摘要:

Natural Product Reports Editorial Board Professor T. J. Simpson (Chairman) University of Bristol Dr C. Abell University of Cambridge Dr J. R. Hanson University of Sussex Dr R. B. Herbert University of Leeds Professor J. Mann University of Reading Dr D. A. Whiting University of Nottingham Natural Product Reports is a bimonthly journal of critical reviews. It aims to foster progress in the study of bioorganic chemistry by providing regular and comprehensive reviews of the relevant literature published during well-defined periods. Topics include the isolation structure biosynthesis and chemistry of the major groups of natural products-alkaloids terpenoids and steroids aliphatic aromatic and 0-heterocyclic compounds. Many reviews provide details of biological activity and wider aspects of bioorganic chemistry including developments in enzymology genetics and structural spectroscopic and chromatographic methods of general interest to all workers in the area.Articles in Natural Product Reports are commissioned by members of the Editorial Board or accepted by the Chairman for consideration at meetings of the Board. Natural Product Reports (ISSN 0265-0568) is published bimonthly by The Royal Society of Chemistry Thomas Graham House Science Park Milton Road Cambridge CB4 4WF England. 1993 Annual Subscription Price E.C. f242.00 Overseas f266.00 U.S.A. $532.00 Canada f279.00. Change of address and orders with payment in advance to The Royal Society of Chemistry The Distribution Centre Blackhorse Road Letchworth Herts.SG6 1 HN England. Air Freight and mailing in the U.S. by Publications Expediting Service Inc. 200 Meacham Avenue Elmont NY 11003. US Postmaster send address changes to Natural Product Reports Publications Expediting Service Inc. 200 Meacham Avenue Elmont NY 11003. Second-Class postage paid at Jamaica NY 11431-9998. Afl other despatches outside the U.K. are by Bulk Airmail within Europe and Accelerated Surface Post outside Europe. Printed in the U.K. 0 The Royal Society of Chemistry 1993 All Rights Reserved No part of this publication may be reproduced stored in a retrieval system or transmitted in any form or by any means electronic mechanical photographic recording or otherwise without the prior permission of the publishers. Printed in Great Britain by the University Press Cambridge Subscription rates for 1993 E.C. f242.00 Overseas f266.00 U.S.A. US $532.00 Subscription rates for back issues are (1988) (1989) (1 990) (1991) (1 992) U.K. €1 59.00 f169.00 f177.00 f198.00 f222.00 Overseas f 183.00 f194.00 f204.00 f228.00 f250.00 U.S.A. US $342.00 US $388.00 US $398.00 US $467.00 US$474.00 Members of the Royal Society of Chemistry should order the journal from The Membership Manager The Royal Society of Chemistry Thomas Graham House Science Park Milton Road Cambridge CB4 4WF England

ISSN:0265-0568    

DOI:10.1039/NP99310FX005

出版商:RSC    

年代:1993

数据来源: RSC

摘要:

ISSN 0265-0568 NPRRDF lO(2) 99-206 (1993) Natural Product Reports A journal of current developments in bio-organic chemistry Volume I0 Number 2 CONTENTS 99 Quinoline Quinazoline and Acridone Alkaloids J. P. Michael Reviewing the literature between July 1990 and June 1991 109 The Chemistry of Azadirachtin S. V. Ley A. A. Denholm and A. Wood 159 Diterpenoids J. R.Hanson Reviewing the literature published in 1991 175 Chemical and Biochemical Manipulations of Nucleic Acids M. J. McPherson and J. H. Parish 199 Tropane Alkaloids G. Fodor and R. Dharanipragada Reviewing the literature between January and December 1991 Cumulative Contents of Volume 10 Number 1 1 Lignans Neolignans and Related Compounds (January 1989 and December 1991) R.S. Ward 29 Muscarine Oxazole Imidazole Thiazole and Peptide Alkaloids and Other Miscellaneous Alkaloids (July 1990 and June Z992) J. R. Lewis 51 Indolizidine and Quinolizidine Alkaloids (July 1990 and June 1991) J. P. Michael 7 1 Microbial Pyran-Zones and Dihydropyran-Zones (up ro December 1992) J. M. Dickinson Articles that will appear in forthcoming issues include Stevioside and Related Sweet Diterpenoid Glycosides (up to May 1992) J. R. Hanson Amaryllidaceae and Sceletium Alkaloids (2991) J. R. Lewis The Biosynthesis of Shikimate Metabolites (1991) P. M. Dewick NMR of Proteins M. P. Williamson Natural Sesquiterpenoids (1991) B. M. Fraga Recent Progress in the Chemistry of Indole Alkaloids and Mould Metabolites (July 1991 to June 2992) J. E. Saxton Arsenic Compounds from Marine Organisms (up to October 2992) J. S. Edmonds K. A. Francesconi and R. V. Stick Advances in Chemical Ecology (January 1988 and June 1992) J. S. Harborne Steroid Reactions and Partial Synthesis (2991) J. R. Hanson Pyrrolizidine Alkaloids (July 1991 and June 1992) D. J. Robins Marine Natural Products (1991) D. J. Faulkner Macrocyclic Trichothecenes (up to December 1991) J. F. Grove P-Phenylethylamines and the Isoquinoline Alkaloids (July 1991 and June 1992) K. W. Bentley Diterpenoid Alkaloids (December 1989 to January 1992) M. S. Yunusov

ISSN:0265-0568    

DOI:10.1039/NP99310FP007

出版商:RSC    

年代:1993

数据来源: RSC

ISSN:0265-0568    

DOI:10.1039/NP99310BP009

出版商:RSC    

年代:1993

数据来源: RSC

摘要:

