pp. 305–318. 11 Thornton, I., and Abrahams, P., in, Changing Metal Cycles and Human Health, ed. Nriagu, J.O., Springer, Berlin, 1984, pp. 7–25. 12 Xu, J., and Thornton, I., Environ. Geochem. Health, 1985, 7(4), 131. 13 Culbard, E. B., and Johnson, L. R., in Trace Subs. Environ Health, vol. XVIII, ed. Hemphill, D. D., University of Missouri, Columbia, MO, 1984, pp. 311–319. 14 Kavanagh, P., Farago, M. E., Thornton, I., Fernandes, S., and Freire, I., Chem. Speciation and Bioavailability, in the press. 15 Farago, M. E., Thornton, I., Kavanagh, P., Elliott, P., and Leonardi, G.S., in Arsenic: Exposure and Health Effects, ed. Abernathy, C., Thomson Science, London, 1997, pp. 210–224. 16 Johnson, L. R., and Farmer, J. G., Environ. Geochem. Health, 1989, 11, 39. 17 Goessler, W., Kuehnelt, D., and Irgolic, I., in Arsenic: Exposure and Health Effects, ed. Abernathy, C., Thomson Science, London, 1997, pp. 18–33. 18 Berndt, H., Fresenius’ Z. Anal. Chem., 1988, 331, 321. 19 Bousnes, R. W., and Tawsky, H., J. Biol. Chem., 1945, 158, 581. 20 Buchet, J. P., and Lauwerys, R., in Arsenic Exposure and Health, ed.Chappell, W. R., Abernathy, C. O., and Cothern, C. R., Science and Technology Letters, Northwood, 1994, pp. 81–89. 21 Mushak, P., and Crocetti, A. F., Environ. Health Perspect., 1995, 103, 684. 22 Hopenhayn-Rich, C., Smith, A. H., and Goeden, H. M., Environ. Res., 1993, 60, 161. 23 Froines, J., paper presented at the Workshop on Arsenic Epidemiology and PBPK Modeling, Annapolis, MD, 27–28 June 1994. 24 Del Razo, L. M., Hernandez, J. L., Garcia-Vargas, G. G., Ostrosky- Wegman, P., de Nava, C. C., and Cebrian, M. E., in Arsenic Exposure and Health, ed. Chappel, W. R., Abernathy, C. O., and Cothern, C. R., Science and Technology Letters, Northwood, 1994, p. 91. 25 Farmer, J. G., and Johnson, L. R., Br. J. Ind. Med., 1990, 47, 342. 26 Hopenhayn-Rich, C., Biggs, M. L., Smith, A. H., Moore, L. E., and Kalman, D. A., paper presented at the Society for Environmental Geochemistry and Health Second International Conference on Arsenic Exposure and Health Effects, San Diego, CA, 12–14 June, 1995. 27 Hseuh, Y. M., Huang, Y. L., Wu, W. L., Huang, C. C., Yang, M. H., and Chen, G. S., paper presented at the Society for Environmental Geochemistry and Health Second International Conference on Arsenic Exposure and Health Effects, San Diego, CA, 12–14 June, 1995. 28 Yamauchi, H., Takahashi, K., Mashiko, M., and Yamamura, Y., Am. Ind. Hyg. Assoc. J., 1995, 50, 606. Paper 7/04893I Received July 9, 1997 Accepted October 14, 1997 Analyst, January 1998, Vol. 123 29

ISSN:0003-2654    

DOI:10.1039/a704893i

出版商:RSC    

年代:1998

数据来源: RSC

摘要:

Concentrations of radon and decay products in various underground mines in western Turkey and total effective dose equivalents† G�ung�or Yener and E`sref K�uç�ukta`s Ege University, Institute of Nuclear Sciences, 35100 Bornova, Izmir, Turkey In the present work radon concentration measurements were performed for one year in 12 different boron, chromium and coal underground mines in Western Turkey. Lucas cells and nuclear track detectors were used for the measurements of radon and its decay products.The effects of parameters, such as type of mine, gallery depth and ventilation rate, on the radon concentration in mine air were examined. The radiation exposure doses of miners due to the inhalation of radon and radon daughters were determined. Gamma survey measurements were also realized together with radon measurements and the total effective dose equivalents in mSv y21 were estimated. Keywords: Radon; underground mines; effective dose Exposure to radon and its decay products is the most significant component of natural radiation exposure of the general population.Among the radon isotopes 222Rn, with the longest half life (3.85 d), is the most important one since it is formed from alpha decay of 226Ra in the decay chain of 238U that is widely distributed throughout the earth’s crust. Radon emanates from soil, rock and water and becomes dispersed in air. Being a noble gas it migrates by diffusion and convection without any significant interaction with the constituents of air or any airborn particulates.1 Human exposure to radon progeny occurs out of several sources.Underground mining is one of the most important technologically enhanced causes that highly contributes to occupational health risk since the ore dust containing the members of the uranium and thorium decay series are transported to the galleries through water or air circulation during mining operations. Epidemiological studies have indicated that the presence of radon and its decay products in inhaled air causes a health risk for lung cancer.2,3 Although there exist large uncertainties associated with risk estimates, studies, especially on uranium miners, have shown that the relative risk for lung cancer increases almost linearly4,5 with working level month (WLM).‡ The first evidence of a health risk associated with exposure to radon and its decay products dates back to the sixteenth century when it was noted that the mining population in Scheeberg (Germany) and Bohemia were suffering from a widespread fatal lung disease known as ‘Schneeberger Krankheit’).6 In the 1950s the theoretical grounds together with experimental investigations were used to establish the direct relation between radon progeny and increased lung cancer observed in Europe and in the United States.6 Intensive epidemiological investigations have been realized on occupational health risk but analyses related to the non-mining population did not start until late 1970s and they are comparatively rare.In recent years, substantial epidemiological and dosimetric information has been collected by the International Commission on Radiological Protection (ICRP) and in 1990, the Committee decided that exposure of miners should be classified as occupational exposure. In 1991, the commission accepted that the dose limit for workers would be 20 mSv y21, it was assumed that the exposure limit for radon progeny would be 2 WLM y21.7 Most of the epidemiological studies done on underground miners dealt with uranium and phosphate mines.8,9 However, high radon concentrations are not confined to uranium mines and mills.Since uranium minerals occur widely dispersed in the earth’s crust they are found to accompany many other minerals that are being mined commercially.1 Exposure of miners around the world from data of variable quality for 750 mines in 12 countries have been summarized by the ICRP.Human exposure levels have an average value of 1 WLM y21 with perhaps 10% or so exceeding 2 WLM y21 in non-uranium mines. Average exposures are 0.2 WLM y21 and 1 WLM y21 for coal miners and uranium miners, respectively. 7 The radon concentration in mine air depends primarily on the uranium content of the mineral and also on other parameters like geological structure, porosity, ventilation rate, moisture and activity type in the mine.10 On the other hand the severity of exposure to radon progeny depends on their concentration in air, the probability of attachment to aerosols and the particular portion of the respiratory system where they end up.11 Therefore, in the calculations for dose estimation the physical parameters that effect the radon progeny concentrations in air, aerosol attachment fractions, the accumulation in different sections of respiratory system and the risk factors for these cells must be taken into consideration.12 In this work radon concentrations in 12 different underground mines in Western Turkey have been measured monthly using two different methods.The annual exposure doses were estimated using a calculation programme that has been developed. The scope of this work excludes the treatment of other hazards, mechanically, and toxic air contaminants that are characteristics of all mining operations. However, the protective measures developed to control radiation exposure may decrease other hazards.The high ventillation rates reduce both radon, radon progeny and air toxic contaminant concentrations. Experimental Radon concentration measurements Mean 222Rn concentrations in 5 boron, 5 coal and 2 chromium underground mines were measured for monthly intervals from October 1994 to October 1995 using Lucas cell and track etching methods. The Lucas cell used in the measurements is a 160 ml cylindrical shell with 53 mm diameter and 73 mm height. The inner surface is coated with scintillation material † Presented at The Sixth Nordic Symposium on Trace Elements in Human Health and Disease, Roskilde University, Denmark, June 29–July 3, 1997.‡ WLM is a traditional unit used to describe potential alpha energy exposure.1 One working level (WL) is 1.3 3 105 MeV of potential alpha energy per liter of air and it corresponds to an activity concentration of 100 pCi l21 = 3700 Bq m23 for 222Rn. One WLM is exposure of 1 WL during 170 h per month or 3.5 3 1023 Jh m23.Analyst, January 1998, Vol. 123 (31–34) 31made of silver-activated ZnS sensitive to alpha particles. It has a quartz window and is optically coupled to a photomultiplier tube (PM) tube. The cell has two inlets, one connected to a vacuum pump to make the air with radon enter the cell after passing through a filter located at another inlet to prevent the decay products from entering the cell. Sampling and counting periods were taken as 10 min.The alpha counts in cpm were converted to radon concentrations in Bq m23 using the calibration factor of 71 Bq m23/cpm obtained from a series of experiments done by a radium standard. The average radon concentrations in the air of underground mines were also measured using nuclear track detectors. CR-39 films cut in 1 cm2 pieces were attached to the bottom of the plastic cups, the front of them were covered with a filter to prevent the dust from entering the cups. The films in the cups were hung at different points in the galleries; after 3 months exposure they were collected and chemically processed to turn the alpha tracks in to visible etch pits.The process solution was 20% NaOH, the bath temperature 70 °C and the developing time 12 h. The calibration constant obtained was 5 kBq m23/track h21 in a series of experiments using a 174.26 l tank with known radon concentrations maintained by a Ra standard. Gamma survey It is necessary to emphasize that underground miners are subject to the radiation of not only the radon progeny inhaled but also to the external gamma radiation from long lived radon daughters, 214Bi and 214Pb. Two gamma survey meters, one Scintrex-B GS-4 (Scintrex, Concord, Ont., Canada) and the other Ludlum micro-R meter (Ludlum Measurements, Sweetwater, TX, USA) were used in gamma measurements.The background counts with these survey meters were regis 45–50 cps and 4–5 mR h21, respectively. The effective dose equivalents were calculated using the conversion factor,13 1 mR h21 = 0.04 mSv y21.Natural radionuclides in the ores Since the radiation doses are closely related to the radionuclide content of the ore in the mine, the ore samples taken from the mines were analysed for their uranium, thorium and potassium concentrations. In geological samples it is generally assumed that 238U and 232Th are in radioactive equilibrium with 226Ra and 228Ra, respectively. Therefore, the concentrations determined through the activity of the decay products are named as equivalent concentrations and denoted by eU and eTh.An ore sample of 100 g from each mine was ground, dried and then sealed in a 5.7 mm diameter cylindrical polyethylene box and left for about one month to attain equilibrium between radium and radon. Gamma spectra were taken with a 3 in 3 3 in detector, 4096 channel Ortec 7010 analyser (EG & G Ortec, Oak Ridge, TN, USA) and related electronic accessories.The eU, eTh and %K contents were determined from 1.76 MeV 214Bi, 2.62 MeV 208Tl and 1.46 MeV 40K gamma lines, respectively, with a method given elsewhere.14,15 Dose calculations Definitions Absorbed dose, D, is a measure of the average energy absorbed by a cell. The conventional unit is the rad and the SI unit is the gray (Gy) where 1 Gy = 100 rad. The dose equivalent, H, is the product of the absorbed dose, D, by the quality factor Q: H = D 3 Q. The conventional unit is the rem and the SI unit is the sievert (Sv) where 1 Sv = 100 rem.Since the influence of radiation on different organs and on different individuals is not same the idea of ‘tissue dose equivalent’ HT was introduced by the ICRP. It is obtained by correcting the dose equivalent using parameters such as deposition coefficient, tissue mass, working period and breathing rate explained below. Another concept in relation to total dose of individuals ‘effective dose equivalent’ HE has been developed by the ICRP to place limits on the total exposure by adding all HT values.It is obtained as the sum of the mean tissue dose equivalents multiplied by a tissue weighting factor, WT, which accounts for the radiosensitivity of an organ or tissue, namely7 HE = S WTHT + HE (g) (1) Calculation procedure From 1956 a significant amount of work was realized on developing mathematical models for dose calculations. The historical development for the published dose calculations is given for 222Rn progeny by James.6 The calculations are based on the radiation delivered to lung, since it is the most sensitive organ as far as radon and its progeny are concerned. 