Quinoline Quinazoline and Acridone Alkaloids J. P. Michael Centre for Molecular Design Department of Chemistry University of the Witwatersrand Wits 2050 South Africa Reviewing the literature published between July 1990 and June 1991 (Continuing the coverage of literature in Natural Product Reports 1992 Vol. 9 p. 25) 1 Quinoline Alkaloids refuted after synthesis of the biaryl,16 has proved to be (E)-8-1.1 Occurrence and Detection hydroxyquinoline-4-carbaldehyde oxime (2) a rare example of 1.2 Non- terpenoid Quinolines and Quinolinones a naturally occurring 0xime.l Structure (2) was deduced on the 1.3 Prenylquinolinones and Hemiterpenoid Tricyclic basis of various elaborate NMR techniques and confirmed by Alkaloids synthesis from the corresponding aldehyde.The possibility that 1.4 Furoquinoline Alkaloids the oxime is an artefact while unlikely cannot be discounted 2 Quinazoline Alkaloids especially since the parent aldehyde was also a constituent of 3 Acridone Alkaloids the plant. The aldehyde has been shown to form complexes 3.1 Occurrence and Structural Studies with. a variety of transition meta1s.l’ 3.2 Synthesis The isolation of the unusual quinolin-4-one (6) from 4 References Esenbeckia leiocarpa described in last year’s review (cf. Reference 18a) has been confirmed by an independent group of workers5 whose results must have been in press when the earlier reportlg appeared. The alkaloid previously unnamed 1 Quinoline Alkaloids but now dubbed leiokinine B was accompanied by leiokinine 1.1 Occurrence and Detection A (7) a new quinoline alkaloid unusually substituted with New quinoline and quinolinone alkaloids that have been oxygen in the 3 position.Both compounds isolated by reversed- reported during the period under review are listed in Table 1 phase recycling HPLC were fully characterized by spec-together with known alkaloids isolated from new source^.^-'^ troscopic techniques amongst which difference lH nuclear Oveshauser effect (NOE) experiments were especially useful. The structures were confirmed by unexceptional syntheses. The 1.2 Non-terpenoid Quinolines and Quinolinones alkaloids have anti-feedant properties against the pink boll- A minor alkaloid from Broussonetia zeylanica formerly thought worm Pectinophora gossypiella and are also general growth to be 3,4’-dihydroxy-2,3‘-bipyridine(1),15 but subsequently inhibitors of animals plants and micro-organisms.Table 1 Isolation and detection of quinoline alkaloids Species Alkaloid (Structure) Ref. Broussonetia zeylanica *8-Hydroxyquinoline-4-carbaldehydeoxime (2) 1 Comptonella sessilifoliola Dictamnine (58,R1 = R2= R3 = H) 2 Dutadrupine (59) Evolitrine (58,R’ = R3 = H R2= OMe) Kokusaginine (58,R1 = R2= OMe R3 = H) (+)-Platydesmine (41) Pteleine (58,R’ = OMe R2 = R3 = H) Echinops niveus Echinopsidine (3) 3 Echinopsine (4) Echinops spp.” Echinorine (5) 4 Esenbeckia leiocarpa *Leiokinine A (7) 5 Haplophyllum myrtifolium y-Fagarine (58 R1 = R2 = H R3 = OMe) 6 Flindersine (52 R = H) Haplafine (8) Kokusaginine *Myrtifoline (60) (+)-Nkolbisine (58,R’ = OCH,CH(OH)C(OH)Me, R2= OMe R3= H) Skimmianine (58 R1 = H R2 = R3 = OMe) 4,5,7-Trimethoxyfuro[2,3-b]quinoline(61) Oxytropis glabra Dictamnine 7 Penicillium expansum Viridicatin (9) 8 Phellodendron chinense N-Methylflindersine (54,R = H) 9 Polyporus sanguineus *4-Hydroxymethylquinoline (10) 10 Polyporus versicolor *4-Hydroxymethylquinoline Ravenia spectabilis Paraensine (11) I1 Ruta chalepensis Graveolinine (12) 12 Tet radium trich otom um Dictamnine 13 Zanthoxylum budrunga Zanthobungeanine (54 R = OMe) 14 * New alkaloids.a Echinops melitenensis E. orientalis E. phaeocephalus E. viscosus subsp. bithynicus. 99 8-2 NATURAL PRODUCT REPORTS 1993 ?H q+N &yj+& I Y I Y Y \ N OH Me Me Me Me (11 (2) (3) Echinopsidine X = NH (5) Echinorine (6) Leiokinine B (7) Leiokinine A (4) Echinopsine X = 0 (8) Haplafine (9) Viridicatin (1 1) Paraensine (12) Graveolinine OMe &FH2)"cH3Y Me0 H RH (13) R= H (14) R=OH (16a) Ar = Ph (17a) 33% (I&) 17"/0 (19a) 80% (1 6b) Ar = 3,4-(OCH20)GH (17b) 25% (18b) 11% (19b) 75% Reagents i sealed tube 170 "C; ii 5% Pd-C 1,2-Cl,C,H4 180 "C.Scheme 1 Two species of the wood-rotting fungus PoZyporus grown in culture produced the new alkaloid 4-hydroxymethylquinoline (10),loknown as a synthetic product but previously detected in nature only as an uncharacteristic metabolite of Cinchona pubescens cultured with L-tryptophan.20 It appears to be the first fungal quinoline to lack oxidation in the aromatic nucleus.A conventional synthesis of 3-alkylquinoline-2,4-diones(1 3 n = 6 or 8) from high-temperature condensation of aniline with a-alkylmalonic esters was followed by 3-hydroxylation with either 30 YOhydrogen peroxide or rn-chloroperoxybenzoic acid to give the 'pyosubstances' (14 n = 6 or 8) alkaloids of Pseudomunus species in overall yields of 30-60 Conditions for replacing the hydroxy group by chloride bromide fluoride and azide were also described. The new 4-arylquinolin-2-ones (15 R = H and OH) from Chiococca alba (cf. Reference 18 b) were prepared conventionally from ethyl 4- NATURAL PRODUCT REPORTS 1993-5. P. MICHAEL iii-viii ___t 06% 41% Et02C HO2C (28) (20)Virantmycin (30) ii 93% J Reagents i KN(SiMe,), 18-crown-6 THF -78 "C to -40 "C;ii hv toluene r.t.; iii LiAlH, THF; iv MnO, acetone; v KCN MnO, MeOH; vi KH THF then MeI -15 "C; vii NaOH MeOH reflux; viii Et,N+ C1- CF,CO,H CH,Cl, -15 "C; ix CH,Cl, r.t.; x LiAlH(0-But),; xi NaH BuiN+I- THF then MeI HMPA -15 "C.Scheme 2 methoxybenzoylacetate and appropriate anilines by way of cyclization of the intermediate anilides with concentrated hydrochloric acid in yields of 72 % and 65 % respectively.22 Palladium(0)-induced coupling of 2-iodoaniline with terminal alkynes in the presence of carbon monoxide at 20 kg cm-z and 120 "C produced a variety of 2-alkyl- and 2-aryl-quinolin-4- ones several of them natural products in yields of 61-90%.23 Similar results have also been reported in the Russian literature., A related reaction of 2-iodoaniline with allylic alcohols has potential for the synthesis of 2-substituted quinoline alkaloids.z5 A more unusual route to 2-arylquinoline alkaloids involved thermal rearrangement of oxime ethers (16) to a mixture of 4- and 2-substituted tetrahydroquinolines (1 7) and (18) the former predominating.2s Dehydrogenation of (18) with palladium on charcoal at 180 "C gave the alkaloids 2- phenylquinoline (19a) and dubamine (19 b) (Scheme 1). Does the antiviral agent virantmycin have structure (20) or the diastereomeric structure (21)? The matter ostensibly settled in favour of the former by NOE studies of the compound and its 3-hydroxy analoguez7 as reported last year (cf.Reference 18b) was re-opened by Shirahama and co-workers after the discovery of ambiguities in NOE and NOESY spectra that are apparently due to conformational Aexi bility of the piperidine rings.z8 By devising stereospecific syntheses of the model compounds (22) and (23) further conversion into the con- formationally rigid cyclic carbarnates (24) and (25) and detailed NOE studies that conclusively established the relative stereo- chemistry of both diastereomers these workers established the groundwork for solving the virantmycin problem. Their subsequently published29 syntheses of (-t)-(20) and (+)-(21) are shown in Scheme 2. The key to stereocontrol lay in the olefination of azido-aldehyde (26) Horner-Emmons reaction with phosphonate (27) gave 2-alkene (28) with a stereo-selectivity of better than 50 1 while Wittig reaction with phosphorane (29) yielded as good an isomeric ratio of the E-alkene (30).Photolysis of the azido-alkenes proceeded stereo- specifically to give aziridines (31) and (32) converted as shown into the target compounds and also into cyclic carbamate analogues of (24) and (25) for further stereochemical con- firmation. Direct spectroscopic and chromatographic com-parisons showed that virantmycin is indeed the isomer (20). The absolute configuration of (+)-virantmycin is thus 2R,3R. Virantmycin (20) has also been synthesized by Hill and Raphae130 (Scheme 3). At the heart of their approach was the efficient palladium(II)/copper(I)-catalysed coupling (94 %) of methyl 4-amino-3-iodobenzoate (33) and the acetylenic alcohol (34) itself prepared in three steps and 40% yield from methyl 4-methoxy-3-oxobutanoate.Meyer-Schuster rearrangement of coupled product (35) was followed by cyclization to the bicyclic aminoketone (36) in turn manipulated to give the unstable alkene (37).The 3-hydroxy substituent was introduced by an epoxidation-hydrogenolysis procedure the product (38) being formed as a single diastereomer whose stereochemistry has previously been assigned with the aid of nuclear Overhauser effects (cf. Reference 18c). Replacement of OH by C1 with retention of configuration followed by ester hydrolysis com- pleted the synthesis of (+)-virantmycin (20). The effect of crude drugs prepared from Evodia fruit on NATURAL PRODUCT REPORTS 1993 (37) v vi 77% vii-ix x xi * Virantmycin 23% 33% Me02C (20) (38) Reagents i PdC12(PPh,), CuI NEt, r.t.; ii MeS0,H-H20(1 :l) THF 40 "C; iii NaBH, MeOH r.t.; iv Ph,P CCl, 54 "C; v HCO,H Ac,O r.t.; vi m-CPBA NaHCO, CH,Cl, r.t.; vii Raney Ni W-4 dioxan then H2(1 atm) 10% Pd-C; viii Bu"Li WCl, THF -78 "C to r.t,; add intermediate epoxide -78 "C to r.t.; ix NaOH MeOH r.t.; x SOCl, CH,Cl, 40 "C; xi LiOH.H,O H,O-MeCN 70 "C.Scheme 3 0 Me (39) Evocarpine raising body temperature is largely due to the quinazolino[2,3- blcarbazole alkaloid evodiamine ;evocarpine (39) administered on its own was ineffecti~e.~~ Washing of Evodia fruit in hot water to debitter and detoxify it had the effect of increasing the evocarpine content by 1.3-f0ld.~ 1.3 Prenylquinolinones and Hemiterpenoid Tricyclic Alkaloids Anthranilic acid-specific enzymes involved in the biosynthesis of dihydrofuro-and dihydropyrano-quinolinium alkaloids have been detected for the first time in tissue cultures of Choisya ternata and Ruta gra~eolens.~~ Over-pressured layer chromatography (OPLC) has been used for the separation of dihydrofuro[2,3-b]quinolinium alkaloids present in Ptelea trif~liata.~~-~~ The technique was used to demonstrate that the recently discovered alkaloid ptelecultinium (40) (cf.Reference 36a) occurred in cotyledons roots hypocotyls and leaves of young plantlets as well as in callus cultures but not in aerial parts of mature The dioxolan-substituted aniline (42) was the starting material for the synthesis of a clutch of Ptelen alkaloids several ofwhich have not been made before (Scheme 4).37 Condensation of (42) with diethyl prenylmalonate at high temperature OMe Me0 Me (40) Ptelecultinium OMe &-L OH (4 1) (+)-Platydesmine afforded the pivotal hydroxyquinolinone (43) methylation of which under controlled conditions gave either a mixture of pteleprenine (44) and the 0-methyl ether (45) or the unnamed natural product (46) previously unsynthesized.Cyclization of the epoxide derived from the latter provided both the dihydropyrano[2,3-b]quinoline pteleflorine (47) and the dihydrofuro[2,3-b]quinoline(48) as yet unknown as a natural product. These two products in turn served as precursors of the alkaloids neohydroxylunine (49) 0-methylhydroxyluninium salt (50) and hydroxylunine (51).Flindersine (52 R = H) has been prepared from b-ketoester (53) in 13.5 YOoverall yield by the route shown in Scheme 5.,* An even simpler synthesis of N-methylflindersine (54 R = H) is NATURAL PRODUCT REPORTS 1993-5. P. MICHAEL z 0 ' N OMe LO (43) iii1%. (44) Pteleprenine (45) 0 LO LO Me (46) (47) Pteleflorine (49) Neohydroxyl unine OMe J"" OMe 0 0 LO LO Me I' LO Me (48) (50) 0-Methylhydroxyluninium salt (51) Hydroxylunine Reagents i diethyl 3-prenylmalonate Ph,O reflux; ii CH,N,-Et,O (4 eq.) MeOH r.t. 6 h; iii CH,N,-Et,O (10 eq.) MeOH r.t. 1 min; iv rn-CPBA CHCl, r.t.; v MeI reflux; vi pyridine 85-90 "C.Scheme 4 i,ii 75% (53) SMe SMe H iv-vi / 69% 72% 0 SMe RH H (52) Flindersine R =H Reagents i NaH DMF PhNCS r.t.; ii MeI; iii 1,2-C1,C,H4 reflux; iv POCl, heat; v AcOH Br,; vi LiBr Li,CO, DMF reflux; vii 6N HCl MeOH reflux; viii NaBH, MeOH; ix POCl, pyridine heat. Scheme 5 shown in Scheme 6.39The key step in the latter was base- Several recent syntheses of pyrano[3,2-c]quinolin-5-ones are induced cyclization of (55) to a mixture of quinolinones (56) of peripheral intere~t.~'-~~ The lH and 13C NMR spectra of 8-and (57) from which the target alkaloid was prepared directly methoxyflindersine (52 R =OMe) have been assigned com- on heating with 2,3-dichloro-5,6-dicyano-1,4-benzoquinone in pletely with the aid of two-dimensional heteronuclear cor-benzene.relation (HETCOR) and long-range HETCOR experiment^.^^ NATURAL PRODUCT REPORTS 1993 (54) N-Methylflindersine R = H Reagents i 5-methylhex-2-enoyl chloride pyridine C,H,; ii NaH MeI C,H,-DMF 0-5 "C ; iii NaH N-methylpyrrolidin-2-one, 0-60"C;iv DDQ C,H, reflux. Scheme 6 /OH OMe (60) Myrtifoline (611 0 0 (62) Acrophylline same is true of a strategy in which hydroxycyclobutanes formed by [2 + 21 photocycloaddition of 4-hydroxyquinolin-2-ones and alkenes are cleaved in a radical-mediated reaction to give mixtures of furo[2,3-b]quinolin-4-onesand furo[3,2-~]quinolin- 2-0nes.~~ Several 2-isopropylfuro[2,3-b]quinolinesrelated to fb w (58) (59) 1.4 Furoquinoline Alkaloids The structure of the new alkaloid myrtifoline (60) isolated from Huplophyllum myrtifolium along with several known quinolin-2-one and furo[2,3-b]quinoline alkaloids was deduced mainly with the aid of proton NMR spectroscopy.s No clear evidence was presented for the geometry of the hydroxyprenyloxy substituent at C-7 which was drawn in the 2 configuration.Hydrolysis of .myrtifoline acetate under acidic conditions produced haplopine (58 R' = H R2 = OH R3 = OMe) thereby providing confirmation of the core structure. Two-dimensional NMR studies allowed the assignment of all proton and carbon signals for a number of furo[2,3-blquinoline alkaloids obtained from Comptonella sessilifoliola and several assignments incorrectly reported in the literature were rectified.2 The 'H and 13CNMR spectra of skimmianine (58 R' = H R2= R3 = OMe) have been fully assigned.43 The synthesis of acrophylline (62) from m-anisidine and ethyl 2-ethoxy-4,5-dihydro-4-oxofuran-3-carboxylatehas been reported in the Chinese literat~re.~~ A similar approach was used to make (63) the putative structure of i~otaifine.~~ However since the physical properties of the synthetic material did not agree with those reported for the natural the structure originally proposed for the alkaloid should now be regarded as dubious.A one-pot synthetic approach to model 2-alkylfuro[3,2- c]quinolin-4-ones based on the reaction of 4-hydroxyquinolin- 2-ones with propargyl halides in the presence of base has some potential for the synthesis of furoquinoline alkaloid^.^' The known alkaloids were prepared in 70-80% yields by treating the corresponding 3-prenylquinolin-2-ones with mercuric oxide and iodine in glacial acetic acid or by similar treatment of 3-(3-methylbut-1-enyl)quinolin-2-ones followed by heating with polyphosphoric acid.49 A range of synthetic 1-alkylfuro[2,3-blquinolin-Cones and furo[2,3-b]quinoline-3,4-diones has been prepared and evaluated for anti-inflammatory and anti-allergic proper tie^.^^ 2-Substituted analogues of dictamnine (58 R' = R2 = R3 = H) have been prepared in 1149% yields by NATURAL PRODUCT REPORTS 1993-5.P. MICHAEL (65) cis-Febrifugine R' = H R2 = OH (66) trans-Febrifugine R' = OH R2 = H 0 0 Table 2 Isolation and detection of acridone alkaloids Species Alkaloid (Structure) Ref.Boenninghausenia albifIora Citrus hybrid dunkan x hamlin Citrus hybrid kiyomo x ito Citrus hybrid ogonkan x hyuganatsu Rutacridone epoxide (86) *( +)-Citropone C (73) *Acrimarine-H (74 R = Me) *( +)-Citropone C *( +)-Citropone C 66 67 68 67 Citrus paradisi Ruta chalepensis Ruta graveolens * New alkaloids. *( +)-Citropone C I-Hydroxy-N-methylacridone(79 R = H) *( +)-Gravacridondiolacetate (77) 12 69 coupling 3-iodo-4-methoxyquinolin-2-one and terminal alkynes with Pd(PPh,),Cl and copper(:) iodide in triethylamine ;51 the reaction proceeded through isolable 3-alkynyl-4-methoxy-quinolin-2-ones often the major products which could be cyclized to the furo[2,3-b]quinoline products with copper(1) iodide and triethylamine.Skimmianine (58 R' = H R2 = R3 = OMe) affects car-diovascular function and vasopressor responses in the rat.52 The alkaloid is neither toxic nor phototoxic to the parsnip webworm Depressaria pastinacella. 53 2 Quinazoline Alkaloids The first natural source of 2-methyl-4(3H)-quinazolinone(64) is the culture broth of the micro-organism Bacillus cereus BMH225-mF1.54 The structure was substantiated by full spectroscopic characterization. The alkaloid is a strong in- hibitor of poly(ADP-ribose) synthetase (Ks0= 1.1 x M), and has a low acute toxicity in mice. A mixture of the cis and trans isomers of febrifugine (65) and (66) has been isolated from a new source Hydrangea rna~rophylla.~~ The cis compound was the major isomer in contrast to previous isolations in which the trans isomer predominated.The trans isomer showed anticoccidial activity in chickens whereas the cis isomer was inactive even at much higher dosages. The hydrochloride of deoxyvasicine (67 X = Y = CH,) an important and relatively non-toxic anticholinesterase drug has been prepared on a fairly large scale (2 kg 94-95 YOpurity) by modifying a known synthesis from anthranilic acid (5 kg) and 2-pyrrolidinone (5.5 dm3).56 The reagents were condensed with phosphorus trichloride at ca. 100 "C and the intermediate deoxyvasicinone (67 X = CH, Y = CO; 70% yield) was reduced with zinc and sulfuric acid. Reduction of deoxy- vasicinone and some of its ring c homologues with sodium borohydride in ethanol left the carbonyl group unchanged but reduced the C=N linkage to give the dihydro compounds (68 X = CH or (CH,), Y = CO).57 These products could be alkylated and acylated on the secondary amine group and nitrated in the aromatic ring.The dihydro derivatives (68 X = CH or CHOH Y = CH or CO) of certain alkaloids underwent slow oxidation back to the alkaloids themselves on storage and more rapid oxidation on heating in alcoholic solvents at 120 "C. 58 The separation of mixtures of deoxyvasicine deoxy-vasicinone and peganol (67 X = CH, Y = CHOH) has been achieved by HPLC.59 Correlations between structure and gas chromatographic behaviour have been elucidated for 2,3-dialkyl analogues of quinazolin-4(3H)-one alkaloids,60 and for analogues of deoxyvasicinone in which ring sizes were varied.61 Sulfoxide analogues of deoxyvasicinone e.g.(69) have been subjected to Pummerer rearrangement with acetic anhydride to give a variety of new a-acetoxysulfides;62 the effect of methyl substituents flanking the sulfoxide group has also been Some bicyclic analogues of deoxyvasicinone lacking the fused benzene ring have been prepared.64 Quinazoline-2,4- diones have been made in excellent yields by sulfur-assisted carbonylation of anthranilamides in the presence of bases such as DBU apparently through an isolable but unstable COS- DBU complex; amongst the compounds prepared was glycosmicine (70).65 3 Acridone Alkaloids 3.1 Occurrence and Structural Studies The period under review has seen comparatively little activity relating to the isolation and detection of acridone alkaloids.The three new alkaloids characterized are listed in Table 2 together with known alkaloids that have been found in new 66-69 NATURAL PRODUCT REPORTS 1993 0 OMe 0 H (71) Citropone-A A (73) Citropone-C (72) Citropone-B H 0'' '0 0 \ 0\ OMe ' / '00 Me0 OH Me Y OR Me0 OH Me (74) (75) Suberosin (76) Citrusamine 0 OMe mR' OMe I Me Me ti2 (77) Gravacridondiolacetate X = OAc (79) (80) Acronycine R = H (82) R'=R2=H (78) Isogravacridonchlorine X = CI (81) R=OH (83) R' = OH R2= H (84) R' = R2 = OOH (85) R' =OH R2= OOH Full details of the isolation of the rare homoacridone synthetic analogues for antimalarial activity towards Plas- alkaloids citropones A and B (71) and (72) (cf Reference 36b) modium y~elli;~O and in vitro activities of six acridone alkaloids have now been published and comprehensive NMR data have against Pneumocystis ~arinii.~~ (-)-Isogravacridonchlorine also been supplied.67 The structure of citropone A has been (78) isolated from the roots of Ruta graveolens and confirmed by single-crystal X-ray analysis.(+)-Citropone C characterized fully by spectroscopic methods has proved to be (73) [a],+7.14" (CHCI,) a new homoacridone alkaloid a potent direct acting frameshift mutagen in Salmonella isolated from various Citrus hybrids has been thoroughly typhimur ium. 