222Rn, its parent 226Ra and its decay products are members of the 238U decay chain. A segment of this chain that has the products of prime radiological interest owing to their potential for retention in the lung is given below. Æ Æ Æ Æ Æ Æ 222 218 214 214 214 Rn 3.82 d Po 3.11 m Pb 3.82 d Bi 19.9 m Po a a b b Decay constants of these products and other physical parameters are used in the calculations as explained below.Three steps are followed in the mathematical computations: Step 1. Calculations related to the medium. The calculation in this section is based on the steady state Jacobi model.6 In this, attached and unattached fraction, potential alpha energy concentration (PAEC) in the mine air and equilibrium factors are calculated in relation to the physical parameters of the medium.These parameters are: lv, the probability for removal of attached and unattached product by ventilation; la, the probability for attachment to aerosols or for radioactive decay to transform to the next product; lI, the probability for disappearance of a product with its own decay constant; ld,f and ld,a, the removal of free or attached products by plate out on fixed surfaces; and p, the appearance of a free product from decay of an attached product.The first four mechanisms here have decreasing effects on the nuclide concentrations. The basic idea in the calculations is to set up the differential equations of daughter nuclides in attached (a) and free (f) forms and to solve them to obtain the concentrations. The general form of the differential equation is dNi,x/dt = (rate of production)i,x 2 (rate of removal)i,x (2) here Ni refers to product nuclei and x indicates the free or attached form of it. Considering the incremental or decremental effect of the above parameters on the product concentrations the differential equation for the first product 218Po in the free form would be written as follows:7 dN2,f/dt = l1N1 2 lrN2,f (3) Solution of this equation gives the number of free 218Po nuclei as N2,f = (l1N1/lr) (1 2 e2lrt) (4) where N1 and N2 refer to 222Rn and 218Po, respectively, and 32 Analyst, January 1998, Vol. 123lr = l2 + lv + la + ld,f Similarly, the number of other products are also calculated. A great deal of research has been done for the numerical values of the physical parameters used above, the results of these works have been collected and reported in ref. 6. The results show a wide range. Since there is no possibility to measure these parameters except ventillation rate in mines, for the numerical values in our calculations we used geometric means of the reported values.6 These parameters are, in fact, closely related to the mining activities and it is not possible to measure them separately, therefore, observation of radon progeny concentrations with respect to mining activity is not done.Step 2. Calculations related to the respiratory system. In this part of the computation procedure the fractions of the radon progeny concentrations accumulated and PAEC in different sections of the respiratory system were calculated. The respiratory system is divided into three regions,16 the nasopharnyx (N), bronchial trache (B) and pulmonary cells (P).The energy DPAECJ deposited in each portion of the system is computed by making use of the deposition coefficients16 and decay constants by the relation6 DPAECJ = (5.79 l2 DN2j + 28.5 l3 DN3j + 21 l4 DN4j) 10210 joule (5) where j refers to the parts of the respiratory system, DN2j, DN3j and DN4j are the doses from the product nuclides 218Po, 214Pb and 214Bi deposited respectively in the regions j and l2, l3, l4 are the decay constants of these nuclides.Step 3. Dose equivalents. The tissue doses were calculated using the relation6 H m V T Q T J J S S (DPAEC) = (6) where VS is the breathing rate (1.2 m3 h21), TS is the annual working period (2000 h), Q is the quality factor, which is 20 for a radiation. The mass, mJ, of tissue j is taken as 0.04 and 0.07 kg for regions B and P, respectively. The dose deposited in region N (nose, mouth and trache) is small and ignored in the calculations. The annual effective dose equivalents from radon progeny were calculated by eqn. (1) The weight factors, WT, of regions B and P were accepted as 0.06.1 Radon itself also contributes a small amount to total dose, it is evaluated using the relation17 HE (Rn) = 1.8 3 10210 A1 (7) where A1 is the radon concentration in Bq m23.HE (g) (for gamma exposure is calculated using the conversion factor 0.04 mSv y21 = 1 mR h21 given before. Results and discussion Radionuclide concentrations of the minerals taken from the underground mines investigated are given in Table 1.18 As expected, U and Th concentrations are higher in coal minerals than in boron and chromium minerals.In fact, the natural radionuclide content of these latter two minerals are lower than the mean concentrations found in rocks. Table 2 gives the range of all experimental data obtained from the measurements and of the dose equivalents calculated using the model summarised in the previous paragraphs.18 The parameters used in the calculations are the measured radon concentrations at different depths of each underground mine, decay properties of radon daughters, attachment fractions calculated, measured ventilation rates and weight factors for the tissues.The exposure doses in WLM y21, the tissue doses, annual effective dose equivalents due to radon progeny and due to gamma radiation were calculated at each measurement station. Overall results are summarised in Table 2. Effect of ventilation Ventilation rate is the most effective parameter used in the calculation of lung doses.Radon progeny concentration as well as the doses exhibit large variations with ventilation rate even in the same mine from code to code. A typical set of experimental data that shows the effect of ventilation on radon concentrations is given for coal mine II in Table 3. The measurements have shown, as expected, that increased ventilation causes a decrease Table 2 Ranges of average Rn concentrations, the exposure doses and the annual effective dose equivalents in mSv y21 Radon Exposure dose/ Lung dose, progeny, Mine Radon/Bq m23 WLM y21 HT HE Gamma, HE Total, HE Boron I 63–112 0.41–0.78 26.2–50 1.57–3 0.12–0.44 1.75–3.12 Boron II 51–117 0.31–0.66 18.9–43.2 1.14–2.6 0.2–0.24 1.38–2.8 Coal I 51–96 0.21–0.67 14.2–42.3 0.86–2.5 0.2–0.36 1.06–2.7 Coal II 42–185 0.13–0.86 9.2–57.4 0.63–3.44 0.44–0.88 0.99–4.16 Coal III 33–74 0.22–0.55 13.9–34.6 0.83–2.08 0.4–0.56 1.35–2.48 Coal IV 31–156 0.2–0.95 14–60.7 0.84–3.64 0.32–0.56 1.22–4.16 Coal V 74–96 0.49–0.62 31.2–39.2 1.77–2.36 0.32–1.4 1.97–3.57 Chromium I 10–34 0.06–0.23 4.2–14.4 0.31–0.86 0.12–0.16 0.37–0.98 Chromium II 13–35 0.09–0.25 7.1–15.6 0.35–0.94 0.08–0.16 0.51–0.97 Chromium III 10–15 0.09–0.11 4.5–6.7 0.27–0.37 0.08–0.16 0.43–0.56 Chromium IV 10–20 0.11–0.78 5–10.7 0.3–0.64 0.08–0.16 0.46–0.8 Chromium V 12–34 0.08–0.24 5.3–15.2 0.32–0.91 0.08–0.16 0.4–0.99 Table 1 Natural radionuclide contents of the ores Mine eU (ppm) eTh (ppm) K (%) Coal I 4.93 3.72 0.23 Coal II 5.08 3.95 0.23 Coal III 6.43 3.98 0.28 Coal IV 6.02 4.07 0.25 Coal V 5.02 6.02 0.28 Boron I 0.12 4.88 0.17 Boron II 0.11 4.11 0.15 Chromium I 0.15 1.66 0.19 Chromium II 0.12 1.73 0.13 Chromium III 0.18 1.42 0.17 Chromium IV 0.10 1.02 0.16 Chromium V 0.15 0.72 0.18 Analyst, January 1998, Vol. 123 33in aerosol concentration and residence time of progeny in mine air. This leads to a reduction in dose due to a large decrease in the potential alpha-emitter concentration available for deposition in the respiratory system.The reduction in radon exposure due to improved ventilation is documented for New Mexico miners as 5.40 WLM in 1967 to 0.5 WLM in 1980 and subsequently stayed at this level.19 Effect of mine type In spite of the fact that there exists only natural ventilation in the galleries, relatively low average radon concentrations were observed in chromium mines. It is because, firstly, the natural radionuclide content of these ores are lower (as seen in Table 1).Secondly, the geological structure is in the form of massive rocks with low porosity which resist radon migration and emanation. As a result the lowest total annual effective dose equivalents are also low in these mines. The lowest and the highest values for total annual effective doses are 0.37 mSv y21 and 4.16 mSv y21 in chromium I and coal II mines, respectively. The maximum lung dose observed was 60.7 mSv y21 in, again, coal mine II.Although the data obtained for coal mines are the highest, as far as the ranges and the average values are concerned the data for boron mines are higher than the others. Little investigation is reported in the literature for concentrations of U and Th in boron and chromium mines. In coal mines, the average activity concentration is given as 1.6 ppm for both U and Th in the Unscear report20 based on the analysis of samples from 15 countries.In the underground mines studied in this work the highest exposure dose, 0.95 WLM y21, again was observed in coal mine II. This is lower than the limiting value of 2 WLM y21 given by the ICRP,17 but it is higher than the average exposure dose, 0.2 WLM y21 for underground coal miners obtained from studies done in different countries. In the EPA report1 the mean annual radon decay product exposure is estimated as 0.3 WLM y21 for the non-uranium miners. Our results for boron and for some coal mines are higher than this value.This is the first work done on radiation exposure of underground miners in Turkey. The work will continue extending the study area and monitoring duration. References 1 Eichholz, G. G., Environmental Radon, ed. Cothern, C. R., and Simith, Jr., J. E., 1987, p. 131. 2 Hornung, R. W., and Meinhardt, T. S., Health Phys., 1987, 52, 417. 3 Hoffmann, W., Katz, R., and Chunxiang, Z., Health Phys., 1986, 51, 457. 4 National Council on Radiation Protection and Measurements, NCRP Report No. 78, 1984. 5 International Commission on Radiological Protection ICRP Publication 50, Annals of the ICRP, Pergamon Press (Oxford), 1987, 17, No. 1. 6 Radon and Its Decay Products in Indoor Air, ed. Nazaroff, W. W., Nero Jr. A. V., Wiley, 1988. 7 Roger, H. C., Health Phys., 1995, 69, 454. 8 Archer, V. E., Waqoner, J. K., and Lundin, F. E., Health Phys., 1973, 25, 351. 9 Lubin, J. H., Boice, J. D., Jr., Edling, C., Hornung, R.W., Howe, G., Kunz, E., Kusiak, R. A., Morrison, H. I., Radford, E. P., Samet, J. M., Tirmarche, M., Woodward, A., and Yao, S. X., Health Phys., 1995, 69, 494. 10 Gessel, T. F., Health Phys., 1983, 45, 289. 11 Wilkening, M., and Mcname, E., Radiation Protection Dosimetry, 1988, vol. 24 No. 1/4. 12 Hoffmann, W., Steinhausler, F., and Pohl, E., Health Phys., 1979, 37, 517. 13 Farzad, S., Erees, F. S., and Yener, G., in Second International Conference on Chemistry in Industry, 24–26 October, Bahrain, 1994, p. 710. 14 Killeen, P. G., Geol. Surv. Can. Econ. Geol. Rep., 1979, 31, 63. 15 Yaprak, G., and Yener, G., J. Geochem. Expl., 1992, 42, 345. 16 Inhalation Risks from Radioactive Contaminants, IAEA Technical Report, 1973, No. 142. 17 International Commission on Radiological Protection ICRP Publication 32, Annals of the ICRP, Pergamon Press (Oxford), 1981, 6, 1. 18 K�uç�ukta`s E., PhD. Thesis, Ege University, Izmir, Turkey, 1966. 19 Morgan, M. V., and Samet, J. M., Health Phys., 1986, 50, 656. 20 United Nations Scientific Committee on the Effects of Atomic Radiation (UNSCEAR), 1982 Report to the General Assembly, with annexes. United Nations sales publication E.82.IX.8, United Nations, New York, 1982. Paper 7/04880G Received July 8, 1997 Accepted October 31, 1997 Table 3 Average doses from coal mine II HT/mSv y21 Gamma, Total Radon/ Rn, HE/ HE/ HE/ Ventillation Mine Bq m23 B P T mSv y21 mSv y21 mSv y21 WLM y21 rate/h21 Code +32 42 7.5 1.7 9.2 0.552 0.44 0.99 0.13 2.24 Code 218 50 9.6 2.3 11.9 0.71 0.88 1.59 0.17 1.87 Code 214 56 10.8 2.6 13.4 0.8 0.48 1.28 0.19 1.87 Code +5 185 45.4 12 57.4 3.44 0.72 4.16 0.86 1.0 Code +1 60 12.3 3.1 15.4 0.92 0.68 1.6 0.22 1.60 Code +24 48 8.5 2.0 10.5 0.63 0.56 1.19 0.15 2.27 34 Analyst, January 1998, Vol.