'I characterized by 'H and 13C NMR spectroscopies including two-dimensional correlation and heteronuclear multiple bond connectivity experiments and NOE enhancements.The new 3.2 Synthesis compound did not occur in the same species as citropones A Several short syntheses of acridone alkaloids and their synthetic and B and differs from them in having a partially hydrogenated analogues largely by Reisch and co-workers have appeared tropone ring. during the review period. The biosynthetically important A further new acridone-coumarin dimer acrimarine H (74 alkaloid 1,3-dihydroxy-N-methylacridone(79 R = OH) has R = Me) has been isolated in optically inactive form from a been made simply but in poor yield by dehydrating a mixture Citrus hybrid and characterized on the basis of spectroscopic of N-methylanthranilic acid and phloroglucinol in boiling analysis.6s Like its seven previously described relatives (cf.xylene over molecular sieves (5-20% yield) or by heating a Reference 18c) acrimarine H incorporates the coumarin melt of methyl N-methylanthranilate and phloroglucinol at suberosin (79 linked through C-1' in its prenyl side chain to a 205-210 "C (20 Aromatic hydroxylation of acronycine known acridone alkaloid in this case citrusamine (76). The (80) to the 5-hydroxy compound (81) was achieved with alkaloid is the 3-0-methyl derivative of acrimarine G (74 R = buffered m-chloroperoxybenzoic acid (1 0 YO);the same reaction HI. on 1,3-dimethoxy-N-methylacridone (82) gave a mixture of the The new furo[2,3-c]acridone alkaloid gravacridondiolacetate 2-hydroxy product (83) (6.5 YO)and the hydroperoxy com-(77) isolated from Ruta graveolens together with known pounds (84) and (85) (13.5 % and 18.8 YOyields re~pectively).'~ compounds of similar structure has been characterized by Hydroxylation of 1 -and 3-methoxy-N-methylacridone has also proton and carbon NMR spectroscopy.69 Reversed phase been Alkylation of 1,3-dihydroxy-N-methyl-HPLC conditions have been developed for the separation of 22 acridone (79 R = OH) with 1,4-dibrom0-2-methyl-2-butene in acridone alkaloids ;66 the relationship between structure and the presence of various bases produced mixtures of rutacridone chromatographic behaviour was probed and several alkaloids (87) isorutacridone (88) and the 0-alkylated compound (89) ; could be detected in plant extracts by this method.Biological the best yield of rutacridone (25 YO)was obtained with aluminium studies include in vitro testing of 47 acridone alkaloids and oxide while isorutacridone predominated (6 1 YO)in the presence NATURAL PRODUCT REPORTS 1993-5.P. MICHAEL H 0" '0 H H 0" '0 0'' '0 0 I Me CH2Br (86) Rutacridone epoxide (87) Rutacridone R = Me (88) lsorutacridone (89) (90) Gravacridonol R = CH20H 00 OH 0 i-iii iv PhN=C=S -60% Ph,N 'C02Me 55Vo C02Me H 6N J-CN v-vii 0 OMe 0 OH CI 0 fyy$: q-q Me \ H /OH 0 (80) Acronycine Reagents i ethyl cyanoacetate NaOMe MeOH; ii MeI; iii ethyl acetoacetate Pr'ONa Pr'OH reflux; iv o-C1,C6H4 reflux; v POCl, 120-125 "C; vi prenyl bromide K,CO, DMF r.t.; vii HCI MeOH r.t. to reflux; viii NaH THF reflux; ix PhOH 100 C; x HCl MeOH reflux; xi DDQ toluene reflux; xii NaH MeI DMF 60 "C.Scheme 7 0 OH 4 References 1 E. V. Dehmlow A. Sleegers N. Risch W. Trowizsch-Kienast V. Wray and A. A. L. Gunatilaka Phytochemistry 1990 29 3993. Me 2 J. Pusset J. L. Lopez M. Pais M. A1 Neirabeyeh and J.-M. HO OMe Veillon Planta Med. 1991 57 153. 3 R. S. Bhakuni Y. N. Shukla and R. S. Thakur Phytochemistry, OMe Me OMe 1990 29 2697. 4 S. Kurucu FABAD Farm. Bilimler Derg. 1991 16 1 (Chem. (91) Glyfoline Abstr. 1991 115 155071). BnO 5 T. Nakatsu T. Johns I. Kubo K. Milton M. Sakai K. Chatani OM0 K. Saito Y. Yamagiwa and T. Kamikawa J. Nat. Prod. 1990 53 1508. 6 B. Sener A. Mutlugil N. Noyanalpan and J. R. Lewis J. Fac. Pharm. Gazi Univ. 1990 7 17 (Chem.Abstr. 1991 115 5108). 7 R. Yu X. Li L. Song R. Zhang T. Zhu G. Yang Z. Li and B. Yang Zhongguo Zhongyao Zazhi 1991 16 160 (Chem. Abstr. ofAmberlite IRA-68.76 Allylic oxidation of rutacridone (87) with selenium dioxide and t-butyl hydroperoxide in dichloromethane 1991 115 155030). at room temperature produced gravacridonol(90) in 23 % yield.77 8 T. A. Reshetilova N. I. Yarchuk Y. V. Shurukhin and A. G. Kozlovskii Biokhim. Mikrobiol. 1991 27 725 (Chem. Abstr. Six new acridones bearing hydroxy or methoxy substituents at 1991 115 278039). positions 7 and/or 8 have been prepared by heating methyl 6-9 R. H. Su M. Kim T. Yamamoto and S. Takahashi Nippon amino-2,3-dimethoxybenzoateand phloroglucinol followed by Noyaku Gakkaishi 1990 15 567 (Chem. Abstr. 1991 114 methylation of the condensation products.Syntheses of 10-and 160 748). 1l-nitronoracronycine have been devised for screening tests with 10 W.-R. Abraham and G. Spassov Phytochemistry 1991 30 371. the transplantation tumour leukaemia P 388.79 11 M. A. Khan and P. G.Waterman Fitoterapia 1990 61 282. 12 A. Ulubelen and N. Tan Phytochemistry 1990 29 3991. The more substantial synthesis of acronycine (80) given in Scheme 7 while rather lengthy has the advantage of giving the 13 A. Quader P. P.-H. But A. I. Grey T. G. Hartley Y.-J. Hu and P. G. Waterman Biochem. Syst. Ecol. 1990 18 251. angularly fused product free of linearly fused isomers.80 Glyfoline 14 B. S. Joshi K. M. Moore S. W. Pelletier and M. S. Puar, (9 l) an acridone alkaloid with significant antileukaemic activity Phytochemical Analysis 199 1 2 20.has been made by a standard route involving Ullmann coupling of 15 A. A. L. Gunatilaka M. U. S. Sultanbawa S. Surendrakumar, the substituted aniline (92) and 1-iodo-2,3,4,5-tetramethoxy-and R. Somanathan Phytochemistry 1983 12 2847. benzene.81 16 E. V. Dehmlow and H.-J. Schulz Liebigs Ann. Chem. 1987 1123. 17 0.A. Ileperuma R. C. Senarathna and M. M. M. C. Meedeniya J. Natl. Sci. Council Sri Lanka 1989 17 11 1 (Chem. Abstr. 1991 115 256438). 18 J. P. Michael Nut. Prod. Rep. (a) 1992 9 25; (b) 1992 9 27; (c) 1992 9 31. 19 F. delle Monache G. delle Monache M. A. de Moraes e Souza M. da S. Cavalcanti and A. Chiappeta Gazz. Chim. Ital. 1989 119 435. 20 R. J. Robins A. B. Hanley S. R. Richards G.R. Fenwick and M. J. C. Rhodes Plant Cell Tiss. Organ Cult. 1987 9 49. 21 R. Laschober and W. Stadlbauer Liebigs Ann. Chem. 1990 1083. 22 Y. Kitahara M. Shimizu and A. Kubo Heterocycles 1990 31 2085. 23 S. Torii H. Okumoto and L. H. Xu Tetrahedron Lett. 1991,32 237. 24 V. N. Kalinin M. V. Shostakovskii and A. B. Ponomarev Dokl. Akad. Nauk SSSR 1991 317 1395 (Chem. Abstr. 1991 115 207 827). 25 R. C. Larock and M.-Y. Kuo Tetrahedron Lett. 1991 32 569. 26 J. Koyama T. Ogura K. Tagahara and H. Irie Chem. Express 1991 6 197 (Chem. Abstr. 1991 114 207559). 27 C. M. Pearce and J. K. M. Sanders J. Chem. Soc. Perkin Trans. 1 1990 409. 28 Y. Morimoto F. Matsuda and H. Shirahama Tetrahedron Lett. 1990 31 6031. 29 Y. Morimoto F.Matsuda and H. Shirahama SYNLETT 1991 201. 30 M. L. Hill and R. A. Raphael Tetrahedron 1990 46 4587. 31 Y. Kano Q. Zong and K. Komatsu Chem. Pharm. Bull. 1991 39 690. 32 Y. Kano Z. Qine and K. Komatsu Yakugaku Zasshi 1991 111 32. 33 A. Baumert J. Creche M. Rideau J.-C. Chenieux and D. Groger Plant Physiol. Biochem. 1990 28 587. 34 G. Petit-Paly M. Montagu C. Viel J. C. Chenieux and M. Rideau Pharmazie 1990 45 698. 35 J. Pothier G. Petit-Paly M. Montagu N. Galand J. C. Chenieux M. Rideau and C. Viel J. Planar Chromatogr. -Mod. TLC 1990 3 356 (Chem. Abstr. 1991 114 202792). 36 M. F. Grundon Nat. Prod. Rep. (a) 1990,7 133; (b) 1987,4232. 37 C. F. Neville M. F. Grundon V. N. Ramachandran and J. Reisch J. Chem. Soc. Perkin Trans.I 1991 259. 38 R. C. Anand and A. K. Sinha Indian J. Chem. Sect. B 1991,30 560. 39 R. C. Anand and A. K. Sinha Indian J. Chem. Sect. B 1991,30 604. 40 M. C. L. N. Gupta V. S. Rao and M. Darwarbar Synth. Commun. 1990 20 2103. 41 F. M. A. El-Taweel M. A. Sofan M. A. Mashaly M. A. Hanna and A. A. Elagamey Pharmazie 1990 45 671. 42 M. A. Chauncey and M. F. Grundon Synthesis 1990 1005. 43 G. E. Jackson W. E. Campbell and B. Davidowitz Spectrosc. Lett. 1990 23 971. 44 B. Shieh and T. P. Lin Huaxue 1990 48 259 (Chem. Abstr. 1992 116 174485). 45 B. Shieh and T. P. Lin Huaxue 1990 48 309 (Chem. Abstr. 1992 116 174486). 46 N. Mohi H. Budzikiewicz B. A. H. El-Tawil and F. K. A. El- Beih Phytochemistry 1982 21 1838. 47 K. C. Majumdar and P.K. Choudhury Heterocycles 1991 32 73. 48 H. Suginome K. Kobayashi M. Itoh S. Seko and A. Furusaki J. Org. Chem. 1990 55 4933. 49 M. Subramaniam P. Shanmugam and K. J. Rajendra Prasad Indian J. Chem. Sect. B 1991 30,422. NATURAL PRODUCT REPORTS 1993 50 S.-C. Kuo S.-C. Huang L.-J. Huang H.-E. Cheng T.-P. Lin C.- H. Wu K. Ishii and H. Nakamura J. Heterocyc. Chem. 1991 28 955. 51 J. Reisch and P. Nordhaus J. Heterocyc. Chem. 1991 28 167. 52 J. T. Cheng S. S. Chang and I. S. Chen Arch. Int. Pharmacodyn. 1990 306 65. 53 M. R. Berenbaum and K. Lee Chemoecology 1990 1,81 (Chem. Abstr. 1991 115 129655). 54 S. Yoshida T. Aoyagi S. Harada N. Matsuda T. Ikeda H. Naganawa M. Hamada and T. Takeuchi J. Antibiot. 1991,44 111. 55 M.Kato M. Inaba H. Itahana E. Ohara K. Nakamura S. Uesato H. Inouye and T. Fujita Shoyakugaku Zasshi 1990 44 288 (Chem. Abstr. 1991 115 64012). 56 K. D. Sargazakov K. N. Arupov L. V. Molchanov and V. N. Plugar Khim. Prir. Soedin. 1990 506 (Chem Abstr. 1991 114 102 528). 57 K. M. Shakhidoyatov and G. A. Belova Khim. Prir. Soedin 1990 659 (Chem. Abstr. 1991 114 207567); English translation in Chem. Nat. Comp. 1991 561. 58 M. V. Telezhenetskaya and V. N. Plugar Khim. Prir. Soedin 1991 149 (Chem. Abstr. 1992 116 105568); English translation in Chem. Nut. Comp. 1991 133. 59 A. L. D’yakanov and B. D. Kabulov Khim. Prir. Soedin 1991 297 (Chem. Abstr. 199? 116 129351). 60 0.Papp G. Szasz L. Orfi and I. Hermecz J. Chromatog. 1991 537 371.61 0.Papp G. Szasz J. Kokosi and I. Hermecz J. Chromatog. 1991 537 377. 62 A. D. Dunn and R. Norrie Z. Chem. 1990 30 288. 63 A. D. Dunn and R. Norrie Z. Chem. 1990 30,439. 64 E. 0.Oripov K. A. Zakhidov and K. M. Shakhidoyatov Khim. Prir. Soedin 1991 394 (Chem. Abstr. 1992 116 106569). 65 T. Miyata T. Mizuno Y. Nagahama I. Nishiguchi T. Hirashima and N. Sonoda Heteroatom Chem. 1991 2 473. 66 J. Reisch W. Probst and D. Groger Pharmazie 1990 45 500. 67 C. Ito S. Tanahashi K. Fujiwara M. Nakagawa M. Ju-Ichi Y. Fujitani M. Inoue A. T. McPhail T.3. Wu I. Kajiura M. Omura and H. Furukawa Chem. Pharm. Bull. 1990 38 188 1. 68 C. Ito S. Tanahashi Y. Tani M. Ju-Ichi M. Omura and H. Furukawa Chem. Pharm. Bull. 1990 38 2586. 69 H. Paulini R.Waibel J. Kiefer and 0.Schimmer Planta Med. 1991 57 82. 70 H. Fujioka N. Kato M. Fujita K. Fujimura and Y. Nishiyama Arzneim.-Forsch. (Drug Res.) 1990 40 1026. 71 S. F. Queener H. Fujioka Y. Nishiyama H. Furukawa M. S. Bartlett and J. W. Smith Antimicrob. Agents Chemother. 1991 35 377. 72 H. Paulini R. Popp 0.Schimmer 0. Ratka and E. Roder Planta Med. 1991 57 59. 73 J. Reisch K. Schmidt and H. Stenke Pharmazie 1990 45 629. 74 J. Reisch and A. Wickramasinghe Monatsh. 1990 121 709. 75 J. Reisch and M. Top Acta Pharm. Turc. 1991 33 71 (Chem. Abstr. 1992 116 59683). 76 J. Reisch A. Wickramasinghe and W. Probst Monatsh. 1990 121 829. 77 J. Reisch and A. A. Voerste Liebigs Ann. Chem. 1991 299. 78 J. Reisch H. M. T. B. Herath and N.S. Kumar Liebigs Ann. Chem. 1990 1047. 79 J. Reisch and P. Dziemba Arch. Pharm. (Weinheim) 1991 324 67. 80 R. C. Anand and A. K. Sinha Heterocycles 1990 31 1733. 81 T.-L. Su K. Dziewiszek and T.-S. Wu Tetrahedron Lett. 1991 32 1541.

ISSN:0265-0568    

DOI:10.1039/NP9931000099

出版商:RSC    

年代:1993

数据来源: RSC

摘要:

The Chemistry of Azadirachtin S. V. Ley A. A. Denholm and A. Wood Department of Chemistry Imperial College of Science Technology and Medicine London UK S W7 2A Y 1 Introduction 1.1 Insect Pest Management 1.2 The Neem Tree Azadirachta indica A. Juss (Meliaceae) 1.3 Azadirachtin Biosynthesis 1.4 Azadirachtins and Related Compounds 1.5 The Biological Effects of Azadirachtin I .6 Discovery and Structure Determination 2 Natural Product Modification 2.1 Hydroxyl Group Reactivity 2.2 Hydrogenation 2.3 Reactions of the C-22-C-23 Enol Ether 2.4 Saponification Reactions 2.5 Functional Group Chemistry of Azadirachtol 2.6 Oxidation Reactions 2.7 Functional Group Chemistry of 7-Ketoazadirachtins 2.8 Retro-aldol Reaction Studies 2.9 Skeletal Rearrangements 3 The Synthesis of Azadirachtin-derived Di hydrofuranacetal Components 3.1 The Shibasaki Route to Azadirachtin 3.2 The Synthesis of Racemic Hydrofuranacetals Related to Azadirachtin 3.3 The Preparation of an Enantiomerically Pure Hydrofuranylacetal Intermediate 3.4 The Preparation of Prototype Coupling Fragments 3.5 The Preparation of Enantiomerically Pure Insect Antifeedants Based on Azadirachtin 4 Decalin Synthesis 4.1 Other Approaches to Azadirachtin 4.2 Early Approaches to a Decalin Fragment 4.3 A Remote Oxidation Approach 4.4 An Angular Hydroxymethylation Approach 4.5 An Intact Hydroxymethylene Residue Approach 4.6 Factors Influencing Intramolecular Diels-Alder Cyclization 4.7 A Silicon Directed IMDA Approach 4.8 The Dimethyl(pheny1)silyl Group as a Stereocontrol Element for Intramolecular Diels-Alder Reactions 4.9 Elaboration of an A-Ring Syn-1,3-diol for Total Synthesis Studies 4.10 Tetrahydrofuran Annulation 5 Structure-Activity Relationships 6 Conclusions 7 References 1 Introduction 1.1 Insect Pest Management As worldwide populations continue to expand the need for the efficient use of diminishing farmland and the maximization of crop returns is becoming evermore prevalent.During the latter half of this century the concept of insect pest control has gained great importance.In 1988 more than half of the worldwide expenditure on agrochemicals some $4000 million was devoted to insecticides in an effort to defy the continuous onslaught of over half a million different herbivorous insect species. The cost of the damage caused by this predation and its effect on agriculture especially in third world countries has created a demand for effective crop protecting agents.' Traditionally the agricultural community has relied extensively on synthetic insecticides such as organo-chlorines -phosphates and dinitro- Me0,C' *-0 phenols etc.2 These broad spectrum chemical pesticides are toxic towards a wide range of insects and whilst being effective against the target pest often indiscriminantly destroy other beneficial species including the pest's natural enemies.Ad- ditionally as insects evolve to resist such toxins larger amounts of pesticide are required thus causing increased ecological disturbance and pollution of the en~ironment.~ Furthermore a large proportion of crops are still lost to predatory insects and other pests. The need for environmentally acceptable methods of plant protection has stimulated the search for new classes of insecticide^,^. including the pyrethroids which now account for about one third of world insecticide use.' Plants have evolved highly elaborate chemical defences against insect attack. This class of secondary metabolite9 provides science with a rich pool of biologically active compounds on which to base the search for an effective insect antifeedant.7*8 An insect antifeedant has been defined by Munakata7 as a substance which inhibits feeding but does not kill the insect directly individuals often remaining near to the treated plant and possibly dying through starvation.This mode of action is in direct contrast to more traditional pesticides and insecticides which display a rapid outright kill. In order to be an effective insect antifeedant a given candidate must fulfil an exacting list of requirements. These criteria include the need for selective toxicity activity at low concentration economic viability stability and compatibility with existing plant protection methods. No currently known antifeedant meets all of these requirements. Not surprisingly the use of insect antifeedants is limited and to date only one commercial product Margosan-O@ which contains the potent antifeedant azadirachtin (1) is available.1.2 The Neem Tree Azadirachta indica A. Juss (Meliaceae)? Azadirachtin (1) belongs to the C-seco-limonoid group of triterpenoids and has been found to occur only in the neem tree or Indian lilac Azadirachta indica A. Juss (Mefiaceae).' The neem tree has been the source of a large array of biologically active triterpenoidslO* l1 which have been isolated mainly from the seeds but also from the bark and leaves. As a measure of the importance of neem as a source of biologically important compounds three international neem conference^'^-'^ have now t Earlier botanic names were Melia indica and M. azadirachta.The latter name has often been confused with Melia azadarach. The taxonomy of these closely related species is complex and some botanists have recognized as many as 15 distinct species. 109 NATURAL PRODUCT REPORTS 1993 (4) azadirone ACO (5) azadirachtanin A (6)salannin (7) nirnbin (8) nirnbidinin been held together with two recent meetings in the United States.15.l6 Neem commonly known as margosa or the Indian lilac and less commonly as nim kohomba verpu thini mamba or sudul' was originally located in Southern Asia and is now widespread over tropical and sub- tropical Africa America and Australia. There are an estimated 14 million trees in India alone.18 The tree is an evergreen fast-growing species which can reach a height of up to 25 m given the correct environmental conditions.An average 15 year old tree can yield up to 20 kg of fruit which corresponds to about two kg of seed kernels. Although a tropical climate is ideal neem is extremely hardy and capable of withstanding harsh conditions.19 The unusual properties of neem have been exploited for centuries and feature in ancient Sanskrit writings. The leaves are used to protect grain and clothes from insects18 and the seed oil used as an insecticide20 and medicine for the treatment of leprosy skin disease and malaria.21 Although the insect antifeedant activity of neem leaves against the desert locust Schistocerca gregaria was recognized over half a century ago22 the first scientific investigations in this area were not initiated until the late 1960~.~ 1.3 Azadirachtin Biosynthesis All of the well characterized components in neem belong to the triterpenoid group.It is likely although no general theory has yet appeared that these triterpenoids are all derived from the steroidal intermediate tirucallol (2).23 Later biosynthetic products arise from successive oxidation and rearrangement reactions and may be grouped into three categories. Those compounds having intact C-20-C-25 steroid side chains e.g. nimbocenone (3),24 make up the first category and are referred to as the protolimomoids. These in turn are the likely biosynthetic precursors to the limonoids or tetranortri- terpenoids e.g. azadirone (4),25 in which four side chain atoms have been lost and the remainder cyclized to form a furan.The final category is composed of further modified products such as penta- and hexa-nortriterpenes. The limonoids are sub-divided according to the presence or absence of additional ring system modification. In the latter case one finds tetracyclic compounds such as azadirone (4) and azadirachtanin A (5).26 The most common members of the former group are the C-seco-limonoids and include salannin (6)27 and nimbin (7),24a7c which are believed1° to originate from nimbidinin (8)28 via a series of oxidation reactions which achieve c ring cleavage. 3-Acetyl-11 -methoxy- 1-tigloylazadirachtinin (9) is an inter- esting C-seco-limonoid isolated by Kraus et al.,29 which presumably arises by C(7)OH intramolecular oxirane ring- opening in an S,2 fashion with accompanying inversion at C-14.1.4 Azadirachtins and Related Compounds As previously mentioned the neem tree is a source of a diverse array of triterpenoids,'O a comprehensive listing of which is beyond the scope of this review. It is however pertinent to NATURAL PRODUCT REPORTS 1993-S. V. LEY A. A. DENHOLM AND A. WOOD (1 0) azadirachtinB (1 0) 3-tigloylazadirachtol (11) azadirachtin D (12) 1-cinnarnoyl-3-feruloyl-11-hydroxyrneliacarpin (13) azadirachtin F (15) azadirachtin H summarize the known azadirachtins and those closely related compounds which have been isolated. Unfortunately a lack of coordination in nomenclature has led to a number of differing conventions and consequently several compounds are referred to by more than one trivial name.Azadirachtin A (1),30or more commonly azadirachtin (I) is the predominant antifeedant and growth disrupting neem component. Rembold30 describes this as azadirachtin A and other structurally related compounds as azadirachtin B etc.3-Tigloylazadirachtol ( is described as being identical with azadirachtin B,31 isolated by following its activity in the Epilachna bioassay.33 3-Tigloylazadirachtol (10) is very pro- bably the active compound of lower polarity than azadirachtin isolated by Morgan and ButterworthS0 and not investigated further. There has been some confusion as to whether 3- tigloylazadirachtol (10) corresponds to a compound described earlier by Kubo and named deacetylazadirachtinol.(14) azadirachtin G (16) azadirachtin 1 Only a partial structure comprising a trans-decalin sub- stituted as for azadirachtin (1) is available for azadirachtin C.30 Azadirachtin D (1 1)30 differs from azadirachtin (1) in that C-29 is not oxidized and is present as an angular methyl group. A compound with a similar oxidation level 1 -cinnamoyl-3-feruloyl-1 1-hydroxymeliacarpin (1 2) has been isolated from the Persian lilac Melia azadara~h.~~ Azadirachtin E30 corresponds to detigloylazadirachtin. Aza- dirachtin F (13)30 and G (14)30are structural relations of 3-tigloylazadirachtol(l0). For azadirachtin F (13) the unoxidized C-19 angular methyl group is accompanied by a pendant methyl glycolate side chain at C-9 whilst for azadirachtin G (14) the almost ubiquitous C-13-C-14 oxirane is absent and replaced by a double bond and a C-17 hydroxyl group.Azadirachtins H (15) and I (16) have recently been isolated from neem seed kernels by preparative HPLC3' and found to lack the C-12 carbomethoxy group. NATURAL PRODUCT REPORTS 1993 (17) 22,23-dihydro-23-P-methoxyazadirachtin (ve paoI) 0 H A L (19)marrangin I IV Although not classified by Remb~ld,~~ 22,23-dihydro-23-P-methoxyazadirachtin (vepaol) (1 7)29.38 and 22,23-dihydro-23- a-methoxyazadirachtin (isovepaol) (18)39 are also claimed to be naturally occurring. Most recently Schmutterer and co-workers have reported the isolation and structure determination of a new azadirachtin congener named marrangin (19).40 This compound is even more effective as an insect antifeedant than azadirachtin (1).The structure given for (19) is surprising given the known reactivity of 3,4-dihydropyran-derived o~iranes.~~ 1.5 The Biological Effects of Azadirachtin Of the numerous triterpenoids isolated from neem azadirachtin (1) has received the greatest attention from the scientific community. Following the original disclosure of Morgan and Butterworth,8 which illustrated that azadirachtin was active as an antifeedant against the desert locust at low concentrations it has been widely reported that azadirachtin disrupts the feeding behaviour of many insects.42 Recent structure-activity- relationship (SAR) studies have begun to clarify the molecular requirements for antifeedant activity30- 43 and will ultimately lead to an understanding of antifeedancy at a molecular level.Azadirachtin also displays several other toxic effects which eventually result in insect growth inhibition malformations ecdysis inhibition and death. Its ability to act as a growth inhibitor was first reported by Schmutterer and Remb01d~~ and since these studies many authors have described the influence of l2-l49 azadirachtin on insect growth. 33,429 45 Despite its high activity against herbivorous insects aza- dirachtin (1) shows no apparent phytotoxicity and is remarkably non-toxic to higher forms of life.46 1.6 Discovery and Structure Determination The full structure determination of azadirachtin (1) took place over some 17 years and is a testament to the unique properties of this complex m01ecule.~' In 1968 the disclosure4* that meliantriol (20) a substance isolated from the fresh fruit of Melia azadarach and the oil of M.Azadirachta acted as a feeding repellant against the desert locust prompted Morgan and Butterworthg to describe the (18)22,23-dihydro-23-a-methoxyazadirachtin (isovepaol) OH H ~ . I \ / (20)meliantnol (211 isolation of a new substance from the seeds of Azadirachta indica A. Juss (Meliceae). This new feeding repellant was of notably high activity against the desert locust and was given the name azadirachtin. In a subsequent publication Morgan and Butter~orth~' went on to correctly identify many of the functional groups of azadirachtin and in the course of this work performed the first chemical modifications on the natural product.Two partial structures (21) and (22) were offered a molecular formula (C35H44016) was determined,50 and it was concluded that the molecule belonged to a new class of hexanortriterpenoids related biogenetically to the C-seco-tetranortriterpenoids salannin (6) and nimbin (7.). Notably the authors demonstrated the presence of two acetate groups and the absence of either epoxide or hemiacetal functions. These errors serve to illustrate the often unusual NMR characteristics and chemical reactivity of azadirachtin pitfalls which early structure determination studies could not have anticipated. Nakanishi and co-workers51 presented the first complete structural proposal (23) for azadirachtin in 1975.Their interpretations were based mainly on partially relaxed Fourier transform 13C NMR spectroscopy and a hypothetical relation- ship of azadirachtin with the known terpenoids salannin (6) and nimbin (7). The tiglate and acetate residues were correctly assigned to C-1 and C-3 respectively the presence of a highly deshielded angular methyl group was inferred to account for a low field non-acetate resonance and azadirachtin was classed as a member of the C-seco-limonoids. Significantly the angular C-19 methyl group was appended to C-10 because of the observation of a long-range 'H-lH coupling with H-9. This result could also have been accounted for by C-8 substitution a feature more in keeping with salannin (6)and nimbin (7).The isolation of a tertiary acetate as the sole product of acetylation was given an ingenious but necessarily incorrect explanation in terms of a secondary to tertiary ester migration leaving a hindered product which was no longer susceptible to further reaction. Nakanishi's azadirachtin (23) silenced the scientific com- .