ISSN:0003-2654    

DOI:10.1039/a704880g

出版商:RSC    

年代:1998

数据来源: RSC

摘要:

Selenium levels, thiobarbituric acid-reactive substance concentrations and glutathione peroxidase activity in the blood of women with gestosis and imminent premature labour† Jolanta Gromadzinska*a, Wojciech Wasowicza, Grzegorz Krasomskib, Danuta Broniarczykb, Michal Andrijewskic, Konrad Rydzynskia and Piotr Wolkanind a Department of Toxicology and Carcinogenesis, Nofer Institute of Occupational Medicine, 90-950 Lodz, Poland b Clinical Division of Pathologic Pregnancy, Polish Mother Memorial Hospital, 90-338 Lodz, Poland c Department of Toxicology Military Medical Academy, 90-759 Lodz, Poland d Department of Ultrastructural Pathology Military Medical Academy, 90-759 Lodz, Poland The aim of the study was to investigate antioxidant status, monitored by selenium and thiobarbituric acid-reactive substance concentrations in blood plasma, and glutathione peroxidase activity in erythrocytes and blood plasma in women with gestosis (n = 26), imminent premature labour (n = 48) and normal pregnancy (n = 23) during 19–38 weeks of pregnancy.Selenium concentrations in blood plasma were significantly higher in women with pathological pregnancies than in normal (45.5 ± 10.5 mg l21, p < 0.01 and 44.1 ± 11.6 mg l21, p < 0.05 vs. 38.6 ± 8.3 mg l21, respectively). In all groups of pregnant women Se concentrations were extremely low as compared with non-pregnant females. Glutathione peroxidase (GSH-Px) activity in blood plasma was significantly higher in complicated pregnancies than in healthy ones.There were no significant differences in thiobarbituric acid-reactive substance concentrations between all groups of pregnant women. Statistically significant correlations were found between blood plasma Se concentrations and GSH-Px activity in healthy pregnant (r = 0.53, p < 0.01), imminent premature labour (r = 0.39, p < 0.01), and non-pregnant females (r = 0.56, p < 0.001). Keywords: Pregnancy; gestosis; premature labour; selenium; glutathione peroxidase; thiobarbituric acid-reactive substances High risk pregnancy may lead to perinatal mortality of foetuses and neonates and poses a threat to the mother, contributing to frequent occurrence of complications which may sometimes be fatal.A typical example of high risk pregnancy is primary or secondary gestosis. The symptoms of gestosis occur in about 20% of high risk pregnancies in Poland. The aetiology of gestosis remains unclear.Its most common symptoms are rapid increase of body mass and oedema of lower limbs, in advanced forms accompanied by proteinuria and hypertension. If not treated, the most severe forms easily turn into preeclampsia and eclampsia. Premature birth is the most common cause of foetal and neonatal mortality accounting for about 80% of perinatal deaths. About 13% of pregnancies in the Lodz region and about 7% in Poland are at risk of premature birth. It is believed that high incidence of premature birth, especially in industrial areas, may result not only from the motherAs predisposition, but also from her lifestyle and pollution of the environment.Life in an oxygen medium requires establishment of mechanisms of protection of vital cells from oxygen-induced damage that could result from oxygen free-radical species produced during metabolism. A disturbance of the balance between formation of active oxygen metabolites and the tempo at which they are scavenged by enzymatic and non-enzymatic antioxidants is referred to as oxidative stress.1 Oxidative stress has been suggested to play a role in some physiological conditions and in many disease processes, including ageing, pregnancy and its complications, carcinogenesis, hypertension, atherosclerosis and diabetes, etc.1,2 Several investigators have reported that in normal pregnancy, peroxidation and antioxidant reactions are increased as compared with non-pregnancy.3,4 Selenium (Se) is an essential trace element necessary for maintaining optimal activity of glutathione peroxidase (GSHPx), an enzyme which may play an important role in protecting polyunsaturated fatty acid biological membranes from oxidative damage.5 There is evidence that Se is particularly important in the nutrition of pregnant women whose requirement for this element is significantly increased during pregnancy and puerperium.6 The present knowledge of the role of Se in pregnancy and in neonatal life is sparse.Dietary Se deficiency has been reported to result in abnormal foetal and postnatal development in laboratory animals.7 Selenium deficiency in preterm infants has been associated with increased haemolysis in babies exposed to oxidant stress8 and the increased risk of pulmonary damage in preterm infants treated with oxygen for respiratory distress syndrome.9 In our previous study we discovered that Se concentrations in whole blood and blood plasma and GSH-Px activity in the blood plasma of delivering women were significantly lower than in the non-pregnant female.10,11 The level of Se in the blood of the residents of our country is relatively low12 and it is estimated that dietary selenium intakes are less than the minimum doses considered safe and adequate. 13 Imbalance of increased lipid peroxides and a decrease in a net antioxidant activity have been reported, not only in normal pregnancies but also in cases of gestosis3, habitual abortion14 and in premature infants.15 The aim of the present study was to examine antioxidant/ oxidant status, monitored by the concentration of blood plasma Se and thiobarbituric acid reactive substances (TBARS, as marker of peroxidative processes) and activity of blood plasma and erythrocyte GSH-Px in women with gestosis, imminent premature labour and normal pregnancy.† Presented at The Sixth Nordic Symposium on Trace Elements in Human Health and Disease, Roskilde, Denmark, June 29–July 3, 1997.Analyst, January 1998, Vol. 123 (35–40) 35Experimental Studies were carried out on 97 women, patients of the Clinical Division of Pathologic Pregnancy Polish Mother Memorial Hospital in Lodz, Poland, in 1995. Twenty-three healthy pregnant women, 26 pregnant women with gestosis and 48 women with imminent premature labour aged from 21 to 39 years in the second and third trimester of pregnancy were chosen for this study. A group of 64 aged-matched nonpregnant healthy women were investigated as controls.Gestosis was defined as: the onset of hypertension, blood pressure > 140/90 mm Hg; proteinuria, > 3.0 g protein d21; and oedema persisting after a night’s rest. The women with diagnosed gestosis were given drugs to lower blood pressure and improve blood supply. Imminent premature labour was diagnosed on the basis of premature uterus contractions (over 100 Montevideo units) and a change of the uterine cervix configuration.Drugs of the gestagen, spasmolytic and psychopharmacological groups were administered to all women with imminent premature labour to stop uterus contractions. Blood samples were collected in heparinized tubes free of trace elements. After centrifugation, blood plasma was removed and used for further analysis. Red blood cells were washed three times with 0.9% NaCl solution and lysed by freezing and thawing. Stroma was removed by centrifugation and haemoglobin concentrations in haemolysates were measured by the cyanmethaemoglobin method.The protocol of this study was approved by the Ethical Committee of the Medical Academy in Lodz. At the time of blood collection, the patients selected for the examination completed a questionnaire concerning their living conditions, lifestyle, dietary habits and medication received. The respondents defined their material status as good, consumed products typical of Polish diet, did not smoke during pregnancy and drank alcohol only occasionally.The patients who received medication containing antioxidants were excluded from the investigation. Selenium concentrations were assayed by the fluorimetric method of Watkinson.16 A detailed description of the method of Se determination has been published elsewhere.17 Lyophilised human reference serum samples of the Seronorm (batch number 010017) from Nycomed Pharma AS (Oslo, Norway) were used to assess the accuracy of the methods.The mean Se concentrations for eight determinations of human serum were 94.5 ± 2.1 mg l21, as compared with the recommended value of 96 mg l21. The RSD for plasma was 3.8% (n = 8). The recovery of Se from reference materials was 92–104% (98% average). GSH-Px activities in lysed red blood cells and blood plasma were measured by the method of Paglia and Valentine18 with tert-butyl hydroperoxide as substrate. One unit of the enzyme activity was defined as micromoles of NADPH oxidised per minute per gram of haemoglobin or millilitre of blood plasma. TBARS concentrations in blood plasma were determined by the optimised fluorimetric procedure as modified by Wasowicz et al.19 The data were expressed as mean ± s and subjected to statistical analysis using StudentAs t-test, analysis of variance, and calculation of correlation coefficients.Statistical significance was set on p < 0.05. Results At the time of examination, blood pressure of all gestosis patients was stable (diastolic 86.2 ± 14.6 mm Hg and systolic 138.7 ± 14.6 mm Hg) and pressure stabilising drugs were administered to them. Biochemical indicators of renal function (uric acid, urea and creatinine concentrations in blood plasma) were normal.Blood plasma protein concentrations were 58.1 ± 6.6 g l21. In the other groups of pregnant women the above mentioned parameters were normal. Considering gestational age, ultrasonography of the foetuses showed growth retardation only in one case, in a woman with gestosis. Table 1 presents blood plasma Se concentrations and glutathione peroxidase activity in all investigated groups of pregnant women and non-pregnant controls. It was found that blood plasma Se concentrations in normal pregnancy were significantly lower than in non-pregnant females (38.6 ± 8.3 mg l21 vs. 60.7 ± 10.5 mg l21, p < 0.001). Selenium concentrations in women with gestosis and imminent premature labour were significantly higher than in healthy pregnancy (p < 0.01 and p < 0.05, respectively).GSH-Px activity in blood plasma was significantly higher in complicated pregnancies than in healthy ones. No differences were observed in erythrocyte GSH-Px between the examined groups of pregnant women. Both erythrocyte and plasma GSHPx activities were significantly lower in healthy pregnant women than in non-pregnant women (11.1 ± 3.9 U g21 Hb vs. 15.9 ± 3.3 U g21 Hb, p < 0.001 and 0.113 ± 0.045 U ml21 vs. 0.179 ± 0.033 U ml21, p < 0.0001). Blood plasma TBARS concentrations were determined in all groups of pregnant women. The differences between them were not statistically significant. However, the concentration of TBARS in the patients with imminent premature labour was about 20% higher than in the group of healthy pregnant women (1.22 ± 0.45 mmol l21 vs. 1.02 ± 0.37 mmol l21). In 20% of the patients with gestosis (5/26) and in 30% of those with imminent premature labour (15/48), TBARS concentrations were found to be higher than mean + s for healthy pregnant women (Fig. 1). In healthy pregnant women, imminent premature labour and in the group of non-pregnant female statistically significant correlations were found between Se concentrations and GSHPx activity in the blood plasma (Fig. 2). Besides, in the group of healthy pregnant women and women with imminent premature labour, a significant relationship with high correlation coefficients were observed between blood plasma Se concentrations and erythrocyte GSH-Px activity (r = 0.51, p < 0.01 and r = 0.45, p < 0.001, respectively). Furthermore, in the group of patients with gestosis, statistically significant correlation was found between TBARS concentration in blood plasma and GSH-Px activity in erythrocytes (r = 0.46, p < 0.02, Fig. 3). As the examination encompassed women at different stages of pregnancy, starting with the 19th week, Fig. 4 presents pregnancy age-dependent changes of the investigated parameters in normal pregnancy and in patients with gestosis or imminent premature labour.Statistically significant decrease in Table 1 Plasma Se concentrations and GSH-Px activities in blood plasma and erythrocytes in controls and pregnant women in the second and third trimester (mean ± s) Plasma Erythrocyte Plasma GSH-Px/ GSH-Px/ Patients n Se/mg l21 U ml21 U g21 Hb Non-pregnant 64 60.7 ± 10.5 0.179 ± 0.033 15.9 ± 3.3 Healthy pregnant 23 38.6 ± 8.3 0.113 ± 0.045 11.1 ± 3.9 p < 0.001* p < 0.0001* p < 0.001* Imminent premature labour 48 44.1 ± 11.6 0.140 ± 0.038 12.5 ± 3.2 p < 0.05† p < 0.01† Gestosis 26 45.5 ± 10.5 0.146 ± 0.048 12.4 ± 4.4 p < 0.01† p < 0.01† * Statistical significance as compared with non-pregnant women.† Statistical significance as compared with healthy pregnant women. 36 Analyst, January 1998, Vol. 123Se concentration correlated with the age of pregnancy was observed in patients with gestosis (r = 20.45, p < 0.05, Fig. 4A). In the last trimester of pregnancy, a statistically significant decrease of Se concentration and GSH-Px activity in erythrocytes and blood plasma correlated with the stage of pregnancy was observed in women with imminent premature labour (r = 20.29, r = 20.28, r = 20.29, respectively, p < 0.05 in all cases). In healthy pregnant women, gradual increase of TBARS was observed in the third trimester of pregnancy. The increase was 47% although it was not statistically significant (Fig. 4D). In the groups of patients with pathological pregnancy, TBARS concentrations were nearly the same, irrespective of the stage of pregnancy. Discussion Selenium concentrations, and thus GSH-Px activity in human blood, present wide regional variations. The mean Se concentration in blood plasma of adult inhabitants of Poland is lower than that found in inhabitants of Western Europe and comparable with the levels in the blood of inhabitants of Eastern Europe.12 In the present study, plasma Se concentrations in healthy pregnant women are extremely low (38.6 ± 8.3 mg l21), as compared with Se levels of healthy non-pregnant females (Table 1).According to available studies on Se concentration in the blood of pregnant women, these results are among the lowest in the world.20 In women with pathological pregnancies the concentration of Se in blood plasma is about 25% higher than in healthy pregnant women, although it remains one of the lowest reported in the world, comparable with the data of the female residents of New Zealand.21 The concentration of Se in plasma decreases as the pregnancy develops and reaches the lowest level just before delivery.Concentration of Se in blood plasma of women in advanced pregnancy has been demonstrated to be lower than in non-pregnant women in studies of many other centres.20,22,23 In the present work we did not find a pregnancy age-dependent decrease of blood plasma Se concentration in healthy pregnant women.The decrease of the concentration of the microelement in blood plasma observed as the pregnancy develops is sometimes connected with the increase of the volume of plasma and reduced concentration of albumins in the blood of pregnant women. However, the concentrations of many components of blood plasma, including some microelements (e.g., Cu), increase during pregnancy.24 This fact suggests that there are mechanisms which control changes of concentration of microelements in the organism during pregnancy.Korpela et al.6 demonstrated that Se concentrations in placenta and amniotic membranes must be subjected to particular control. Selenium concentrations in the placenta of Finnish pregnant women is the same as in Americans (2.28 ± 0.32 mmol kg21 vs. 2.24 ± 0.20 mmol kg21) whereas the ratio of its concentration in placenta and blood is 3 and 1.5, respectively. This may indicate that placenta and foetal membranes are being provided primarily with sufficient amounts of selenium and explain the reason of differences between the concentration of the microelement in non-pregnant and healthy pregnant women. In our investigation, the drop of Se concentration in the blood plasma of healthy pregnant women was accompanied by decreased activity of plasma and erythrocyte GSH-Px activity.Data published by other authors are not so explicit; Behne and Wolters23 reported decreased blood plasma GSH-Px activity, without changes in the activity of the enzyme in erythrocytes.Butler et al.25 and Rudolph and Wong26 observed an increase of erythrocyte GSH-Px activity. Zachara et al.22 found a gradual Fig. 1 Plasma TBARS concentrations in pregnant women (IPL; imminent premature labour). Full line represents mean TBARS level for each group of patients. Fig. 2 Relationship between blood plasma Se concentration and GSH-Px activity in non-pregnant female (A) and pregnant women (B, healthy; C, gestosis; D, imminent premature labour).Analyst, January 1998, Vol. 123 37decrease of the activity of the enzyme in blood plasma and erythrocytes during pregnancy. These differences in erythrocyte/ plasma GSH-Px activity may result from different concentrations of Se in blood/blood plasma during pregnancy. In female USA residents Se concentrations in blood were about 110 mg l21 at the beginning of pregnancy and dropped to about 70 mg l21 in the final weeks,25 whereas in healthy Polish women in the first weeks of pregnancy they were 75.8 ± 16.7 mg l21 and decreased to 49.5 ± 9.5 mg l21 in the final weeks before delivery.22 Blood plasma TBARS concentrations in normal pregnancy are higher than in non-pregnant women.3 Our studies showed that in normal pregnancy, the concentration of TBARS increases in the last trimester.Unfortunately, due to lack of analyses of blood plasma of non-pregnant women, it is not possible to compare these data with the population of healthy women.Wang et al.27 demonstrated that serum levels of lipid peroxides remained relatively stable throughout normal gestation. Analysing also concentrations of plasma vitamin E, the same authors suggested an increase of antioxidative activity of blood plasma over peroxidation with advancing gestation in normal pregnancy. Little is known about oxidant status in pathological pregnancies. It has been shown that concentrations of placental lipid peroxides are abnormally increased in preeclampsia and eclampsia.Walsh3 postulates that high levels of lipid peroxides initiate the arachidonic acid cascade, causing imbalance between thromboxane and prostacycline production. Thromboxane and unsaturated fatty acids peroxides formed in the course of its synthesis may be an important factor leading to blood vessel damage and disturbances first of placental circulation and then the motherAs circulation, which in consequence contributes to the development of different stages of gestosis.Sane et al.14 pointed out that maximum increase of concentration of lipid peroxides in blood plasma occurs immediately before spontaneous abortion. As the aetiology of imminent premature labour is unclear, an attempt was made to determine oxidant/antioxidant status in both types of abnormal pregnancies. At the time of the examination all women with pathologic pregnancy received medication, so TBARS level was affected not only by the disorders in the pregnancy, but also by the use of therapeutic agents.Therefore the increase of TBARS concentration in blood plasma of women with pathologic pregnancy should be considered an outcome of combined action of the administered drugs and disorders of the normal metabolism of the organism. In both examined pathologic conditions Se concentration and GSH-Px activity were significantly higher than in healthy pregnancy (Table 1).Uotila et al.28,29 demonstrated that the concentration of blood Se in the third trimester of pregnancy in women with different stages of gestosis does not differ from that observed in healthy pregnant females. Erythrocyte and plasma GSH-Px activities, however, were significantly higher in women with severe gestosis than in healthy pregnancies. In another work Uotila et al.2 demonstrated that total peroxyl radical-trapping capacity is significantly higher in blood plasma Fig. 3 Relationship between plasma TBARS concentration and erythrocyte (RBC) GSH-Px activity in gestosis women. Fig. 4 Pregnancy age-dependent changes in: blood plasma Se level (A); erythrocyte (B); and plasma (C) GSH-Px activity; and TBARS concentration (D). IPL, imminent premature labour; 19–24, 25–29, 30–34, 35–40 weeks of pregnancy. 38 Analyst, January 1998, Vol. 123and cerebrospinal fluid of women with gestosis than in normal pregnancy. In their investigation Nicotra et al.30 did not find differences in TBARS and vitamin E concentrations or GSH-Px activity between patients with habitual abortion 3–6 months after the most recent abortion and non-pregnant women.The relatively low number of publications on antioxidants in pathologic pregnancy does not allow extensive discussion of our results. GSH-Px is one of the primary antioxidants present in tissues that limits the concentration of lipid peroxides. It has been shown that GSH-Px activity in placentas of pre-eclamptic women is significantly lower than in placentas obtained from healthy pregnant women.31 Deficiency of GSH-Px in the placenta may be one of the factors contributing to the development of gestosis.The cause of the low GSH-Px activity in the placenta of women with gestosis is unknown. GSH-Px activity in the tissues depends on the availability of Se, and first of all on its dietary intake. However, it is probably not the dietary factors that cause the decrease of GSH-Px activity in the placenta.If its drop were due to Se deficiency in the diet, it would lead to its decrease in all tissues, and not only in the placenta. The increase of erythrocyte and blood plasma GSH-Px activity may be a protective mechanism compensating for the increase of TBARS concentration in women with gestosis. Moreover, disturbances in the normal function of kidneys in gestosis patients may result in increased blood plasma GSH-Px activity. Blood plasma GSH-Px protein originates from proximal tubular cells of the kidney.32 The studies demonstrated statistically significant relation between plasma Se concentration and erythrocyte and plasma GSH-Px activity. Since in people with appropriate concentrations of Se in blood plasma (over 100 mg l21) only a small portion of Se (10–15%) is incorporated in erythrocyte and plasma GSH-Px,25 such correlations are found only in populations with very low Se levels.Selenium in blood plasma is bound with GSH-Px, selenoprotein P and albumin.The percentage of Se content in this protein fraction depends on its availability, so its concentration in blood may also vary considerably in people.33 In Se deficiency the amount of the microelement bound with GSH-Px in erythrocytes and plasma may be as high as about 60%.33 A linear correlation between Se concentration and GSH-Px is then observed. High correlation coefficients of the statistically significant relations between Se concentration and GSH-Px activity in blood plasma may indicate that the saturation of the organism with GSH-Px has not been achieved.In women with pathologic pregnancy Se concentration in blood plasma was also higher than in healthy pregnant women. The concentration of Se in the organism depends primarily on its dietary supply. The consumption of Se in Poland is estimated to be about 40 mg d21.12 The amount which is appropriate for pregnant women is not known.High correlation coefficients between Se concentration and GSH-Px activity in blood plasma in all groups of examined women may indicate that the consumption of Se in Poland is too low to cover the demand. There are also other factors which may influence the concentration of selenium in blood; supply of antagonistic microelements (e.g. fluorine),34 smoking, alcohol consumption35 or exposure to industrial pollution.36 Moreover, it depends on accumulation in tissues in certain physiological and pathological conditions6 and on other than ‘normal’ excretion in urine.6,37 As all the examined patients lived in the same geographic region, the average dietary intake in all the groups is probably the same.Also the lifestyle, dietary habits and clinical status reported by the patients were similar. At the time of examination, the basic morphological and biochemical indices of the blood of patients with complicated pregnancies were normal. In women with gestosis, blood pressure was stabilised and oedema was eliminated.In all groups of examined women, ultrasonography showed that the development of foetuses was normal, considering gestational age. This provided grounds for the assumption that the increase of plasma volume in all examined groups of women was comparable. Therefore it can be speculated that increased Se concentration in blood plasma of women with gestosis and imminent premature labour results from metabolic changes caused by pathologic pregnancy.It might also explain the increased activity of plasma GSH-Px. Barrington et al.38 demonstrated significant decrease of serum Se concentration in women in the first trimester of pregnancy at risk of nonrecurrent miscarriage. Mask and Lane39 found out that GSH-Px activity in plateletrich plasma in women with imminent premature labour is significantly higher than in healthy pregnant women and comparable with non-pregnant women. They did not observe differences in the concentration of plasma Se in the examined groups of women but at the time of labour it was about four times higher than in the groups of patients examined in our study (130 ± 30 mg l21 vs. 40.5 ± 4.2 mg l21 in healthy pregnant women and 120 ± 30 mg l21 vs. 36.5 ± 13.2 mg l21 in imminent premature labour).39 Uotila et al.,29 who examined women with hypertensive complications of pregnancy, did not find differences in their blood Se concentration in comparison with the control group.However, it can be supposed that the clinical status of the two groups of examined women differed considerably. The comparison of Se concentration in foetal blood or umbilical blood of babies born by mothers with gestosis and healthy women was very interesting. The decrease of GSH-Px activity in erythrocytes and platelets of umbilical blood of a neonate born by a mother with gestosis may suggest accumulation of antioxidants in maternal organism as a kind of mechanism protecting from oxidative stress.29 The same authors also demonstrated that significantly increased plasma or platelet GSH-Px activity is associated with poor outcome of pregnancy.29 The results of the present study and the analysis of data by other authors indicate that changes of plasma Se concentration and erythrocyte and plasma GSH-Px activity during pregnancy depend in general on the concentration of Se in the whole population of a given area.When Se concentration in blood of non pregnant women is high, the changes of Se concentration and of Se-dependent GSH-Px activity during pregnancy do not involve significant decrease of concentration/activity of these antioxidants.However, when the concentrations are low, physiological transfer of Se and GSH-Px between tissues causes much more drastic decrease of these antioxidants in blood plasma. In conclusion, our results indicate that pregnancy influences blood Se status and GSH-Px activity.Complications of pregnancy are accompanied by lipid peroxidation and elevated levels of antioxidants, selenium concentrations and GSH-Px activity. It would be advisable to continue studies on the balance of TBARS, Se, GSH-Px and other antioxidants in the foetus, placenta and mother in pathological pregnancies. References 1 Papas, A. M., Lipids, 1996, 31, S77. 2 Uotila, J. T., Kirkkola, A. L., Rorarius, M., Tuimala, R. J., and Metsa- Ketela, T., Free Radicals Biol. Med., 1994, 5, 581. 3 Walsh, S. W., Hypertens. Pregnancy, 1994, 13, 1. 4 Walsh, S. W., in World Review of Nutrition and Dietetics, ed. Simopoulos A. P., and Karger, S., Basel, Switzerland, 1994, pp. 114–118. 5 Neve, J., Experientia, 1991, 47, 187. 6 Korpela, H., Loneniva, R., Yrjanheikki, E., and Kauppila, A., Int. J. Vitam. Nutr. Res., 1984, 54, 257. 7 Smith, A. M., and Picciano, M. F., J. Nutr., 1986, 116, 1068. Analyst, January 1998, Vol. 123 398 Gross, S., Semin. Hematol., 1976, 13, 187. 9 Kim, H. Y., Picciano, M. F., Wallig, M. A., and Milner J. A., Pediat. Res., 1991, 29, 440. 10 Zachara, B. A., Wasowicz, W., Gromadzinska, J., Sklodowska, M., and Krasomski, G., Biol. Trace Elem. Res., 1986, 19, 175. 11 Wasowicz, W., Wolkanin, P., Bednarski, M., Gromadzinska, J., Sklodowska, M., and Grzybowska, K., Biol. Trace Elem. Res., 1993, 38, 205. 12 Wasowicz, W., Proceedings of the Fifth International Symposium on Uses of Selenium and Tellurium, ed. Carapella, S. C., Olfield, J. E., and Palmieri, Y., Bibliotheque Royale de Belgique `a Bruxelles, Brussels, 1994, pp. 163–170. 13 Levander, O. A., J. Am. Diet. Assoc., 1991, 91, 1572. 14 Sane, A. S., Shobha, A., Mishra, V. V., Barad, D. P., Shah, V. C., and Nagpal, S., Gynecol. Obstet. Invest., 1994, 31, 172. 15 Kelly, F. J., Brit. Med. Bull., 1993, 49, 668. 16 Watkinson, J. H., Anal. Chem., 1966, 38, 92. 17 Wasowicz, W., and Zachara, B. A., J. Clin. Chem. Clin. Biochem., 1987, 25, 402. 18 Paglia, D.E., and Valentine, W. N., J. Lab. Clin. Med., 1967, 70, 158. 19 Wasowicz, W., Neve, J., and Peretz A., Clin. Chem., 1993, 39, 2522. 20 Bro, S., Berendtsen, H., Norgaard, J., Host, A., and Jorgensen, P. J., J. Trace Elem. Electrolytes Health Dis., 1988, 2, 165. 21 Thomson, C. D., and Robinson, M. F., Am. J. Clin. Nutr., 1980, 33, 303. 22 Zachara, B. A., Wardak, C., Didkowski, W., Maciag, A., and Marchaluk, E., Gynecol. Obstet. Invest., 1993, 35, 12. 23 Behne, D., and Wolters, W., J. Clin. Chem. Clin. Biochem., 1979, 17, 133. 24 Campbell, D. M., Proc. Nutr. Soc., 1988, 47, 45. 25 Butler, J., Whanger, P. D., and Trip, M. J., Am. J. Clin. Nutr., 1982, 36, 15. 26 Rudolph, N., and Wong, S. L., Pediatr. Res., 1978, 12, 789. 27 Wang, Y., Walsh, S. W., Guo, J., and Zhang, J., Am. J. Obstet. Gynecol., 1991, 165, 1690. 28 Uotila, J. T., Tuimala, R. J., Aarnio, T. M., Pyykko, K. A., and Ahotupa, M. O., Br. J. Obstet. Gynaecol., 1993, 100, 270. 29 Uotila, J., Tuimala, R., Pyykko, K., and Ahotupa, M., Gynecol. Obstet. Invest., 1993, 36, 153. 30 Nicotra, M., Muttinelli, C., Sbracia, M., Rolfi, G., and Passi, S., Gynecol. Obstet. Invest., 1994, 38, 223. 31 Walsh, S. W., and Wang, Y., Am. J. Obstet. Gynecol., 1993, 169, 1456. 32 Avissar, N., Ornt, D. B., Yagil, Y., Horowitz, S., Watkins, R. H., Kerl, E. A., Takashaki, K., Palmer, I. S., and Cohen, H. J., Am. J. Physiol, 1994, 266, C367. 33 Xia, Y., Zhao, X., Zhu, L., and Whanger, P. D., J. Nutr. Biochem., 1992, 3, 211. 34 Wasowicz, W., Golebiowska, M., and Chlebna-Sokol, D., Trace Elem. Med., 1988, 5, 43. 35 Alfthan, G., and Neve, J., J. Trace Elem. Med. Biol., 1996, 10, 77. 36 Gromadzi�nska, J., W�asowicz, W., Sk�lodowska, M., Bulikowski, W., and Rydzy�nski, K., Environ. Health Perspect., 1996, 104, 1312. 37 Swanson, C. A., Reamer, D. C., Veillon, C., King, J. C., and Levander, O. A., Am. J. Clin. Nutr., 1983, 38, 169. 38 Barrington, J. W., Lindsay, P., James, D., Smith, S., and Roberts, A., Brit. J. Obstet. Gynaecol., 1996, 103, 130. 39 Mask, G., and Lane, H. W., Nutr. Res., 1993, 13, 901. Paper 7/05396G Received July 25, 1997 Accepted October 22, 1997 40 Analyst, January 1998,