~~ munity until 1984 when Kubo et ~ 1reported the isolation and NMR structure determination of a new azadirachtin congener named deacetylazadirachtinol(24). The proposed structure was the first example of an azadirachtin to have a single C-8-C-14 NATURAL PRODUCT REPORTS 1993-S. V. LEY A. A. DENHOLM AND A. WOOD 0 (23) Nakanishi's azadirachtin (24) Kubo's deacetylazadirachtinol (25)prieurianin bond joining two halves.This conclusion drawn on the basis of an upfield shift in the 13C NMR resonance of C-13 with respect to that of azadirachtin was truly serendipitous given the now known homology between the two compounds. The single C- 84-14 bond joining two 'halves' accounts well for the temperature dependent NMR behaviour of azadirachtin an observation which was not pursued until after an unequivocal structure was available for azadirachtin. The implication of this type of behaviour on the structure of a similarly arranged compound prieurianin (25)52 was known in 1975 and if the analogy with azadirachtin had been noticed at this time it may have profoundly influenced Nakanishi's original deductions.Frenzied activity initiated in 1985 by the publication of the first reappraised azadirachtin structure (26),53 was culminated later in that year with the unequivocal assignment of aza- dirachtin through single crystal X-ray analysis.54 The structure suggested by Ley and co-w~rkers~~ in early 1985 represented a significant advance in showing the presence of a C-8 angular methyl group and a C-9-C- 10 annulated tetrahydrofuranacetal moiety. This revised structure was based on 2D-NOESY and ID NOE difference spectroscopy which revealed the presence of H- 1 -H-19 and H-2-H- I9 interactions thus placing the C- 19 methylene unit at C-10. A syn relationship was proposed for C-18 and C-16 due to the erroneous observation of an NOE between H-16a and Me-18.The correct structure for azadirachtin was submitted to the The azadirachtin puzzle now solved Krau~~~ was led to re- examine Kubo's deacetylazadirachtinol (24).35 Once more the application of NOE difference spectroscopy revealed a new compound with considerable homology to azadirachtin which was named 3-tigloylazadirachto1 (1 0). 32 This assignment was later confirmed by Rembold3' and ultimately by Ley.34.57 Some debate still exists regarding the correct melting point for this material hence it is likely that at least two morphogenic forms exist. Finally three comprehensive full papers published 'back to back' in 1987 brought this chapter in the life of azadirachtin to an end.29,34,58 2 Natural Product Modification Azadirachtin (1) is one of the most highly oxidized limonoids known.It is a complex molecule which boasts a plethora of oxygen functionality comprising an enol ether acetal hemi- acetal and tetra-substituted oxirane as well as a variety of carboxylic esters. Additionally both secondary and tertiary hydroxyl groups and a tetrahydrofuran ether are present. Inspection of the molecular structure reveals 16 stereogenic centres seven of which are quaternary. Azadirachtin is acid base and light sensitive the latter property necessitating the inclusion of UV filters e.g. para- aminobenzoic acid (PABA) in commercial formulations. Chemical Society in September 1985 by Ley and co-w~rkers.~~ This paper contained details of the single crystal X-ray analysis of 22,23-dihydrodetigloylazadirachtin(27) and gave the now well accepted full structure for azadirachtin.Two conformation stabilizing intramolecular hydrogen bonds were noted consisting of a strong interaction between the C(1l)OH and oxirane oxygen and a significantly weaker one between the C(20)OH and C(7)OH with the former group functioning as a hydrogen bond donor. Simultaneously Kraus et al.38published the correct structure for azadirachtin (1) and vepaol (17). Using one-dimensional NOE difference spectroscopy in conjunction with 13C deuterium isotope shift experiment^^^ the authors were able to deduce the correct tetrahydrofuran annulation locus and the presence of the C-I1 hemia~etal.~~ The C-134-14 oxirane was identified as a consequence of its characteristic 13C shifts and its stereo- chemistry demonstrated through selected NOE studies.Much of the early research on the chemistry of azadirachtin was undertaken to assist structure assignment and was conducted in the absence of a full and correct molecular structure. Nevertheless the literature prior to 1985 contains a number of reactions which have proven invaluable as the chemistry of azadirachtin matures. 2.1 Hydroxyl Group Reactivity (a) Acetylation. A number of authors have reported the formation of a tertiary acetate on treatment of azadirachtin with acetic anhydride. 29*45a. 49. 51 Low yields feature promi- nently a trend which characterizes much of the early chemistry of this molecule. Kraus et aL2' were the first to establish unequivocally the identity of this acetylation product as the C- 11 derivative using a combination of 2-D homonuclear correlation and deuterium shift 13C NMR techniques.Our own NPR 10 NATURAL PRODUCT REPORTS 1993 i __t OH AcO"."W OH MeO,C *-0 (28) i Ac,O Et,N DMAP CH,CI, rt (29) (67 YO);(30) (5 YO) R=H R=Ac (29) (30) (1) i (MeO),CO 75 "C 30 min (77%) 0 i OAc (10) i Ac,O Et,N DMAP CH,Cl, (86%) i,R=H (33) ii R=TMS (34) i bis-Trimethylsilylacetamide (BSA) 10 min (43'%); ii BSA trimethylsilylimidazole TMSCl py 60 "C 90 h (12 YO) work in this area has revealed complications caused by (b) Silylation. Morgan and Butter~orth~~ 50 prepared both bis-concomitant C(20)OH acetylation a problem which may be and tris-trimethylsilylethers (33) and (34) of azadirachtin for reduced by employing a stoichiometric quantity of 4-dimethyl- molecular weight determination using mass spectroscopy.aminopyridine. For example acetylation of 22,23-dihydro- Harsh conditions were needed for silylation of the secondary azadirachtin (28) under these conditions affords the desired C(7)OH group providing an early indication of the unreactivity C(1l)OAc (29) along with the C-ll,C-20 diacetate (30).59 of this functional group. Yamasaki and Klo~k~~" have reported the formation of Similarly treatment of 3-tigloylazadirachtol (10) with the 11,20-dicarbomethoxyazadirachtin(3 l) a result which sup- highly reactive silylating reagent trimethylsilyl triflate61 af- ports the emerging C( 1l)OH > C(20)OH % C(7)OH reactivity forded 1,7,20-tris- trimethylsilylazadirachtol (35).43b pattern for azadirachtin.(c) Methylation. Azadirachtin has been successfully alkylated 3-Tigloylazadirachtol (10) is an interesting substrate for using iodomethane under Purdie conditions. The reaction was acetylation allowing comparison of axial C( l)OH versus endo- originally to be low yielding and difficult however C(20)OH reactivity. In the presence of a C-3 tiglate residue slight modification of this procedure allows efficient C(11)OH acetylation is highly regioselective giving 20-acetyl-3-tigloylaza- methylation.62 In parallel with acylation and silylation pro- dirachtol (32) exclusively.g0 longed treatment affords 11,2O-dimethoxyazadirachtin(37).63 9-2 NATURAL PRODUCT REPORTS 1993 i Pd/C H, MeOH 10 min (91 YO) (10) y y i - OH AcO***'W OH Me0,C -0 (1) i AcOH r.t.72 h (99 YO); ii 1.7 x 10-3mm Hg 175 "C,5 min (99 YO) i __Ic (43) i AcOH r.t. 72 h (97%) Consequently a great deal of commercial interest has recently been placed in hydrogenated azadirachtins. 65 We have found that azadirachtin is selectively reduced using palladium on charcoal to either 22,23-dihydroazadirachtin (39)34 or 2',3',22,23-tetrahydroazadirachtin (40)43b depending on the duration of the reaction. 22,23-Ditritioazadirachtin an extremely desirable mech- anistic probe for the mode of action of azadirachtin has been reported by Rembold30 although experimental detail is lacking.11-Methoxyazadirachtin (36) may also be successfully hydro- genated using our conditions and affords compounds with greatly improved stability which remain active as insect antifeedants. 63 Interestingly hydrogenation of 3-tigloylazadirachtol (10) is neither chemo- nor stereo-~elective,~~ perhaps reflecting a 43b less constrained environment for the C-3 tiglate residue in this instance. Although it confers stability removal of the C-22-C-23 enol ether by hydrogenation is not a synthetically productive transformation since it precludes re-establishment of this functional group at a later stage. Consequently reactions which constitute a formal protection of the enol ether are more valuable for total synthesis studies. 2.3 Reactions of the C-22-C-23 Enol Ether During an investigation of the acid catalysed rearrangement of azadirachtin it was discovered that addition of acetic acid to the C-22-C-23 enol ether was an efficient process giving a mixture HO '-A0 v -.*OH Me0,C' (44) of anomeric acetates (42).43b.66 To our disappointment we were unable to isolate similar addition products with other carboxylic acids such as formic and propionic acids etc.Significantly the resulting anomeric acetates (42) could be re-converted to azadirachtin by pyrolytic syn-elimination of acetic acid. This particular strategy for C-22-C-23 enol ether protection has been applied successfully to a number of related compounds including 3-tigloylazadirachtol( 1 1-methoxyazadirachtin (36),67 and azadirachtol (43).60b As well as ease of protection/deprotection an additional criteria for a successful protecting group is stability to a range of conditions.We were not confident that an anomeric acetate would meet this requirement and so elected to examine alternative blocking groups. Treatment of azadirachtin with a variety of Bronsted acids in the presence of methanol led only to complex mixtures of azadirachtinins. It was clear that a more neutral method of acetalization was needed. The reaction of dihydropyran with bromine in methanol is known to give a trans- bromoacetal almost exclusively.68 Treatment of aza-dirachtin with a methanolic solution of bromine gave an isolable mixture of trans-bromoacetals (45),66 which were converted to the naturally occurring methyl acetals ( 17)29.38 and ( 18)39with tributyltin hydride in refluxing benzene.69 The origin of stereocontrol in the formation of halonium cations from allylic alcohols is complex.7o In the case of this conformationally restricted and highly reactive allylic system it is unclear as to the extent to which steric approach control stereoelectronics or reagent polarization by the endo-C(20)0H group are responsible for diasterofacial selection.NATURAL PRODUCT REPORTS 1993-S. V. LEY A. A. DENHOLM AND A. WOOD i (1) -(46) R=Et (47) R='Pr (48) R='BU i Br, ROH 0 "C 5 min; ii Bu:SnH ii (45)R=Br (17)(p) :(18)(a)3 1 R = H[L OR ii L a:J3 = 1 :6 (97%) a:p = 1 :6 (96%) a :J3 = 1 :6 (97%) (49) R=Et a:J3 = 1 :6 (69%) (51) R='M a:J3 = 1 6 (87%) (50)R='Pr a:J3= 1 6 (68%) AIBN C6H6 80 "C 15 min (52) (53) i PhSH Amberlyst-15,4 A sieves MeCN r.t.10 min (60%); ii mCPBA CH,Cl, 0 "C 5 min then Na,S,O and NaHCO, 5 min; iii A toluene Et,N 90 "C 5 min (two steps 47 YO) As well as the naturally occurring 22,23-dihydro-23-a/P- methoxyazadirachtins (17) and (18) a variety of other alkyl 67 acetals (49)-(5 1) have been Our endeavours to restore the C-224-23 enol ether from (18) under mild acidic conditions were unsuccessful as was anomeric exchange with thiophenol which was thwarted by concomitant rearrangement to the azadirachtinin (52).436 The successful formation of 1-tigloyl-3-acetylazadirachtinin (53) is encouraging and implies that choice of a suitable Lewis acid'l to avoid rearrangement will allow this protocol to be extended to azadirachtin synthesis.The loss of stereochemical integrity at C-1 1 upon rearrangement is noteworthy implying a specific role for the C-13-C-14 oxirane in fixing the relative configuration of this stereogenic centre through a hydrogen bond. 2.4 Saponification Reactions 3-Desacetylazadirachtin has been prepared in low yield from azadirachtin by saponification with methanol under basic Removal of the intrinsically less reactive and sterically encumbered C-1 tiglate residue represents a more challenging task. Existing methods rely upon prior conversion to a highly reaction C-1 pyruvate e.g. (54) which is then selectively hydrolysed.For azadirachtin chemoselective tiglate versus enol ether oxidation is accomplished using sodium periodate and pot- assium ~ermanganate,~~ whereas for 22,23-dihydroazadirachtin (39) sodium peri~date,,~ ozone,6oa and osmium tetroxided5" have all been employed. In the latter case the intermediate C-2' C-3' cis-vicinal-diol (56) may be Formation of azadirachtol (43) is a much more straight- forward operation requiring treatment of 3-tigloylazadirachtol (10) with triethylamine in aqueous methanol. As a corollary the resulting tetraol (43) may be esterified regioselectively with tigloyl chloride providing an important relay for synthesis studies directed towards (10).60b* 72 2.5 Functional Group Chemistry of Azadirachtol The availability of azadirachtol(43) makes it an ideal prototype for the examination of end game strategies concerned with NATURAL PRODUCT REPORTS 1993 (39) I iii HO Hog$ OH (56) (55) i 0, MeOH -SO 'C (60 %); ii aq.NaHCO, (56 %); iii OsO, aq. MeCN 25 'C 30 min then NaIO, 230 min (5 1 %) C0,Me o$ H -HQ I 0 i -OH -II "*OH (10) (43) i Et,N MeOH H,O (1 :5 l) 65 "C (96%); ii Tigloyl chloride Et,N DMAP CH,Cl, (50%) .OAc OAc -i ii (57) i 2-Methoxypropene PPTS CH,Cl, r.t. 3 h (93%); ii CuCl;H,O azadirachtin total synthesis. Protection of the A ring 1,3-diol as an acetonide e.g. (58) may be accomplished for the parent compound (43) 22,23-dihydroazadirachtol and 23-aIP-ace- toxy-22,23-dihydroazadirachtol(57).43b Deprotection of (58) using copper(I1) chloride mon~hydrate~~ in ethanol is facile.Treatment of azadirachtol (43) with acetic anhydride gives 1,3,20-triacetylazadirachtol(59)in high yield,43b whereas acetic pivalic anhydride74 affords predominantly 3-acetylazadir-achtinol (60).60b From this result the reactivity pattern of an hypothetical azadirachtin derived pentaol may be extrapolated as C(3)OH -C(l l)OH > C(20)OH > C(1)OH 9 C(7)OH. In accord with this scale the reaction of 3-acetylazadirachtol (60) with tiglic acid under Mukaiyama conditions75 gave 3- acetyl-20-tigloylazadirachtol(62).60bIt is clear that introduction of a tiglate residue at C-1 will require an alternative approach. 