ISSN:0003-2654    

DOI:10.1039/a705396g

出版商:RSC    

年代:1998

数据来源: RSC

摘要:

Iron metabolism and human ferritin heavy chain cDNA from adult brain with an elongated untranslated region: new findings and insights† Maire E. Percy*a, Simon Wonga, Sharon Bauera, Negin Liaghati-Nasseria, Marc D. Perryb, Vijay M. Chauthaiwalec, Madhu Dharc and Jayant G. Joshic a Department of Physiology, University of Toronto and Surrey Place Centre, 2 Surrey Place, Toronto, Ontario, Canada M5S 2C2 b Department of Molecular and Medical Genetics, University of Toronto, Toronto, Ontario, Canada M5S 1A8 c Department of Biochemistry, University of Tennessee, Knoxville, TN 37996, USA Ferritin is a ubiquitous protein which plays a major role in iron sequestration, detoxification and storage.In this paper we highlight the role of ferritin in iron homeostasis and describe factors and diseases that affect its expression. We also describe new studies which further characterize the structure and expression of a novel form of ferritin heavy (H) chain mRNA that was identified in brain and discuss possible implications of these findings.Human fetal and adult brain cDNA libraries previously were screened with cDNA for well-characterized liver ferritin H. In addition to ‘liver-like’ brain ferritin H cDNA, novel ferritin H cDNAs with an additional 279 nucleotide sequence at the 3Auntranslated region (UTR) were identified in both libraries (see refs. 1 and 2; Dhar, M., Chauthaiwale, V., and Joshi, J. G., Gene, 1993, 126, 275 and Dhar, M., and Joshi, J.G., J. Neurochem., 1993, 61, 2140). However, relative to liver ferritin H cDNA, these novel cDNAs were incomplete at their 5Aends [see ref. 3; Joshi, J. G., Fleming, J. T., Dhar, M. S., and Chauthaiwale, V., J. Neurol Sci., 1995, 134, (Suppl.), 52]. In the present paper, by sequencing of cDNAs using reverse transcriptase polymerase chain reaction, we show that the 279 nt 3AUTR sequence, a coding sequence identical to that in human liver ferritin H, and a full-length 5AUTR that includes one mRNA regulatory iron-response element sequence, co-exist in at least one species of ferritin H transcript in six normal human adult and six late-onset, sporadic Alzheimer disease (AD) brains.This sequence is the same in the normal and AD brains. Dot-blot analysis of poly A+ RNAs from different human tissues indicates that relative to the coding sequence of ferritin H, expression of the 279 nt 3AUTR sequence varies among different tissues, is highest in the adult brain, and is very low in fetal brain.In normal adult hippocampus, ferritin H RNA with the novel 279 nt sequence localizes strongly to small non-neuronal cells, capillary endothelial cells, and to selected populations of neurons (granule cells of the dentate gyrus). Significant homology was observed between a region in the 279 nt 3AUTR segment of ferritin H RNA and the 3AUTR of cyclooxygenase-2 mRNA (an inducible iron-containing enzyme involved in prostaglandin synthesis).Possible functions for ferritin H protein derived from the novel message and for the elongated 3AUTR and 5AUTR are discussed. Keywords: Human ferritin heavy chain; brain; cDNA sequence; Alzheimer’s disease; iron metabolism; iron response element; 3Auntranslated region; 5Auntranslated region; cyclooxygenase-2; RNA secondary structure Introduction Pathways involved in iron homeostasis Iron is not only a cofactor of many heme and non-heme enzymes, but it also is an essential participant in many metabolic processes including DNA, RNA, protein synthesis, the formation of myelins and development of neuronal dendritic trees.4 Because free iron will catalyze the formation of free radicals which oxidize nucleic acids, protein, and lipid, the metabolism of iron is highly regulated by complexing to specific transport and storage proteins. A number of different pathways involved in iron uptake by cells have been described; which pathways are used in a cell depends upon the cell type and the availability and need for iron.The pathway that has been most studied involves complexing of the iron transporting protein, transferrin, to the transferrin receptor, and internalization of the complex through receptor-mediated endocytosis.5–9 In this process, iron is liberated from the transferrin in the acidic endosome environment, transferrin is released into the extracellular fluid, and its receptor is recycled back to the plasma membrane.Immature erythroid cells are the most active in this function. The iron that is freed may be utilized in metabolic processes, sequestered and stored by ferritin, or transported through the cell. Transferrin also may be internalized by a transferrin-receptor independent system. Investigations using reticulocytes have demonstrated that the transferrin-transferrin receptor process disappears as they mature, and that uptake of ferrous iron is associated with Na+ transport across the cell membrane.8 The uptake of iron from transferrin by isolated rat hepatocytes varies in parallel with plasma membrane NADH: ferricyanide oxidoreductase activity and is Ca2+ ion dependent.10 In intestinal cells, iron uptake proceeds exclusively via integrin and a cytosolic protein called mobilferritin. 11 This latter pathway previously was demonstrated in reticulocytes and has been found to be a minor pathway in all nucleated cells studied to date.12 The presence of transferrin receptors on the luminal plasma membranes of the vascular endothelial cells, which constitute the blood–brain barrier, suggests that these participate in the transport of iron into the brain.Recent studies with rodent brain support a model in which the bulk of iron which enters brain via the binding of transferrin to tranferrin receptors exits with the bulk outflow of cerebrospinal fluid (CSF) through arachnoid villi and other channels.13 However, in a cell culture model of the blood–brain barrier consisting of a co-culture of bovine brain capillary endothelial cells and astrocytes, the majority of iron-loaded transferrin crossed the endothelial cells bound to transferrin, suggesting by-pass of the lysosomal compartment.14,15 Because † Presented at The Sixth Nordic Symposium on Trace Elements in Human Health and Disease, Roskilde, Denmark, June 29–July 3, 1997.Analyst, January 1998, Vol. 123 (41–50) 41the iron-binding protein p97 (also known as melanotransferrin) localizes to blood vessel walls in normal adult brains, p97 also has been implicated in transferring iron through the blood–brain barrier.16 It currently is believed that transferrin-bound iron can be used by all types of cells in all tissues in amounts that depend upon their complement of transferrin receptors.Although iron is transported in blood mainly bound to transferrin, in abnormal conditions other iron-containing compounds may become important.These include ferritin, hemopexin–heme, haptoglobin –hemoglobin, and non-specific non-transferrin-bound iron.8 In contrast to transferrin which is a high affinity, low capacity protein (two atoms of iron per molecule), ferritin is a lower affinity, higher capacity protein (maximum of 4500 iron atoms per molecule). In higher organisms iron bound to transferrin and stored in ferritin account for more than 90% of the total non-heme iron.17 Ferritin structure and expression Ferritin (Mr 500 kDa) is composed of 24 subunits consisting of variable numbers of 21 kDa heavy (H) chains and 19 kDa light (L) chains which form a hollow protein shell.3,17 The H and L chains are found associated in various ratios, giving rise to a wide range of isoforms depending on the physiological conditions and the type of tissue.18 H-chain rich ferritin accumulates and releases iron faster than L-chain rich ferritin does and predominates in cells and tissues which have a high level of oxidative respiration.The L subunit predominates in cells and tissues that store iron. The mechanisms by which iron is loaded into the ferritin shell is not well understood, but involves the conversion of toxic Fe2+ ions to the benign Fe3+ form.17 Factors that release iron from the ferritin shell (e.g., bursts of free radicals, high levels of ascorbic acid, or an acidic environment), result in the conversion of Fe3+ to catalytic Fe2+ which upon their release generate huge numbers of free radicals.Thus ferritin can be life-supporting or death-promoting, depending on the circumstances. Changes in transcription/accumulation of ferritin messenger ribonucleic acid (mRNA) accompany cell differentiation in development as cells establish the pattern of iron metabolism and storage that matches their specialized features.19 Ferritin gene expression varies over 1000-fold at different stages of development.20 Fetal brain has very little iron or ferritin, whereas adult brain contains large quantities of both.As much as a third of non-heme iron in adult brain is stored in this protein.3,21 Ferritin is approximately 10 times more abundant than transferrin throughout the brain, and it is evenly distributed as is iron, between gray and white matter. There is more ferritin H chain than L chain in the adult brain.18 Furthermore, HPLC analysis has revealed four distinct molecular species of brain ferritin H but only one major species of ferritin L chain.3 These observations collectively demonstrate the importance of ferritin H in the central nervous system.Factors regulating ferritin expression Two aspects of the regulation of ferritin expression are unusual. First, initiation of translation is remarkably efficient. Second, the intracellular iron concentration is a major regulator of the biosynthesis and accumulation of ferritin and certain other proteins involved in iron metabolism.19 This regulation is mostly exerted post-transcriptionally by specific mRNA– protein interactions between iron-regulatory proteins and a highly conserved 28 nucleotide (nt) sequence termed the ‘ironresponsive element’ or IRE20–22 contained in the 5Auntranslated region (UTR) of ferritin H- and L-subunit mRNAs.3,17,23 IREs are also found in some mitochondrial enzymes [5-aminolevulinate synthase,24 mitochondrial aconitase,25 and succinate dehydrogenase (Drosophila)26] as well as in transferrin27 and amyloid precursor protein.28 Several IRE repeats are present in the 3AUTR of transferrin receptor mRNA.29 Two specific proteins, IRP1 and IRP2, which bind to IRE sequences have been isolated from rodent and human tissues or cells.30–32 Binding of these proteins to IREs in the 5AUTR repress translation whereas binding to IREs in the 3AUTR enhance message stability (by blocking the recognition site for the transcript’s degradation apparatus) and enhance translation.7 The finding of IREs in mitochondrial enzymes indicates that there is a regulatory link between energy and iron metabolism and suggests biological functions for the IRE regulatory system in addition to iron homeostasis.The IRPs also bind to IRErelated structures in distinct sets of RNA target sequences, possibly extending their function beyond regulation of iron homeostasis.32 With the discovery of nitric oxide (NO), its role in host defense and its interactions with a number of different ironcontaining proteins, studies currently are beginning to unravel the connection between iron metabolism and NO.9 Cells producing excess NO presently include endothelial cells, hematopoietic cells, hepatocytes, smooth muscle cells, chondrocytes and macrophages.Under inflammatory conditions, bacterial endotoxin and the inflammatory cytokines IL-1b, IL- 6, TNF-a and INF-g induce the transcription of nitric oxide synthase isoform-2 (NOS-2). (Inflammation is the induction of processes by tissue injury that promote healing.) NOS-2 catalyzes the formation of NO and citrulline from arginine.There is evidence that NO enhances the binding of IRP1 to IREs in ferritin and transferrin receptor mRNAs independently of the iron level. Another specific motif in the 5AUTR of ferritin mRNAs common also to certain other proteins, but distinct from the IRE, responds to IL-1b by derepression of H-ferritin translation.33 One model predicts that in inflammation NO will induce a net increase in surface transferrin receptor expression and an increase in ferritin expression.9 Some inflammatory cytokines also induce ferritin H transcription through the activation of transcription factors AP1 and NF-kB.9 Other signals that induce changes in ferritin gene expression in mammalian cells include hormones (thyroid hormone,34 thyrotropin,35 insulin,36 progesterone,37) phagocytosis and/or inducing agents,38 tissue injury,39 heat shock,40 ischemiareperfusion, 41,42 hypoxia,43 differentiation44 and virus infection. 45 Distribution of iron and iron-binding proteins in the central nervous system Localizing iron, ferritin and other major iron-binding proteins in brain tissue at the regional and cellular level is fundamental for understanding how iron gains entry into the brain and iron homeostasis in this organ. High levels of stainable non-heme iron have been reported in the extra-pyramidal system within the globus pallidus, substantia nigra zona reticulata, red nucleus and myelinated fibres of the putamen. Moderate staining has been found in the forebrain, mid-brain and cerebellar structures within the striatum, thalamus, cortex and deep white matter, substantia nigra zona compacta and cerebellar cortex.46 The brain-stem and spinal cord show low intensity staining.The levels of transferrin, transferrin receptor and non-heme iron in brain cells are not well correlated.47 In the brain, transferrin is found primarily in oligodendrocytes.These cells are important for myelin synthesis; they also are the predominant iron-containing cells in brain. Message for transferrin has been detected in the choroid plexus as well as in oligodendrocytes. Transferrin receptor is present on the surface of every cell requiring iron; it is abundantly expressed on blood vessels, large neurons in the cortex, striatum and hippocampus, and it also is present on oligodendrocytes and astrocytes.48,49 Ferritin and iron are present in microglial cells (including 42 Analyst, January 1998, Vol. 123perivascular microglia50) in all brain regions, but especially in the hippocampus. Immunostaining for ferritin also has been observed around the third ventricle where ferritin and iron are found in tanacytes. Some neurons immunostain specifically for ferritin H protein. Oligodendrocytes immunostain only for ferritin H early in development.48,49,51 Aberrations of iron metabolism in ageing and in neurodegenerative diseases Characterizing the effects of ageing and of certain neurodegenerative diseases associated with accumulation of iron in the degenerating brain regions [e.g., Alzheimer’s disease (AD),3,4,28,52 Parkinson’s disease (PD),53 Huntington’s disease, 54 and Hallervorden–Spatz disease55] on brain iron distribution and on the expression of genes involved in iron homeostasis will contribute valuable information about factors regulating iron metabolism and help to clarify the aberrant processes that underlie, contribute to, or are associated with disease development.For example, the degree of iron deposition in the basal ganglia (especially the caudate and putamen) increases with age and especially in disorders involving the basal ganglia.4,56 With ageing, and in the basal ganglia disorders, microglia become more numerous and richer in iron and ferritin.4,57 In normal ageing, the levels of both ferritin H and ferritin L increase in parallel.In AD and PD, however, the H/L ratio of ferritin protein in vulnerable regions (frontal cortex in AD; caudate and putamen in PD) is increased.51 In addition to aberrations of iron metabolism in the AD brain, aberrations in the central nervous system (CNS) and plasma also have been described.28,58 It has been suggested that trapping of non-heme iron by astroglial mitochondria may account for the accumulation of redox-active iron in degenerating brain regions.59 Experiments in rats indicate that increases in ferritin compensate for age-related increases in iron, and suggest that increased ferritin is cytoprotective and prevents the accumulation of protein carbonyl groups.60 Ferritin and the acute phase response The body responds to tissue injury, infection and other types of traumatic stress by manifesting an acute phase response (APR) in an attempt to restore physiological homeostasis.The peripheral APR is mediated by inflammatory cytokines and nitric oxide.61 These up-regulate the synthesis of certain proteins (including ferritin) in the liver and down-regulate the synthesis of others (including transferrin).With respect to iron metabolism, the APR results in blockage of tissue iron release, decreased serum iron, transferrin, total-iron-binding capacity and increased serum ferritin.9 Analytical procedures currently are being developed to attempt to distinguish an APR from responses characteristic of iron overload.62,63 There is increasing evidence that an acute phase response also can be mounted in the CNS (possibly by the choroid plexus and macrophages) in response to cytokine release at sites of tissue injury in the brain.64 A chronic APR may eventually result in the anemia inflammation and in which is seen in certain chronic diseases. 61 Previous genetic studies of ferritin heavy chain in human fetal and adult brain The H and L subunits of ferritin are genetically and functionally distinct, and a study of them separately is essential for determining how iron is managed at the cellular and molecular level.Because of the central role that ferritin plays in iron homeostasis, and the observations which suggest that changes in ferritin H expression are particularly important in human development and in AD, we have been studying ferritin H gene expression in brain.1–3,65–67 Northern blot analysis of polyA+ RNAs from human brain and liver with a human liver ferritin H chain probe previously revealed two different sizes of transcripts.A 1.4 kb RNA band was expressed predominantly in the brain whereas a 1.1 kb form was more abundant in liver.65 Subsequent screening of fetal and adult brain cDNA (DNA that is complementary to RNA) libraries yielded two types of human brain ferritin H cDNAs. They were sequenced using conventional techniques. One type of cDNA corresponded to the previously characterized 1.1 kb RNA from liver and lymphocytes.The second type contained the 3AUTR sequence of liver ferritin H mRNA and an extra 279 nt segment at the 3AUTR. This novel 279 nt 3AUTR corresponded to ‘intron IV’ of human liver ferritin H genomic sequence which was thought not to be transcribed into RNA, except that it had an apparent insert of 15 nt which corresponded to an ambiguous region of five nucleotides in the published genomic sequence (see Fig. 1). Utilization of alternative polyadenylation sites in the precursor mRNA was proposed to generate the ferritin H mRNA species which differed at their 3AUTR ends.1,2 The 5AUTR sequences of the larger mRNAs were incomplete, however.Fetal brain cDNA clones contained the elongated 3AUTR, the coding sequence of liver ferritin H mRNA, but only 130 of the 215 bp of the liver ferritin 5AUTR. The IRE and the remainder of the 5AUTR were absent. Adult brain cDNA clones contained the elongated 3AUTR, but the entire 5AUTR and the first 24 nucleotides (corresponding to 8 amino acids) of the coding sequence were absent.However, reverse transcriptase polymerase chain reaction (RT-PCR) analysis suggested that normal fetal and adult brain carried some ferritin H transcript with an elongated 3AUTR and a 5AIRE like that of liver ferritin H.3 Objectives A long-term goal in our research has been to characterize aberrant processes which, if corrected, would lead to the rational development of treatments to slow down or prevent AD.Because aberrations of iron and ferritin metabolism have been described in AD, and because an unusual form of message with an elongated 3AUTR and truncated at the 5Aend was cloned from human brain cDNA libraries, it was considered important to determine if full-length ferritin H RNA with a normal 5AUTR existed in series of normal human adult and AD brains, and to determine if these had the same sequence. To gain new insight into the function of the novel 279 nt segment in the ferritin H 3AUTR, we also measured relative levels expression of the 279 nt 3AUTR sequence in different adult and fetal tissues and in different regions of the adult brain, and examined autopsy tissue from normal human hippocampus to determine which cell types expressed high levels of ferritin H with the novel 279 nt sequence at the 3AUTR.Additionally, we applied RNA folding paradigms to study the conformation of ferritin H chain RNAs. Possible implications of our findings are discussed.Experimental procedures Studies Four studies were carried out: (a) Total RNA was extracted from hippocampal brain tissue of six normal human adults and six persons with autopsyverified AD. After reverse transcription using a primer specific for the novel 279 nt sequence in the 3AUTR of ferritin H RNA, ferritin H cDNAs were produced by PCR amplification using appropriate oligonucleotide primers, purified by elution from agarose gel after electrophoresis, and sequenced.(b) A human RNA Master blot was hybridized sequentially with probes for the ferritin H coding region, for the novel 279 nt sequence at the 3AUTR of ‘brain’ ferritin H RNA, and ubiquitin as a control. Analyst, January 1998, Vol. 123 43(c) RT-PCR was carried out in situ on tissue sections from formalin-fixed paraffin-embedded normal adult human hippocampus to amplify and detect only ferritin H RNA possessing an elongated 3AUTR with the novel 279 nt sequence.(d) Ferritin H RNA secondary structure predictions were determined using the Zuker Biofold program on BIONET and the University of Wisconsin’s GCG software. Brain tissue Samples of adult human hippocampus from normal persons and from persons with late-onset, sporadic AD (i.e., AD manifesting after the age of 65 years with no previous family history of disease) for RNA extraction were obtained from Duke University Medical Center, Durham, NC, USA. Subject age varied from 59 to 93 years; autopsy was performed within 30–250 min. Sections of formalin-fixed, paraffin-embedded normal adult hippocampal tissue for the RNA localization study (cause of death, myocardial infarction; post-mortem interval, 3 h) were provided by the Canadian Brain Bank, University of Toronto.Reagents Oligonucleotides P1 to P6 were obtained from Oligos, Guilford, CT, USA. Oligonucleotides P7 and P8 were obtained from Dalton Chemical, North York, Canada.Their designation, location, sequence and polarities are given in Fig. 1. FN1 is a 0.718 kb ‘liver-like’ ferritin H brain cDNA probe isolated from an adult brain cDNA library. It contains the coding sequence common to all ferritin H cDNAs but lacks the 279 nt 3AUTR sequence. It is cloned into the EcoRI site of the vector pBSK(+). FN30 is a 0.296 kb adult brain cDNA probe containing the 279 nt sequence. It is cloned into the EcoRI/KpnI site of the vector pBSK(+). Purification of inserts from these probes has been described previously.67 Because FN30 has a poly A+ tail at the 5Aend and a short sequence at the 3Aend which is complementary to the extreme 3AUTR of liver ferritin H, a Fig. 1 Nucleotide sequence of one species of ferritin H cDNA from adult brain obtained by RT-PCR. The IRE and the extra 279 nt segment in the 3AUTR are shown in the boxes. The nucleotide positions of primers P1–P8 are underlined. The arrows indicate the polarity. The 15 nt region that is underscored by asterisks corresponds to a region of five unidentified nucleotides in the published ferritin H genomic sequence.81 The same sequence was obtained for six normal adult and six AD ferritin H cDNAs. 44 Analyst, January 1998, Vol. 123A B PCR probe ‘FN30pcr’ lacking these two ‘problem’ regions was constructed by PCR amplification using FN30 as template and appropriate primers P1 and P7, Fig. 2). FN30pcr was resolved by agarose gel electrophoresis and extracted after melting the agarose with Gene Clean II (BIO 101, La Jolla CA, USA).The ubiquitin cDNA probe was provided with the Master RNA Blot. GIBCO BRL T4 polynucleotide kinase and random priming labelling kits were from Life Technologies (Gaithersburg, MD, USA). Isotope was from ICN Pharmaceuticals, (Irvine, CA, USA) or Amersham, (Arlington Heights, IL, USA). PCR reagents from Perkin Elmer (Norwalk, CT, USA) and Cyclist or Cyclist exo2 pfu sequencing kits from Stratagene (La Jolla, CA, USA) were used for sequencing of PCR fragments.Electrophoresis reagents were from United States Biochemicals, Cleveland, OH, USA. Isolation of total RNA Total RNA from brain samples was isolated by the guanidine– HCl method according to Sambrook et al.,68 All samples were reverse-transcribed, PCR-amplified and sequenced as indicated below. Reverse transcription polymerase chain reaction A 30-mer oligonucleotide, (5AGAGAATTCCAGCCTTTAATGCCTTTTATTC3A), which is identical to P1 and complementary to the 3Aend of 279 bp sequence but which contains an internal EcoRI site (underlined), was used to prime the reverse transcription (i.e., the first strand synthesis).The reaction mixture contained 10 mg of heat-denatured total RNA from normal adult or AD brains, 2 mm of each dNTP, 5 mm MgCl2, 50 mm KCl, 50 pmol P1, 10 mm TRIS-HCl (pH 8.3), 50 U RNasin and 100 U M-MulV reverse transcriptase in a final volume of 50 ml. After incubation at 37 °C for 1 h, the reaction was terminated by heating at 95 °C for 5 min.Two PCR reactions were then carried out on each sample using an aliquot of 2–5 ml of first strand mix, and 20 pmol each of P1 as the upstream primer and either P4 or P5 (Fig. 1) as the downstream primer, 1.5 mm MgCl2, 200 mm of each dNTP, 50 mm KCl, 10 mm TRIS–HCl (pH 8.3) and 2 U of Taq DNA polymerase in a final volume of 100 ml. PCR was performed in a Perkin Elmer Cetus thermal cycler at 95 °C for 1 min, 50 °C for 1 min, 72 °C for 2 min for 35 cycles followed by 10 min extension at 72 °C.DNA sequencing PCR products from the two amplification reactions described above were resolved by electrophoresis on a 1.2% agarose gel, electroeluted, and directly sequenced using Cyclist or Cyclist exo2 pfu DNA sequencing kits (Stratagene). Appropriate oligomers corresponding to the known fetal brain ferritin H cDNA1 were used for sequencing. Human RNA master blots and hybridization protocols The Human RNA Master Blot (Clonetech, Palo Alto, CA, USA) is a positively charged nylon membrane to which poly A+ RNAs from 50 human tissues have been immobilized in separate dots along with several controls.Master Blot hybridization provides a convenient method for obtaining information about the expression of a cloned gene of interest across a wide range of human tissues, for determining tissue or developmental-stage specificity of gene expression, and information about relative levels of mRNA abundance.The loading of poly A+ RNA on each dot of the RNA master blots (which varies from 100–500 ng) is normalized to eight different housekeeping genes so that the maximum dot-to-dot variation in the normalized signal from all eight housekeeping gene probes is less than 50% from the average level. DNA probes were labelled by random priming with [32P]dCTP. Oligonucleotides were 5Aend-labelled with Fig. 2 Human RNA Master Blot Data. A, Diagram of the type and position of denatured poly A+ RNAs and controls dotted on the positively charged nylon membrane.Actual membrane size is 80 3 120 mm. B, Composite autoradiogram obtained by hybridizing one Master Blot with three different radiolabelled probes: FN1, a cDNA probe containing a portion of the open reading frame (ORF) common to all ferritin H cDNAs (bottom set of dots); FN30pcr, a doublestranded PCR probe corresponding to the novel 279 nt 3AUTR sequence of brain ferritin H chain cDNA (top set of dots); and, Ub, a ubiquitin cDNA probe (intermediate level of dots offset to the right).After each hybridization, an autoradiographic image of the blot was obtained. Autoradiograms from the three hybridizations were superimposed to yield the composite image. Exposure times were 2 d, 30 d and 2 h, respectively, for FN1, FN30 and Ub. Thus when the FN1 and FN30pcr dots are of equal intensity, there is approximately 15-fold more ferritin ORF sequence than the 279 nt segment.Analyst, January 1998, Vol. 123 45[32P]ATP and T4 polynucleotide kinase. Procedures used in the Human RNA Master Blot User Manual were followed for radiolabelling of probes, hybridization, and for washing the blots. Probe binding was visualized by autoradiography using X-OMAT AR X-ray film (Eastman Kodak, Rochester, NY, USA) and image intensifiers. Exposure times varied from 2 h to 1 month. Individual DNA probes were stripped from the Master Blot by boiling the membrane for 5–10 min in 250 ml of 0.5% SDS followed by cooling for 10 min, a procedure that was repeated four times altogether.After stripping, damp blots were stored between MM no. 3 filter paper moistened in 2X SSC in plastic wrap at 270 °C until needed. Relative intensities of signals obtained with different probes were scored by inspection of composite autoradiographs. Tissue In Situ reverse transcriptase polymerase chain reaction (RT-PCR) analysis The exquisitely sensitive and specific new technique of in situ RT-PCR analysis enables specific RNA (or DNA) sequences to be amplified and readily detected in single cells on sections of formalin-fixed, paraffin-embedded autopsy tissue.This procedure was applied to sections of normal adult human hippocampus in order to visualize the relative levels of only ferritin H RNA which contains the novel 279 nt segment in the 3AUTR (as opposed to total ferritin H RNA levels or any RNA with the 279 nt segment) in different cell types.The protocol of Nuovo69 was followed with the exception that the PCR reaction was carried out with unlabelled nucleotides and PCR product was detected by conventional in situ hybridization with a [3H]-labelled ‘sense’ oligonucleotide corresponding to a sequence in the amplified DNA which does not overlap with sequences of the oligos used to prime the reaction. Briefly, after de-waxing, tissue sections were treated with proteinase K (to permeabilize the tissue) and then with RNase-free DNase (to remove genomic and mitochondrial DNA).Sections treated with proteinase K, RNase and DNase were used as the negative control. Reverse transcription of RNA into cDNA then was carried out in situ using random hexamers as primers. To amplify the sequence of interest in this cDNA, PCR was then carried out in situ using oligonucleotides P1 and P4 (Fig. 1) as described above. To detect specific PCR product, sections then were hybridized with oligonucleotide P7 (Fig. 1) which was ‘tailed’ at the 3Aend with [3H]dCTP and dATP using terminal deoxynucleotidyl transferase. Enzyme reactions, PCR amplifications, and hybridizations were done using a Coy TempCycler II Slide Cycler, Diamed Lab Supplies, Mississauga, Ontario, Canada. After washing, slides were dipped in autoradiographic emulsion and refrigerated in a light-tight container at 4 °C. After developing and fixing, and staining with hematoxylin–eosin, sites to which labelled oligonucleotide has bound are revealed as black grains of silver upon high magnification.70 Results (a) Sequencing of RT-PCR products Reverse transcription of all total RNA preparations was primed with oligonucleotide P1 corresponding to the extreme 3A end of the 279 nt sequence; all PCR amplifications were done using this first strand mix.The sequence of adult ferritin H cDNA obtained from analysis of PCR products using primers 1 and 4, or 1 and 5 was found to be identical in the six normal adult brains and six late-onset AD brains.The full-length cDNA sequence is given in Fig. 1. This has a 5AUTR that is identical to that of liver ferritin H cDNA and includes an IRE; the coding sequence is identical to that reported for liver and fetal brain ferritin H cDNA. This full-length cDNA also has an elongated 3AUTR containing the novel 279 nt segment which is identical to that described previously. To further confirm the 5AUTR of 279 nt containing transcripts, the first strand mix obtained with P1 as primer was PCR-amplified using the previously reported transcription start point (tsp) as downstream primer (P6 in Fig. 1) along with P1 as the upstream primer, and the PCR fragment was sequenced at the 5AUTR. The results were as expected. The PCR fragment sizes and sequence analysis rule out the possibility of an amplification of a contaminating genomic DNA in the RNA preparations because the sequence lacks introns. In summary, these data show that at least one species of ferritin H cDNA in the present series of AD and normal adult brains differs from liver-like ferritin H cDNA only by the presence of an extra 279 nt segment in the 3AUTR.Second, they also show that the apparent 15 nt insert in the 3AUTR (denoted by asterisks in Fig. 1) likely is not an allelic variation since this was present in RNAs from all of the subjects. Finally, the finding that all of the normals and AD cases had the same ferritin H cDNA sequence indicates that serious splicing defects which prevent formation of full length ferritin H message, insertions, deletions, or point mutations in the coding sequence, are not associated with the present series of AD cases.These studies do not exclude the possibility that mutations in ferritin H are associated with or linked to AD generally, or to different sub-types of AD, particularly the earlyonset forms. (b) Master blot analysis Inspection of the dot blots (Fig. 2) shows that the pattern of expression of the 297 nt sequence relative to expression of the ferritin H coding sequence is tissue specific and highest in adult brain. Within the 14 adult brain regions examined, levels were highest in amygdala, caudate nucleus, putamen, substantia nigra and spinal cord, and lowest in cerebellum, indicating regionspecific expression within the brain. High expression also was apparent in adult kidney, lung, and peripheral leukocytes.Moderate expression was apparent in heart, aorta, colon, bladder, prostate, stomach, adrenal gland, thyroid gland, mammary gland, and trachea. Low relative levels were apparent in adult skeletal muscle, testis, ovary, pancreas, pituitary gland, salivary gland, liver, small intestine, spleen, thymus, and appendix, and in fetal brain, heart, lung and thymus. The data shown in Fig. 2 were confirmed by independent hybridization experiments of the same blot. Furthermore, hybridization with P8, a 50-mer oligonucleotide corresponding to positions 936–986 (in the 279 nt 3AUTR segment) yielded a pattern that was indistinguishable from that obtained using the FN30pcr probe, although signals were weaker (data not shown).The low relative level of the 279 nt sequence in fetal as compared to adult brain is indicative of developmental regulation in this organ, and the great importance of this sequence in adult brain. The dot blot analysis described in this paper complements previous northern blot data which showed that 1.4 kb ferritin H polyA+ RNA is much more abundant in brain than in liver in which the predominant species is 1.1 kb.65 (c) Tissue In Situ RT PCR analysis The photographs in Figs. 3A, B and C show that in normal adult hippocampus, the novel 279 nt 3AUTR sequence in ferritin H localizes strongly to non-neuronal (astroglial) cells, capillary endothelial cells, and to selected populations of neurons (the granule cells of the dentate gyrus).Signals in the negative control section (pre-treated with RNase before RT-PCR) were substantially less than in the test reactions (Fig. 3D). (d) RNA folding Predicted secondary structures for ferritin H RNAs showed a high degree of intra-chain base-pairing (Fig. 4). Interestingly, 46 Analyst, January 1998, Vol. 123residues 999 to 1120 (located in the novel 279 nt 3AUTR of FTH) formed three ‘stem-loops’ (denoted L1, L2 and L3) which were a constant feature of structures predicted by both the Zuker and GCG software programs over a wide energy range.A Blast search71 revealed homology between positions 1013 and 1095 of this stem-loop region, and a region in the 3AUTR of human endoperoxide synthase type II–cyclooxygenase-2 (COX-2) (Fig. 5). (Human endoperoxide synthase type II appears to be related to COX-2 by alternative splicing; these enzymes are rate-limiting in the synthesis of prostaglandins which are important mediators of inflammation.72,73 These observations suggest a functional importance for positions 1013–1095 of the novel 279 nt 3AUTR segment of ferritin H RNA which has been evolutionarily conserved.Although