2.6 Oxidation Reactions Morgan and Butter~orth~~ failed to oxidize azadirachtin using (58) EtOH (94%) Cornforth's reagent76 but noted slow oxidation of detigloylaza-dirachtin to an A ring 1-en-3-one.Such a product was consistent with their proposed A ring substitution pattern but would require an allylic chromate ester 2,3-~hift~~ were it to arise from azadirachtin (1). The resistance of the C(7)OH group of azadirachtin towards oxidation may be attributed to shielding of this function by the right-hand side of the molecule which is held in place by a network of hydrogen bonds (see Section 1.6). Examination of previous NMR studies suggested that disruption of this hydrogen bonding particularly the strong C( 1 1)OH-oxirane interaction might reduce C(7)OH encumbrance by populating more open conformers such as that given for 7,11,20-trimethoxyazadirachtin (38).58 Indeed NOE experiments con- ducted at 3 16 K on 23-a-acetoxy-22,23-dihydro-1l-methoxy-azadirachtin (63)67 in deuteriochloroform solution indicated the presence of an open conformer behaviour not observed for azadirachtin at 333 K! Activated DMSO reagents7* and ruthenium based NATURAL PRODUCT REPORTS 1993-S.V. LEY A. A. DENHOLM AND A. WOOD (43) ii (60) (61) I i Ac,O Et,N DMAP CH,Cl 2 d r.t. (95%); ii Acetic pivalic anhydride Et,N DMAP CH,CI, 0 "C to r.t. 13 h (60) (61 %); (61) (6%) (60) i 2-Chloro- 1-methylpyridium iodide tiglic acid Et,N CH,CI, (47 YO) MeO n HO n ?*c OTig (1) (CDC13 D20,333K) (38) (CDCl3,333K) (63) (CDC13,316K) OAc i ii __t (63)-(64) i PDC 4 A sieves CH,CI, r.t.40 h (82 YO);ii 175 "C 1.7 x lo- mmHg 5 min (99%) all failed to oxidize (63) however pyridinium dichromate centration.81 The resulting 23-a-acetoxy-22,23-dihydro-7-keto-(PDC)so was successful. Prolonged treatment with a large 11-methoxyazadirachtin (64) was easily transformed into 7-excess of oxidant was required supporting a mechanistic keto-11-methoxyazadirachtin (65) by pyrolytic syn-elimination rationale which involves the rate determining decomposition of of acetic acid (see Section 2.3).67 an axial chromate ester present in low equilibrium con-PDC oxidation was successful for a variety of other NATURAL PRODUCT REPORTS 1993 ppy i __t 1:l 0 (1) i Periodinahe CH,Cl, r.t. 30 min (73 YO) i __t 'OAc ii --..cL i Periodinane CH,Cl, 40 "C I6 h (60 %); ii 165 "C,2 x mmHg 5 min (63 %) azadirachtin derivative^,^^.82 including 22,23-dihydro- 11-meth-oxyazadirachtins3 and 22,23-dihydro-11,2O-dimethoxyazadi-ra~htin.~~ The latter reaction is more rapid and higher yielding as may be predicted from our conformation based model for C(7)OH reactivit~.~~ 11-Methoxyazadirachtin (36) is resistant to C-11 acetal exchange thus precluding the synthesis of 7-ketoazadirachtin (66) via this intermediate. The importance of (66) within our SAR programme necessitated its synthesis and consequently an alternative route to this compound was sought. Dess-Martin periodinaneS4 is an efficient and mild oxidizing agent which has found use in natural product synthesis.The ability of this reagent to function in the presence of acetic acid suggested it might be usefully employed in the oxidation of azadirachtin. To our surprise treatment of (1) with periodinane afforded the allylic acetates (67).846 This complication was easily circumvented by masking the C-22-C-23 enol ether as an anomeric acetate. Although capricious oxidation was successful and gave 7-ketoaza-dirachtin (66) following elimination of acetic 2.7 Functional Group Chemistry of 7-Ketoazadirachtins For the most part 7-ketoazadirachtins behave in a similar fashion to their naturally configured C(7)OH counterparts however differences do arise. It would appear that C(7)OH oxidation is accompanied by an attenuation of C(1)OH reactivity.For example saponification of 7-keto- 1 1-methoxy-azadirachtin (65) occurs readily giving 3-desacetyl- 1-detigloyl-7-keto-11-methoxyazadirachtin (69),67 whereas for 1l-meth-oxyazadirachtin (36) the reaction is sluggish and incomplete even after 72 h.82 Furthermore attempted acetonide formation85 from the 1,3- diol(72) gives only the mixed methyl acetal (73) in contrast to 3-desacetyl-1-detigloyl-22,23-dihydroazadirachtin(74) which affords the 1,3-acetonide (75).82 Significantly 1,3-benzylidene acetal formation is possible for 7-ketoazadirachtins e.g. (76).82t 2.8 Retro-aldol Reaction Studies Our planned synthesis of azadirachtin is highly convergent and envisages the late construction of the C-84-14 bond joining two functionalized components.These advanced synthetic intermediates have considerable homology with the trans-decalin and dihydrofuranacetal portions of azadirachtin. Consequently the goal of degrading azadirachtin by C-84-14 bond cleavage has existed since the conception of our synthetic programme. The realization of this objective would furnish molecular fragments which could be correlated with advanced synthetic material and used to enrich later reactions. It was hoped that a retro-aldol reaction would provide decalin and dihydrofuran fragments as shown below. The proposed retro-aldol cleavage requires C(7)OH oxi- dation and ring-opening of the tetra-substituted C- 13-C- 14 oxirane. Initial attempts at base mediated cleavage served only to illustrate the resistance of the oxirane function towards t A rationale for this behaviour is presented in Section 2.8.NATURAL PRODUCT REPORTS 1993-S. V. LEY A. A. DENHOLM AND A. WOOD (70)R = tigbyl (36) (71)R=H i Et,N,MeOH,H,O (1 5 l) 65 "C 32 h (46 Yo);ii Et,N,MeOH H,O (1 5 I) 65 "C 72 h (70) (59 YO);(71) (28 Yo) (72) i 2-Methoxypropene PPTS CH,Cl, 0 "C (87 Yo) (74) i 2-Methoxypropene PPTS CH,CI, r.t. (70 %) (76) (77) i PhCH(OMe), PPTS C,H, A 15 min (94%) X CO,Me -+ NATURAL PRODUCT REPORTS 1993 (65) i NaOMe MeOH r.t. 1 h (81 %) yy i OH AcO'*''~ OH Me0,C '-0 X-ray of (80) i PDC 4 A sieves CH,Cl, (80) (10%) intermolecular attack. For example the reaction of 7-keto- 11-methoxyazadirachtin (65) with sodium methoxide gave only 3-desacetyl-7-keto- 1 1-methoxyazadirachtin (78).67 Acid mediated reactions were also unsuccessful however a number of interesting rearrangements were observed (see Section 2.9).An important breakthrough came with the isolation and structure determination by X-ray diffraction analysis of a minor by-product from the PDC mediated oxidation of 22,23-dihydro-11-methoxyazadirachtin (79) giving (80) and (81).59.62,63 The unusual cyclic carbonate (80) possess the necessary disposition of functional groups to allow intra- etc. molecular oxirane ring-opening by a series of p-elimination reactions. Additionally the boat configured B ring fulfills the Corey-Sneen8' requirements for C-84- 14 bond cleavage by placing this bond orthogonal to the C-7 carbonyl residue.Several mechanisms may be postulated for the formation of (80) including chromium (v)~* mediated cleavage of the C- 2042-21 bond to form an oxonium cation (82) or C-20-C-21 cleavage via the intermediacy of the cyclic chromate ester (83).89 The observation that the B ring conformation changes on C(7)OH oxidation explains a number of seemingly anomalous results. The now pseudo-axial right-hand side increases steric compression of the C-1 tiglate residue thus accounting for its NATURAL PRODUCT REPORTS 1993-S. V. LEY A. A. DENHOLM AND A. WOOD 'OH (85) OKoMe -" 0 iii C0,Me ii + HO-'' 2 1 a:p (84) i MeOH r.t. 1 h (85 YO);ii NaOMe MeOH r.t. 24 h (82YO); iii NaOMe MeOH r.t.24 h (92 YO) Me02C (77) increased rate of saponification and the attenuation of C(1)OH reactivity. Additionally if one reasonably assumes a boat conformation for both the B ring and benzylidene acetal units of (77) then formation of a similarly arranged 1,3-acetonide is precluded by unfavourable flagpole interactions. We were extremely pleased to find that treatment of the ketocarbonate (80) with sodium methoxide in methanol caused a retro-aldol reaction to take place giving the decalin (84) as a mixture of C-8 epimer~~~.~~ and the unusual spirocycle (86).59 The formation of (80) was optimized by using the more acidic oxidizing agent pyridinium chlorochromate (PCC)goand our attention turned to an examination of the chemistry of the decalin fragments (84).Protection of the 1,3-diol unit of (84) as a diacetate (87) benzylidene acetal (88) or acetonide (89) was readily ac-complished by standard means.62 C0,Me C0,Me (84) (87) \ iii C0,Me I C02Me (89) i Ac,O Et,N DMAP CH,CI, r.t. 24 h (79%); ii PhCH(OMe), PPTS C,H, A I h (96%); iii 2-methoxypropene PPTS CH,Cl, 24 h (79%) NATURAL PRODUCT REPORTS 1993 Unfortunately attempts to regenerate the C-1 1 hemiacetal under a variety of conditions proved fruitless. For example treatment of (87) with dimethylboron bromideg1 caused tetrahydrofuranyl ether cleavage in preference to acetal exchange.82 A more easily removed C(1l)OH protecting group was needed. An acetate moiety seemed ideal but was unlikely to withstand the strongly basic conditions developed for the retro- aldol reaction.Fortunately retro-aldol cleavage proved amen- able to much milder conditions. For example a mixture of partially saponified decalins was isolated following treatment of (80) with methanolic triethyla~~line.~~.~~ Oxidation of 11-acetoxy-22,23-dihydroazadirachtin(29) with PCC gave the required ketocarbonate (93) albeit in reduced yield. 82 The retro-aldol reaction of (93) was successful and ac-companied by C(1 1)OAc hydrolysis. The resulting decalins were then readily transformed into the fully protected fragments (98) and (99) which show considerable homology with our synthetic material. For the partially saponified compounds (96) and (97) the C(1l)OH groups were first benzylatedg2 and the remaining tiglate and acetate residues removed using potassium carbonate in methanol to allow formation of a 1,3-benzylidene acetal.86 For the trio1 (95) benzylidene acetal formation must precede benzylation and consequently benzaldehyde dimethyl acetal was replaced with benzaldehyde since the former reagent is known to cause concomitant acetal exchange at anomeric 2.9 Skeletal Rearrangements The close proximity of so many conformationally restricted and reactive functional groups means that the chemistry of azadirachtin is not only determined by the inherent reactivity of C0,Me C0,Me AcO *" (87) (90) i Me,BBr CH,Cl, -78 OC 2 h r.t.15 min (52%) C0,Me CO,Me 1:20a:p (84) (91) R=H (3:5 a:P) ii r '-(92)R=AcO (519 a:P) i Et,N MeOH H,O (I :5 I) r.t.24 h (84) (29%); (91) (38 YO); (92) (20%); ii Ac,O Et,N DMAP CH,Cl, 5 h r.t. (92%) i (29) -+ (93) (94) i PCC 4 A sieves CH,Cl, 48 h r.t. then 35 "C 24 h (93) (49 YO); (94) (1 1%) c0,Me (93) + :P (95) (96) (97) i 5 % Et,N MeOH A 30 h then CH,N, CH,Cl, (95) (61 %); (96) (15 %) or i Et,N MeOH H,O (1 :5 l) r.t. 24 h then CH,N, CH,Cl, (96) (24yo); (97) (1 7 yo) NATURAL PRODUCT REPORTS 1993-S. C0,Me (97) I i ii v V. LEY A. A. DENHOLM AND A. WOOD 0 CO,Me its constituent functionality but also by synergistic effects. These are the origin of the somewhat unpredictable behaviour of azadirachtin a characteristic which often manifests itself in the form of unusual rearrangement reactions.The azadirachtin to azadirachtinin rearrangement is the best understood and most easily recognized example of this behaviour. First encountered during an attempted deoxy- genation reactiong4 this rearrangement can now be induced under acidic conditions for both azadirachtin and 3-tigloylaza- (96) dirachtol 57 Unfortunately the direct biomimetic conversion of azadirachtin to 3-acetyl- 1-tigloylazadirachtinol I (53) cannot be accomplished because of competing C-22-C-23 ,,iv,iii enol ether decomposition. As previously mentioned the loss of the C-134-14 oxirane in (100) is accompanied by configurational instability at the C- 11 hemiacetal site. The major naturally configured epimer is C02Me C0zMe similar to 3-acetyl- 1 1-methoxy-1-tigloylazadirachtinol (9) iso- H H lated by Kraus et al.,29whilst the minor component bears close analogy to 1-cinnamoylmelianolone.95 The rather unusual polycyclic oxetane (101) was isolated as + a by-product of azadirachtin saponification.The structure presented follows from extensive NMR studies and may be rationalized mechanistically. Oxetane ring formation by 7-endo-tet cyclizationg6 induces C- 13-C- 14 oxirane ring opening. The resulting C( 14)OH group then causes transacetalization at (99) C-1I liberating an angular C-19 hydroxymethylene ‘arm ’ -which lactonizes at the c-29ester-i BnBr Ag,O DMF 3 h (84%); ii K,C03 MeOH r.t. 2 h (64%); During a large scale C-23 acetate pyrolysis a new product iii BnBr Ag,O DMF 3.5 h (63 YO);iv K,CO, MeOH r.t.2 h (73 %); V PhCH(OMe), PPTS C,H, A I h (98) (21 %); (99) was observed which showed some similarities to the compound (49Yo) (103) obtained from the Lewis acid catalysed rearrangement of i -(39) i Amberlyst-15 4 A sieves MeCN 3 d (51 %) i NaOMe MeOH r.t. 2.5 h (101) (23%); (102) (50%) i TMSCl NaI MeCN,” 5 min (39%) salannin (6).436 82 Again structure determination relied heavily on NMR analy~is.'~*~~ A mechanism for the formation of (104) must draw precedent from the known rearrangement of furans to butenolide~.~~ Finally a series of cage-like C-7 acetals have been isolated from the attempted acid catalysed retro-aldol decomposition of 7-ketoa~adirachtins.~~ For example 22,23-dihydro- 1 1 ,20-di-methoxy-7-ketoazadirachtin (105) gave the polycyclic acetal (106) whose structure was unequivocally assigned by X-ray analysis.The ketocarbonate (80) is the cornerstone of our retro-aldol strategy. This material also undergoes acid catalysed rearrange- ment rather than fragmentation.82 These rearranged acetals are devoid of insect antifeedant a~tivity.'