homology to a small region of the 279 nt sequence in the 3AUTR of ferritin H cDNA has been found in the 3AUTR of COX-2 mRNA, the 279 nt sequence, in toto, seems to be uniquely associated with the functional ferritin H gene and mRNA. Using PCR analysis, we previously showed that the cDNA sequence extending from within a consensus sequence in the coding region to the end of the elongated 3AUTR mapped to the same locus on human chromosome 11 as the functional gene for liver ferritin H.67 Application of the same approach has shown that no human chromosomes other than 11 carry the 279 nt 3AUTR sequence in entirety.74 These observations indicate that the entire 279 nt sequence is not likely to be present in any other human gene, including the many ferritin H pseudogenes that exist on any human chromosomes other than 11, and that it likely is not present in the gene for liver ferritin L or its pseudogenes.Screening of brain cDNA libraries with a probe for liver ferritin L also did not reveal any clones of novel size.3 Our finding of small sequences homologous to the 279 nt segment in regions of the genome distinct from the functional ferritin H gene raises the possibility that a portion of the signal obtained with the 279 nt probe originates from non-ferritin H RNA.There is no evidence from northern blotting that this is the case for adult tissue. In fetal brain, however, a probe containing the 279 nt segment hybridized not only to a 1.4 kb ferritin H band, but also to a 1.55 kb band which did not hybridize to the coding sequence of ferritin H. The origin of this signal is not clear. If it is COX-2 mRNA, the size of the cross-hybridizing mRNA species in fetal brain (1.55 kb) is distinct from published sizes of 2.8 and 4.6–4.8 kb for COX-2 mRNA.72,73 Discussion Our observations that the level of the normal 279 nt segment of ferritin H RNA (relative to the level of the ferritin H coding sequence) is highest in adult human brain, and that within this organ the levels of ferritin H message with the elongated 3AUTR are high in vascular endothelium and astroglial cells of the hippocampus, suggest that ferritin H may be particularly important in the vasculoendothelial-astroglial compartment.Attempts to interpret these findings must be considered speculative. First, as indicated in background, our understanding of mechanisms of iron transport and homeostasis in the brain are in their relative infancy. No consensus has yet been reached about how iron is moved through the blood–brain barrier.13,14 Furthermore, knowledge that we do have has Fig. 3 Localization of ferritin H chain RNA containing the 279 nt sequence in hippocampal tissue of a normal adult.The procedure of tissue in situ RT-PCR analysis was used to identify cells containing this RNA as indicated in the text. The number of grains associated with a cell is approximately proportional to the number of molecules which hybridize to the radioactively-labelled probe.70 Details of hybridization with radioactive probes are given in ref. 70. A, Large arrows denote large neurons; small arrows, astroglial cells. B, Large arrows denote capillary endothelial cells; small arrows, astroglial cells.C, Large arrows denote granule cells of the dentate gyrus; small arrows, astroglial cells. D, Negative control. Tissue section was treated with RNase before application of tissue in situ RT-PCR. Analyst, January 1998, Vol. 123 47largely been gleaned from animal experiments. Second, it is not known if the novel form of ferritin H RNA that we have been studying in human tissue exists in other animal species. Finally, it has not yet been shown that the translation of ferritin H protein is supported by message with the elongated 3AUTR.Previous work has shown that in order to prepare for a rapid increase in ferritin in response to a rise in cellular iron, a large number of dormant ferritin H mRNAs are accumulated in cytoplasm.75 Assuming that ferritin H protein is produced from message with the 279 nt segment in the 3AUTR, fundamental questions to be resolved are whether this is most important in protection against oxidative stress, cellular metabolic processes, movement of iron into, through or from cells, iron storage, inflammatory processes, basal expression, induction, and/or tissue specific expression, and what the specific function of the novel 279 nt 3AUTR segment might be.There is insufficient knowledge for one process to be highlighted over another. However, the high lipid content, high rate of oxidative metabolism and high iron content collectively make the brain the organ most vulnerable to oxidative stress.76 (In the presence of Fe2+, hydroxyl radicals are generated from H2O2; these initiate a free radical cascade.) Because levels of the 279 nt 3AUTR segment are expressed most highly in brain, a cytoprotective function for the elongated ferritin H message is implicated.Special cytoprotection might be particularly important in capillary endothelium because this constitutes the blood–brain barrier.77 Added cytoprotection would also be important in phagocytic (microglial) cells since these produce superoxide anions and ingest iron in tissue injury.38 Not clear, however, is why ferritin H produced by ‘liver-like’ ferritin H message which lacks the 279 nt segment in the 3AUTR would not suffice.The steady state level of a message is governed by factors regulating its translation, transcription and degradation. The cytoplasmic regulation of translation by 3AUTRs is of increasing interest because these not only can affect message stability but also translation and message localization.78 In vitro translation studies of bullfrog ferritin H message that long-range interaction occurs between the 5AUTR and the 3AUTR, since translation could not be repressed by reticulocyte extract (presumably by IRP) when the first 70 residues of the 3AUTR were missing.79 The identification of one species of ferritin H RNA which carries an intact 5AUTR including the IRE, and the IL-1b responsive element and an elongated 3AUTR,33 will enable effects of new long-range interactions between the 5A and 3AUTRs on in vitro translation to be studied in the presence/ absence of modulatory factors.The findings that the cytoplasmic iron responsive protein has two forms which are differentially regulated by NO and which may each regulate unique mRNA targets,32 and that IL-1b enhances ferritin translation by interaction with a 5A regulatory region that is independent of the IRE,33 open exciting new avenues for research. Studies of the regulation of translation also should include the contribution of the poly A+ tail.Although this Fig. 4 Predicted secondary structure of full-length ferritin H chain mRNA using the GCG program (energy level, 2318.1). Position numbers (in brackets) correspond to those in Fig. 2. The beginning of the ferritin H mRNA molecule (5ACAP), the IRE element (IRE), the codon (ATG) which would initiate translation in this sequence, the codon (UAA) which would terminate translation in this sequence, and the beginning of the 279 nt 3AUTR segment are noted on the diagram.The three stem-loops (L1, L2 and L3) are a constant feature of structures predicted by the Zuker and GCG programs over a wide range of energy levels. The sequence of stem-loops L1 and/or L2 are conserved in mRNAs of human COX-2. Fig. 5 Homology between the 279 nt region in the 3AUTR of human ferritin H RNA and the 3AUTR of human endoperoxide synthase type II– cyclooxygenase-2 (COX-2) mRNA.A, Nucleotide sequence of ferritin H cDNA. B, Nucleotide sequence of COX-2 mRNA. 48 Analyst, January 1998, Vol. 123previously was thought to retard 3A–5A degradation by exoribonucleases, current evidence indicates that it has an important regulatory role.78 In contrast to our knowledge of factors regulating message translation, the mechanisms and trans-activating factors by which transcription is regulated either in terms of basal expression, induction or tissue-specific expression, are poorly understood. ‘Liver-like’ ferritin H message and the elongated ‘brain’ form appear to be derived from the same gene by differential polyadenylation.3 Identifying factors or conditions that result in the differential transcription of the two forms of ferritin H message will be of great importance for the field of brain iron homeostasis.Although our work has shown that both normal adult and late onset, sporadic AD brains carry some full-length mature ferritin H RNA with an elongated 3AUTR and a 5AUTR with an IRE, Northern blotting, primer extension analysis and RNase protection assays must be done to characterize and compare ferritin H mRNA heterogeneity in normal and AD brain tissues.68 Not established is whether the brain ferritin H cDNAs which are truncated at the 5Aend that we have isolated from brain cDNA libraries1–3 are functionally significant or represent prematurely- terminated reverse transcription products.The reader is referred to other recent reviews for additional detail about the regulation of cellular iron metabolism in health, inflammation and chronic disease.4,7,9,80 In summary, our understanding of iron homeostasis in the human brain is in its infancy. Investigations into the function and significance of an elongated form of ferritin H message which carries a novel 279 nt segment in the 3AUTR, and which is expressed strongly in the vasculoendothelial-astroglial compartment in brain, are important directions of investigation.The authors thank Bryan Alzheimer’s Disease Research Center at Duke University Medical Center, Durham, NC 27710 for normal and AD brain samples, Dr. C. Bergeron and L. Weyer for sections of normal adult hippocampus, and S. Rainey for samples of FN1 and FN30 insert. Support for this research was provided, in part, by the Council for Tobacco Research, Physicians’ Medical Education Research Fund, Knoxville, TN, the Queen Elizabeth Hospital Research Institute, Toronto, ON, Canada, the Scottish Charitable Rite Foundation of Canada, Surrey Place Centre, Toronto, ON, the University of Toronto Life Sciences Summer Student Program, the SEED Program, and the Government of Ontario Work-Study Program.References 1 Dhar, M., Chauthaiwale, V., and Joshi, J. G., Gene, 1993, 126, 275. 2 Dhar, M., and Joshi, J. G., J. Neurochem., 1993, 61, 2140. 3 Joshi, J. G., Fleming, J. T., Dhar, M., and Chauthaiwale, V., J.Neurol. Sci., 1995, 134, (Suppl.), 52. 4 Gerlach, M., Ben-Shachar, D., Riederer, P., and Youdim, M. B., J. Neurochem., 1994, 63, 793. 5 Klausner, R. D., Renswoude, J. V., Ashweel, G., Kempt, C., Schechter, A. N., Dean, A., and Bridges, K. R., J. Biol. Chem., 1983, 258, 4715. 6 Theil, E. C., J. Biol. Chem., 1990, 265, 4771. 7 Crichton, R. R., and Ward, R. J., Analyst, 1995, 120, 693. 8 Morgan, E. H., J. Gastroenterol. Hepatol., 1996, 11, 1027. 9 Domachowske, J. B., Biochem. Mol. Med., 1997, 60, 1. 10 Thorstensen, K., and Romslo, I., J. Biol. Chem., 1988, 262, 8844. 11 Wolf, G., and Wessling-Resnick, M., Nutr. Rev., 1994, 52, 387. 12 Umbreit, J. N., Conrad, M. E., Berry, M. A., Moore, E. G., Latour, L. F., Tolliver, B. A., and Elkhalifa, M. Y., Br. J. Haematol., 1997, 96, 521. 13 Bradbury, M. W., J. Neurochem., 1997, 69, 443. 14 Descamps, L., Dehouck, M. P., Torpier, G., and Cecchelli, R., Am. J. Physiol., 1996, 270, H1149. 15 Van Gelder, W., Cleton-Soeteman, M. I., Huijskes-Heins, M. I., van Run, P. R., and van Eijk, H. G., Brain Res., 1997, 746, 105. 16 Kennard, M. L., Richardson, D. R., Gabathuler, R., Ponka, P., and Jefferies, W. A., EMBO J., 1995, 14, 4178. 17 Beard, J. L., Dawson, H., and Pinero, D. J., Nutr. Rev., 1996, 54, 295. 18 Connor, J. R., Boeshore, K. L., Benkovic, S. A., and Menzies, S. L., J. Neurosci. Res., 1994, 37, 461. 19 Theil, E. C., Enzyme, 1990, 44, 68. 20 Theil, E. C., in Hemoglobins in Development and Differentiation, ed.Stamatoyannopoulos, G., and Neinhuis, A., Liss, New York, 1981, pp. 423–431. 21 Joshi, J. G., Dhar, M., Clauberg, M., and Chauthaiwale, V., Environ. Health Perspect., 1994, 102, Suppl. 3, 207. 22 Rouault, T. A., Hentze, M. W., Haile, D. J., Harford, J. B., and Klausner, R. D., Proc. Natl. Acad. Sci. USA., 1989, 86, 5768. 23 Thorstensen, K., and Romslo, J., Biochem. J., 1990, 271, 1. 24 Melefors, O., Goossen, B., Johansson, H.E., Stripecke, R., Gray, N. K., and Hentze, M. W., J. Biol. Chem., 1993, 268, 5974. 25 Kim, H. Y., La Vaute, T., Iwai, K., Klausner, R. D., and Rouault, T. A., J. Biol. Chem., 1996, 271, 24 226. 26 Gray, N. K., Pantopoulous, K., Dandekar, T., Ackrell, B. A., and Hentze, M. W., Proc. Nat. Acad. Sci. USA, 1996, 93, 4925. 27 Cox, L. A., Kennedy, M. C., and Adrian, G. S., Biochem. Biophys. Res. Commun., 1995, 212, 925. 28 Feldman, H., Kennard, M., Yamada, T., Adams, S., and Jefferies, W., Alzheimer’s Disease: Biology, Diagnosis and Therapeutics, ed.Iqbal, K., Winblad, B., Nishimura, T., Takaeda, M, and Wisniewski, H. M., Wiley New York, 1997, pp. 189–196. 29 Mullner, E. W., Neupert, B., and Kuhn, L. C., Cell, 1989, 58, 373. 30 Guo, B., Yu, Y., and Leibold, E. A., J. Biol. Chem., 1994, 269, 24252. 31 Hu, J., and Connor, J. R., J. Neurochem., 1996, 67, 838. 32 Henderson, B. R., Menotti, E., and Kuhn, L. C., J. Biol. Chem., 1996, 271, 4900. 33 Westmacott, D., Hawkes, J.E., Hill, R. P., Clarke, L. E., and Bloxham, D. P., Lymphokine Res., 1986, 5, S87. 34 Iwasa ,Y., Aida, K., Yokomori, N., Inoue, M., and Onaya, T., Biochem. Biophys. Res. Commun., 1990, 167, 1279. 35 Iwasa, Y., Aida, K., Yokomori, N., Inoue, M., and Onaya, T., Biochem. Int., 1990, 21, 473. 36 Yokomori, N., Iwasa, Y., Aida, K., Inoue, M., Tawata, M., and Onaya, T., Endocrinology, 1991, 128, 1474. 37 Zhu, L. J., Bagchi, M. K., and Bagchi, I. C., Endocrinology, 1995, 136, 4106. 38 Olakanmi, O., McGowan, S. E., Hayek, M. B., and Britigan, B. E., J., Clin. Invest., 1993, 91, 889. 39 Koeppen, A. H., Dickson, A. C., and McEvoy, J. A., J. Neurol. Sci., 1995, 134, (Suppl.), 102. 40 Atkinson, B. G., Blaker, T. W., Tomlinson, J., and Dean, R. L., J. Biol. Chem., 1990, 65, 14 156. 41 Terada, L. S., Am. J. Physiol., 1996, 270, H945. 42 Ishimaru, H., Ishikawa, K., Ohe, Y., Takahashi, A., Tatemoto, K., and Maruyama, Y., Brain Res., 1996, 726, 23. 43 Qi, Y., Jamindar, T.M., and Dawson, G., J. Neurochem., 1995, 64, 2458. 44 Sanyal, B., Polak, P. E., and Szuchet, S., J. Neurosci. Res., 1996, 46, 187. 45 Mulvey, M. R., Kuhn, L. C., and Scraba, D. G., J. Biol. Chem., 1996, 271, 9851. 46 Morris, C. M., Candy, J. M., Oaklely, A. E., Bloxham, C. A., and Edwardson, J. A., Acta Anat. (Basel), 1992, 144, 235. 47 Griffiths, P. D., and Crossman, A. R., Neurosci. Lett., 1996, 211, 53. 48 Connor, J. R., and Menzies, S. L., J. Neurol. Sci., 1995, 134, (Suppl.), 33. 49 Connor, J. R., and Menzies, S. L., GLIA, 1996, 17, 83. 50 Mato, M., Oikawa, S., Sakamoto, A., Aokawara, E., Ogawa, T., Mitsuhashi, U., Masuzawa, T., Suzuki, H., Honda, M., Yazaki, Y., Watanabe, E., Luoma, J., Yla-Herttuala, S., Fraser, I., Gordon, S., and Kodama, T., Proc. Natl. Acad. Sci. USA, 1996, 93, 3269. 51 Connor, J. R., Snyder, B. S., Arosio, P., Loeffler, D. A. M., and LeWitt, P., J Neurochem., 1995, 65, 717. Analyst, January 1998, Vol. 123 4952 Bouras, C., Giannakopoulos, P., Good, P.F., Hsu, A., Hof, P. R., and Perl, D. P., Eur. Neurol., 1997, 38, 53. 53 Logroscino, G., Marder, K., Graziano, J., Freyer, G., Slavkovich, V., LoIacono, N., Cote, L., and Mayeux, R., Neurology, 1997, 49, 714. 54 Dexter, D. T., Jenner, P., Shapira, A. H., and Marsden, C. D., Ann. Neurol., 1992, 32, (Suppl.), S94. 55 Taylor, T. D., Litt, M., Kramer, P., Pandolfo, M., Angelini, L., Nardocci, N., Davis, S, Pineda, M., Hattori, H., Flett, P. J., Cilio, M. R., Bertini, E., and Hayflick, S. J., Nat. Genet., 1996, 14, 479. 56 Jellinger, K., Paulus, W., Grundke-Iqbal, I., Riederer, P., and Youdim, M. B., J. Neural. Transm. Park. Dis. Dement. Sect., 1990, 2, 327. 57 Grundke-Iqbal, I., Fleming, J., Tung, Y. C., Lassmann, H., Iqbal, K., and Joshi, J., Acta Neuropathol., 1990, 81, 105. 58 Fischer, P., Gotz, M. E., Danielczyk, W., Gsell, W., and Riederer, P., Life Sci., 1997, 60, 2273. 59 Wang, X., Manganaro, F., and Schipper, H. M., J. Neurochem., 1995, 64, 1868. 60 Focht, S. J., Snyder, B. S., Beard, J. L., Van Gelder, W., Williams, L. R., and Connor, J. R., Neuroscience, 1997, 79, 255. 61 Konijn, A. M., Baillieres Clin. Haematol., 1994, 7, 829. 62 ten Kate, J., Wolthuis, A., Westerhuis, B., and van Deursen, C., Eur. J. Clin. Chem. Clin. Biochem., 1997, 35, 53. 63 Herbert, V., Jayatilleke, E., Shaw, S., Rosman, A. S., Giardina, P., Grady, R. W., Bowman, B., and Gunter, E. W., Stem Cells, 1997, 15, 291. 64 Percy, M. E., in Aging and Dementia. Applied Perspectives, ed. Janicki, M. B., and Dalton, A. J., Taylor Francis, New York, 1998, in the press. 65 Dhar, M. S., and Joshi, J. G., Biofactors, 1994, 4, 147. 66 Joshi, J. G., and Clauberg, M., Biofactors, 1988, 1, 207. 67 Percy, M. E., Bauer, S. J., Rainey, S., McLachlan, D. R., Dhar, M. S., and Joshi, J. G., Genome, 1995, 38, 450. 68 Sambrook, J., Fritsch, E. F., and Maniatis, T., in Molecular Cloning. A Laboratory Manual, 1989, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 2nd edn. 69 Nuovo, G. M., Amplification, 1992, 8, 1. 70 Somerville, M. J., Percy, M. E., Bergeron, C., Yoong, L. K., Grima, E. A., and McLachlan, D. R., Brain Res. Mol. Brain Res., 1991, 9, 1. 71 Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J., J. Mol. Biol., 1990, 215, 403. 72 O’Neill, G. P., and Ford-Hutchinson, A. W., FEBS Lett., 1993, 330, 156. 73 Ristimaki, A., Narko, K., and Hla, T., Biochem. J., 1996, 318, 325. 74 Percy, M. E., and Bauer, S. J., unpublished. 75 Munro, H., Nutr. Rev., 1993, 51, 65. 76 Gutteridge, J. M., Ann. N.Y. Acad. Sci., 1994, 738, 201. 77 Vercellotti, G. M., Balla, G., Balla, J., Nath, K., Eaton, J. W., and Jacob, H. S., Artif. Cells Blood Substit. Immobil. Biotechnol., 1996, 22, 207. 78 Tanguay, R. L., and Gallie, D. R., Mol. Cell. Biol., 1996, 16, 146. 79 Dickey, L. F., Wang, Y. H., Shull, G. S., Wortmann, I. A., III, and Theil, E. C., J. Biol. Chem., 1988, 263, 3071. 80 Hentze, M. W., and Kuhn, L. C., Proc. Natl. Acad. Sci. USA, 1996, 93, 8175. 81 Chou, C. C., Gatti, R. A., Fuller, M. L., Concannon, P., Wong, A., Chada, S., Davis, R. C., and Salser, W. A., Mol. Cell. Biol., 1986, 6, 566. Paper 7/06355E Received September 1, 1997 Accepted October 31, 1997 50 Analyst, January 1998, Vol. 123

ISSN:0003-2654    

DOI:10.1039/a706355e

出版商:RSC    

年代:1998

数据来源: RSC

摘要:

Recovery of uranium from aqueous solutions by trioctylamine impregnated polyurethane foam† Yasemin Toker, Meral Eral* and � Umran Hiçs�onmez* Ege University, Institute of Nuclear Sciences, 35100-Bornova, ÿIzmir, Turkey Polyurethane foams can be used as effective sorbents for the separation and concentration of trace amounts of metal ions. In this work, the sorption and desorption behaviour of uranium(vi) was investigated in dilute uranyl sulfate solutions on an open-cell polyurethane foam impregnated with trioctylamine (TOA) used as an extractant. The parameters affecting uranium extraction such as uranium concentration, ratio of solution volume to foam weight (ml g21), pH, concentration, retention time and temperature were studied and optimum conditions were determined. Seven different stripping reactants, (NH4)2SO4, Na2CO3, NH4Cl, NaCl, NaNO3, NaCl–H2SO4, NH4NO3–HNO3, were tested for extracting uranium from the polyurethane foam impregnated with TOA into the aqueous phase again.High stripping efficiences were obtained with 1 m NaCl–0.5 m HCl, 1 m NaCl–0.05 m H2SO4 and 0.9 m NH4NO3–0.1 m HNO3 solutions. Keywords: Uranium (separation, absorption, sorption, extraction); trioctylamine (TOA); polyurethane foam; urethane polymers The use of polyurethane foams in the separation and extraction of various inorganic and organic species was first demonstrated by Bowen1 and the field has been reviewed by Braun.2 The foams act as weak anion-exchangers with low capacity since the chemical nature of these foams contain amido and aminogroups. 1 The extraction is specific with polyurethane foams having high distribution coefficients. The apparatus required is simple and inexpensive. The hydrodynamic properties of polyurethane foams are excellent due to its quasi-spherical membrane structure.3 Because of these advantages, polyurethane foams have important and fundamental applications in analytical chemistry. It has been reported by several authors that polyurethane foams can be used as effective and inert supports for various extractants and are used for the recovery of metal ions in analytical and water treatment processes.4,5 Polyurethane foams containing different functional groups can be prepared by immobilizing various organic extractants or chelating agents.6 High molecular weight tertiary amines [(CnH2n + 1)3N] that are selective to uranium and are readily available have been used in the solvent extraction of uranium.7 The stripping of uranium from amines can be achieved easily.In our work, polyurethane foams were impregnated with trioctylamine (TOA), a tertiary amine, and the parameters effecting the efficiency of uranium extraction were investigated. Experimental Materials and methods A stock uranium solution of 0.01 m was prepared by dissolving 0.5279 g of UO2(NO3)2.6H2O (Merck, Darmstadt, Germany) in 0.1 m nitric acid. A portion of this stock solution was evaporated.After the dissolution of the residue with sulfuric acid, the solution was evaporated again to dryness. The uranyl sulfate solution of 0.01 m was prepared from this stock solution. The commercial polyurethane foam was obtained from Pinar Co. (ÿIzmir, Turkey). TOA was supplied from Merck. All other chemicals used were reagent grade. Polyurethane foam plugs, 4.5 cm in diameter and 2.2 cm long (average weight = 0.5500 ± 0.0020 g), were cut from a foam sheet. Each foam plug was squeezed in 2 m HCl in a batch extractor for 1 h, washed with distilled water until free of HCl, and again squeezed, and air-dried overnight before using.The solution of TOA in cylohexane was equilibrated with an equal volume of aqueous 0.1 m H2SO4 for 10 min. The cleaned and dried foam plugs were impregnated in a sulfate formed TOA–cyclohexane solution and then cylohexane was evaporated off in the air. The extraction was carried out by a dynamic method in an automatic squeezing system.The uranium concentration in aqueous solution was determined by the 1-(2-pyridylazo)- resorcinol (PAR) method8 (l = 510 nm, e = 3.87 3 104 l cm21 mol21) by using a Shimadzu UV/VIS 260 Recording Spectrophotometer (Shimadzu, Kyoto, Japan.) The amount of uranium extracted by the TOA was determined from the difference between the initial and final concentrations of uranium in aqueous solutions. Results and discussion Measurements of the foam extraction capacity The 0.550 ± 0.002 g of foams impregnated with and without TOA were brought into contact with uranyl sulfate solution for 1, 8 and 24 h.The concentration of UO2 2+ in the solution was determined spectrophotometrically with sodium salicylate.9 After it was equilibrated, the sorbed amount of UO2 2+ (UO2 2+ mmol g21 foam) was calculated by measuring decreasing UO2 2+ concentration in the solution. Table 1 shows that the extraction capacity of uranium on TOA impregnated foams is higher than that on foam without TOA.Therefore, it is assumed that uranium desorbs if time is extended to 24 h and so extraction efficiency decreases. Parameters affecting uranium extraction Effect of uranyl concentration The effect of uranyl concentration was tested by using standard solutions of varying initial concentrations from 5.0 to 150.0 † Presented at The Sixth Nordic Symposium on Trace Elements in Human Health and Disease, Roskilde, Denmark, June 29–July 3, 1997.Table 1 Extraction capacity of polyurethane foam for uranium Foam (0.5 g) Time/h Capacity/ mmol g21 %U extracted Impregnated with 10% TOA (10 ml) 1 0.8762 97.0 Without impregnation 1 0.3907 43.2 Impregnated with 10% TOA (10 ml) 8 0.9011 99.8 Impregnated with 10% TOA (10 ml) 24 0.8050 89.0 Without impregnation 24 0.3050 33.8 Analyst, January 1998, Vol. 123 (51–53) 51mg l21 to investigate the extraction behaviour of uranium by TOA-impregnated foam. The extraction of uranium increases with increasing uranyl concentration, because the capacity of impregnated foam is high, as is shown in Fig. 1. Since the purpose of these experiments is to recover uranium from dilute aqueous solutions, uranium solutions of concentrations 25 mg l21 were used. Effect of the ratio of solution volume to foam weight Fig. 2 shows the effect on uranium extraction of the ratio of solution volume (V, ml) to the mass of dried foam (m, g). Foam samples of 0.1 g were used and volumes of solutions were varied from 50 to 1000 ml.As is shown in Fig. 2, the efficiency of extraction remains constant between 500–4000 (V:m), but decreases with increasing V:m after 4000. The V:m ratio of 500 was chosen in subsequent experiments. Therefore the recovery of uranium from large volumes of solution should be possible by using small amounts of impregnated foam. Effect of pH The pH of uranium solution was adjusted to a desired value by addition of H2SO4 or NH4OH solution.The effect of pH on the extraction of uranium by TOA-impregnated foam is shown in Fig. 3. The extraction efficiency was investigated by varying the initial pH of solutions from 1 to 7. It was observed that there is no significant change between pH 2–5. During the experiments, precipitation formation and turbidity were observed in solutions where the pH was !4, because the uranyl ions hydrolyze at this pH. In addition, the amines convert free salts up to pH 4.10 A pH of 2 was determined to be the optimum value.In comparison, � Olmez and Eral have reported that the extraction efficiency of uranium by tributylphosphate (TBP)-impregnated foam is low at acidic solutions but is high in neutral solutions.11 Effect of TOA concentration In this set of experiments, the amine concentration in cylohexane was varied from 5 to 20 vol%. The amines formed as sulfate salt were prepared by equilibrating the amine and 0.1 m H2SO4 in the volume ratio of 1 : 1.Foam samples of 0.1 g were impregnated with 2 ml of these solutions. The extraction efficiency of uranium was investigated by using different amounts of TOA. The results are shown in Fig. 4. The highest efficiency was obtained by using 10 vol% TOA, and efficiency again decreased at 15 vol% and 20 vol% TOA. In comparison, the extraction efficiency of uranium by using 30 vol% of regnated foam is 72%.11 However, the extraction efficiency is 82% in the experiments using 5 vol% TOA-impregnated foam.Effect of time The time dependence of uranium extraction was examined between 15–480 min. The experimental results are given in Fig. 5. Solvent extraction is an equilibrium process and shaking time is one of the important factors influencing the extraction of metals. The efficiency that is 83% for 15 min, reaches 90% for 120 min. But, 1 h is suitable for extraction from the economic point of view. At 1 h, high extraction efficiency has been reported using TBP-impregnated foam at room temperature.Fig. 1 Effect of uranium concentration on uranium extraction (A, mg and B, %). Conditions were: 0.55 g polyurethane foam, pH 2, V, = 50 ml, 10 ml of 10% (v/v) TOA, 1 h room temperature. Fig. 2 Effect of the ratio of solution volume to foam weight on the extraction of uranium (A, mg and B, %). Conditions were: 0.1 g polyurethane foam, pH = 2, [U] = 25 ppm, 2 ml of 10% (v/v) TOA, 1 h, room temperature. Fig. 3 Effect of pH on the extraction of uranium (A, mg and B, %) onto polyurethane foam impregnated with 10% TOA–cyclohexane.Conditions were: 0.1 g polyurethane foam, 50 ml of 25 ppm U, 1 h, room temperature. Fig. 4 Effect of TOA concentration on uranium extraction (A, mg and B, %). Conditions were: 0.1 g polyurethane foam, 50 ml of 25 ppm U, 1 h, room temperature. Fig. 5 Effect of shaking time on the rate of uranium extraction (A, mg uranium extracted, and B % uranium extracted). Conditions were: 0.1 g polyurethane foam, 50 ml of 25 ppm U, pH = 2, 2 ml of 10% (v/v) TOA, room temperature. 52 Analyst, January 1998, Vol. 123Effect of temperature The effect of temperature (0–45 °C) on the extraction efficiency of uranium is shown in Fig. 6. It shows that the extraction efficiency is 83% between 0–4 °C and is 88% at room temperature. Also, the efficiency decreased by 4% at higher temperatures. For this reason, room temperature (23 °C) was chosen as the appropriate extraction temperature.Optimum conditions The optimum extraction conditions were found to be: U concentration = 25 ppm; pH of solution = 2; V:m ratio (ml g21) = 500; TOA concentration = 10% (v/v) TOA– cyclohexane; time = 1 h, and temperature = 23 °C. At these optimum conditions, the recovery of uranium was found to be 90.0 ± 3.0%. Stripping uranium from foam Solutions of (NH4)2SO4, Na2CO3, NH4Cl–HCl, NaNO3, NaCl– H2SO4, NH4NO3–HNO3 were evaluated for the extraction of uranium from the polyurethane foam impregnated with TOA into the aqueous phase again.Stripping experiments were carried out by squeezing the foam samples in two stages for one hour. The stripping results are presented in Table 2. The nitrate ions in a mixture of ammonium nitrate and nitric acid are easily displaced by uranyl sulfate ions bonded to amine during the extraction stage. An efficiency of 90% was obtained by using both NaCl–H2SO4 and NH4NO3–HNO3 solutions and are therefore suitable for the stripping of uranium into the aqueous phase.Conclusions The results of the present work indicate that TOA-impregnated polyurethane foam can be used for the recovery of uranium from dilute aqueous solutions. The fact that extraction is high at pH = 2 indicates the need to use acidic solutions, such as waste acidic leach solutions. The polyurethane foam acts as a cheap and readily available support material for TOA. It has been found that the use of TOA is more economical than the use of TBP when unit price, percentage of solvent and extraction efficiency were evaluated together.The stripping of uranium is easy using 1 m NaCl, 1 m NaCl–0.05 m H2SO4 or 0.9 m NH4NO3–0.1 m HNO3. This method can also be used for concentrated uranium solutions because the TOA-impregnated foam has a high extraction capacity. On the other hand, the effects of some interfering impurities need to be studied in order to apply this method to real solutions. References 1 Bowen, H.J. M., J. Chem. Soc. A, 1970, 1082. 2 Braun, T., Fresenius’ Z. Anal. Chem., 1983, 314, 592. 3 Huang, T. C., Chen, D.-H., and Huang, S.-D., J. Chem. Eng. Jpn, 1993, 26, 361. 4 Shakir, K., Beheir, G., and Aziz, M., J. Radioanal. Nucl. Chem., 1992, `61, 371. 5 Gesser, H. D., and Ahmed, S., J. Radioanal. Nucl. Chem., 1990, 140, 396. 6 Mizuike, A., Enrichment Techniques for Inorganic Trace Analysis, Springer-Verlag, New York, 1983, pp. 90–91. 7 Ritchey, G. M., and Ashbrook, A. W., Solvent Extraction Principles and Applications to Process Metallurgy, Part II, Elsevier, Amsterdam, 1979. 8 Korkish, J., Modern Methods for the Separation of Rare Metal Ions, Pergamon Press, Oxford, 1974, p. 574. 9 Kabay, N., and Egava, H., Sep. Sci. Technol., 1993, 28, 1985. 10 Merritt, R. C., The Extractive Metallurgy of Uranium, 1971, Colorado School of Mines Research Institute, USAEC, Johnson, Boulder, Co, 1971, p. 195. 11 � Olmez, S., and Eral, M., J. Biol. Trace Element Res., 1994, 43–45, 731. Paper 7/04882C Received July 8, 1997 Accepted October 28, 1997 Fig. 6 Effect of temperature on uranium extraction (A, mg and B, %). Conditions were: 0.1 g polyurethane foam, 50 ml of 25 ppm U, pH = 2, 2 ml of 10% (v/v) TOA, 15 min. Table 2 Stripping yields by using different stripping reagents Stripping reagent pH of stripping reagent Amounts of U on foam/mg Total stripping (in two stages) U(%) 1.5 m (NH4)2SO4 3.4 1141.8 6.0 0.6 m Na2CO3 8.1 1102.0 47.3 1.5 m NH4Cl 3.5 1138.5 63.5 1 m NaCl–0.5 m HCl 2.0 1020.2 88.7 1 m NaNO3 7.1 1061.3 68.6 1 m NaCl–0.05 m H2SO4 1.5 1015.1 90.2 0.9 m NH4NO3–0.1 m HNO3 1.6 1105.9 90.1 Analyst, January 1998, Vol. 123

ISSN:0003-2654    

DOI:10.1039/a704882c

出版商:RSC    

年代:1998

数据来源: RSC