~ The diverse range of complex products derived from oxidized azadirachtins under acidic conditions illustrates that a delicate thermodynamic balance exists between the 2,4-dioxatricyclo- [6.2.1 .03* 'Iundecane acetal unit of azadirachtin and its related polycyclic permutations. The reversible series of acid catalysed acetal hydrolysis versus formation reactions which link these species complicates the chemistry of both fully constituted azadirachtins and much simpler fragments.3 The Synthesis of Azadirachtin-derived Dihydrofuranacetal Components The fused-ring cyclic acetal moiety is embodied in a large number of natural products many of which display interesting biological properties ranging from the highly toxic and carcinogenic aflatoxinsg9 to insect antifeedants such as clero- dinloo and azadirachtin (1). The furo[2,3b]pyran unit is (105) i Amberlyst- 15 4 A sieves MeOH 72 h (59Yo) 0 (80) i PPTS C,H, 96 h (40%) * NATURAL PRODUCT REPORTS 1993 conserved in the azadirachtins whilst several clerodanes and aflatoxins contain the more common furo[2,3b]furan moiety. Many methods exist for the synthesis of fur0[2,3b]furans.~~' In contrast relatively few syntheses of the homologous furo- [2,3b]pyrans have been reported.lo2 Indeed with the exception of our own efforts in this area only one other synthesis of a complex furo[2,3b]pyran similar to that embodied in aza-dirachtin (1) has appeared.lo3 3.1 The Shibasaki Route to Azadirachtin Shibasaki and co-~orkers'~~ are pursuing the total synthesis of azadirachtin from a potential approach which is similar to our own and involves the strategic disconnection of the C-84-14 bond.The authors plan to transform the advanced synthetic intermediates (108) and (109) into azadirachtin using aldol-like methodology following hydroxylation of (109) at the pro-C-13 0 CO,Me i o 0~3 C02Me nHom* OTBDMS R'O"' 0 Metal (109) Me02C *-0 NATURAL PRODUCT REPORTS 1993-4.V. LEY A. A. DENHOLM AND A. WOOD carbon atom. The published synthesis of the dihydrofuranacetal component (109) was achieved in 28 steps. The synthesis of (109) starts from the enantiomerically pure aldehyde (1 10) which is readily available from S-( -)-ethyl lactate. lo4 In order to select this antipodal series the absolute configuration of azadirachtin was assumed to be 3(R). Stereoselective olefinationlo5 of (1 10) was followed by a Johnson rearrangement to give (1 1 1). This transformation displays excellent allylic stereocontrol. The poor control exerted at the newly derived ct-stereogenic centre in (1 11) is due to non-stereoselective ketene acetal formationlo6 and is of little OHC-i ii -OEE consequence since subsequent Dieckmann cyclization was accompanied by equilibration at this position.Decarboxylation of the intermediate ketoester under standard condition^'^' then afforded the substituted cyclopentanone (1 12) as a 7 1 mixture in favour of the desired trans-isomer. This was converted in seven steps to the allylic alcohol (1 13). Stereoselective epoxi- dation of (1 13) was achieved in high yield using the catalytic Sharpless reaction. lo8This reaction has proved especially useful for the epoxidation of 2-substituted allylic alcohols like (1 13) whose product oxiranes e.g. (114) are often susceptible to nucleophilic ring-opening by isopropoxide anion.lo9 Reaction c~+jJ, -0 + vi-xii OH c,..SOHxv-xvii 0 xviii-xix ~ ___t OBn OBn xx-xxiii I HO I TBDMSO OTBDMS OTBDMS (1 19) xxv-xxvii HOAp OTBDMS (109) i Br-Ph,P+(CH,),CO,Et ButOK THF -78 "C (94 YO);ii AcOH-H,O-THF (3; 3; I) (100 YO); iii EtC(OEt), EtCO,H xylene 140 "C (91 YO); iv KH THF (89 %); v NaCl H,O DMSO 130 "C (100%); vi HOC€I,CH,OH TsOH PhH 80 "C (84%); vii OsO, NMO 99%; viii NaIO, (95 %) ;ix BnOCH,Sn@, BuLi -78 "C (83 YO);x CrO .2Py 4 A sieves (94 %) ;xi H, Pd/C ;xii Br-Ph,P+Me ButOK (78 %) ;xiii TBHP (-)-DET Ti(Pr'O), 4 A sieves CH,Cl, -20 "C (96 %) 1:14 a:P;xiv BnOH KH THF (91 YO); xv SO,.Py DMSO Et,N (93%); xvi Br-Ph,P+Me ButOK 50 "C (89 YO); xvii FeCI * SiO, acetone (1 00 %) ;xviii LDA THF -78 "C then MoOPh -30 "C (40%) ; xix Me,NBH(OAc), AcOH MeCN r.t.(83 Oh) 99 1 @:a;xx TBDMSOTf 2,6-lutidine 50 "C (91 YO);xxi BH,-THF then Me,NO diglyme (61 %); xxii H, Pd/C (90%); xxiii (COCl), DMSO Et,N CH,Cl, -78 "C to r.t. ;xxiv AcOH-H,O-THF (3 3 I) 60 "C (60 %); xxv PhSH BF,.Et,O (83 YO);xxvi m-CPBA NaHCO,; xxvii PhMe 120 "C; xxviii PDC DMF 40 "C (37% over three steps) NATURAL PRODUCT REPORTS 1993 I OMe I OMe (128) OTBDMS (127) *TBDMS i,,/ (126) OTBDMS vii &'<i _____t & I OI OTBDMS OTBDMS OTBDMS (130) R=OH (131) R=SPh c (132) R=SOPh A 10d! 10g& I t>H OH (121) (1 22) i LDA THF -78 "C then MoOPH -78 "C to r.t. (67%); ii ButMe,SiC1 imidazole DMF r.t. 1 h (94%); iii KDA THF -78 "C CH,=CHCH,Br -78 "C to r.t. (83%); iv DIBAL toluene -78 "C (57%); v H,SO, MeOH r.t.60%; vi 0, MeOH -78 "C then NaBH, r.t. (88 %); vii Amberlysto 15 MeCN r.t. 50 min (64 %); viii TBAF THF r.t. (71 %); ix 0,,CH,Cl, -78 "C then Ph,P r.t. 4 h (93YO); xi rn-CPBA CH,CI, 0 "C (72%); xii Et,N toluene 110 "C 10 min, x Amberlyst 15 PhSH 4 A sieves MeCN r.t. 30 min (85 YO); (99%); xiii TBAF THF r.t. 1 h (76%) of (1 14) with potassium benzyloxide affords the tertiary alcohol stereochemistry of which was confirmed by X-ray crystallo- (1 15) without complications caused by competing epoxide graphic analysis. Standard protection of (124) by silylation was rearrangement,'lO which in this case is degenerate. Compound followed by re-enolization with potassium diisopropylamide (1 15) was then elaborated by standard means to give the ketone (KDA)ll6 and alkylation with ally1 bromide.Once again (1 16) whose kinetic enolate was stereoselectively oxidized from reaction occurred from the more 'open' eno-face to give the its a-face using the MoOPh complex.111 The resulting acyloin fully substituted lactone (125) as a single stereoisomer as was then reduced using Evan's reagent112 to give the diol (1 17) assigned by X-ray crystallographic analysis. Reduction of the which was converted to a dialdehyde (1 18) possessing the same lactone (1 25) with diisobutylaluminium hydride (DIBAL-H) oxidation level as the target molecule (109). Selective deprotec- gave the pivotal lactol intermediate (126). tion of the secondary silyl ether present in (1 18) then allowed Conversion of (126) to the fully saturated model compound acetal formation to take place giving the tricyclic lactol (1 19) (121) relied upon ozonolysis with reductive work-up and which was dehydrated to the enol ether (1 12) using a protocol therefore required that the sensitive lactol function be protected developed in our laboratories.Finally oxidation with PDCB0 prior to this transformation. Following anomeric exchange gave the desired coupling fragment (109). with methanol and ozonolysis the tricyclic acetal (129) was obtained by intramolecular transacetalization under acidic conditions. The silicon protecting group was then removed 3.2 The Synthesis of Racemic Hydrofuranacetals Related to using tetra-n-butylammonium fluoride (TBAF) to give the Azadirachtin model compound (12 1). During our studies on the total synthesis of the clerodane The synthesis of the dihydrofuranacetal (122) required antifeedants we were able to illustrate that partial structural ozonolysis of (126) to give an intermediate which could be units could function as biologically active compounds.113 This transformed by dehydration into the desired 2,3-dihydrofuran. fact taken together with our proposed route to azadirachtin In contrast to the findings of Pfleiger and Muckensturm102b made the synthesis of simple racemic hydrofuranacetal models ozonolysis of (1 26) could be performed without competing an ideal starting point from which to explore more complex lactol oxidation and decomposition of the intermediate targets designed with total synthesis in mind. ozonides with triphenylphosphine allowed isolation of the Our route to the model compounds (121) and (122)43a*114 lactol(l30) in high yield.The direct dehydration of (1 30) failed starts with the known bicyclic lactone (123).'15 As predicted under a variety of conditions. At this point rather than oxidation of the lithium enolate of (123) with MoOPh"' following more classical precedent which relied on lactol '17 occurred from the least hindered exo-face to give (124) the acetate pyrolysis,102b we elected to develop new methodology NATURAL PRODUCT REPORTS 1993-S. V. LEY A. A. DENHOLM AND A. WOOD TBDMSO TBDMSO (134) (138) i NaBH, MeOH r.t. (85%); ii DMSO (COCI), -65 "C; Et,N -65 LDA THF -78 "C then MoOPH -78 "C to r.t. (76 %) TBDMSO 1,3 silyl shift 7 I H20 + * I OTBDMS TBDMSO OH (143) i DMSO (COCI), -65 "C; Et,N -65 "C to r.t.(77%); ii Bu"Li CH,=CHCH,SnBu, THF -78 "C to 15 "C (142) (50%); (143) (34 Yo) for introduction of the required enol ether. Thus (130) was converted to the thioacetals (131) by anomeric exchange with thiophenol. Oxidation with meta-chloroperbenzoic acid (m- CPBA) then gave a mixture of sulfoxides (1 32) which afforded the desired enol ether (122) on thermolysisll* followed by desilylation. This azadirachtin model proved to be a potent antifeedant against Spodoptera littoralis (Boisduval) in a choice bioassay.43a. 11* TBDMSO TBDMSO H (139) (140) "C to r.t. 93%; iii rn-CPBA TsOH.H,O cat CH,Cl, r.t. (87%); iv 3.3 The Preparation of an Enantiomerically Pure Hydrofuranylacetal Intermediate The syntheses developed for the model compounds (121) and (122) provide no facility for the introduction of oxygen functionality at C-9 or C-10 which was needed if suitable fragments were to be made available for coupling studies.A modification of our route was necessary to allow this required functionalization. The tricyclic ketone (134) has been used by Roberts and co- worker~~~~ in the synthesis of prostaglandins and is available in enantiomerically pure form via enzymatic reductionlZ0 or from the a-methylbenzylammonium salt (1 33).lZ1 This chiral educt seemed ideally suited to our purposes provided regioselective homoconjugate reduction could be accomplished. Paquette et all2 have shown that reduction of the related species (135) with lithium aluminium hydride affords the endo-alcohol (1 36).This outcome which may be attributed to efficient C-34-7- bond overlap with the C-2 carbonyl group which gives a LUMO having similar nodal properties to that of butadiene [see (137)l. A similar C-3-C-4 bond interaction is geometrically precluded. As predicted the reduction of (1 34) with sodium borohydride followed by Swern oxidation7* gave the desired bicyclic ketone (138) which was readily converted to the lactone (139) by regioselective Baeyer-Villiger oxidation.123 It was envisaged that the remaining transformations would be accomplished following our previously established procedures. Although stereoselective a-hydroxylation of (1 39) occurred smoothly attempts to further elaborate intermediate (140) by enolization and electrophilic allylation proved fruitless reflecting the highly encumbered environment of the C-4 endo-proton.It was hoped that the a-ketolactone (141) might provide a solution to this problem by allowing use of a chemoselective nucleophilic addition to install the required C-4 exo-ally1 moiety. Unfortunately the addition of ally1 lithium to (141) was accompanied by an oxy-anion 1,3-silicon shift124 to give the unwanted bicycle (142) as well as the desired material (143). This transfer and subsequent rearrangement was induced exclusively by the addition of hexamethylphosphoramide (HMPA) to the reaction medium. The formation of the thermodynamically more stable cis-fused bicyclo[3.3 .O] system (142) occurs to relieve steric buttressing caused by unfavourable endo interactions in (143).Further evidence of the propensity for rearrangement was NPR 10 NATURAL PRODUCT REPORTS 1993 * I OTBDMS TBDMSO OH (143) OH (144) i TBAF THF r.t. (82%); ii TBAF THF r.t. (92%) 0 observed on the attempted deprotection of (143). Independent treatment of the tertiary silyl ethers (142) and (143) with TBAF gave the same product which was identified as the bicyclo[3.3.0] diol (144) by extensive NMR ana1~sis.l'~ It was argued that inversion of the endo-C(6)0H group in (138) would give a diastereoisomeric series in which rearrange- ment was less likely because of the greater strain associated with the formation of a trans-fused bicyclo[3.3 .O]octane ring The bromoketone (145) seemed an ideal precursor to an exo-configured C(6)OH intermediate and was readily available from (133) via known compounds,126 by a route directly analogous to that previously employed.114 12' The displacement of bromide from (145) was initially investigated under silver(1) cation assisted conditions and caused partial racemization.'14 This may be attributed to a contribution from a pathway involving the intermediacy of the symmetrical nortricyclene (146). The highly nucleophilic combination of potassium super- oxide and 18-cr0wn-6-ether~~~ was tested next in the hope that racemization might be avoided under conditions which favoured an S,2 like reaction coordinate.Protection of the C-2 ketone residue in (145) as a 1'3-dioxane allowed bromide displacement with potassium superoxide to give (147) together with a small amount of elimination product (148). Subsequent benzylati~n'~~ and dioxane removal gave the ether (149)' which was shown to be enantiomerically pure by NMR determination of a derived Mosher ester.67. 130 Regioselective Baeyer-Villiger oxidation then provided the lactone (1 5O).ll4 Oxidation of (150) was achieved via the enolate using MOO * Py .DMPU (MoOPD) a new and safer alternative to the conventional MoOPh reagent,"l in which HMPA has been replaced with the less toxic 1,3-dimethyl- 3,4,5,6,-tetrahydro-2-( 1 H)-pyrimidone (DMPU).132 The inter- mediate a-hydroxylactone was then silylated to give (1 51) as a mixture of isomers in favour of the expected P-product.Deprotonation with KDA116 and stereoselective alkylation with ally1 bromide gave an excellent yield of the desired lactone (152). The success of this approach contrasts the earlier failure to enolize (138) and is a reflection of the importance of endo- 1iii (150) (149) i HO(CH,),OH PPTS PhH 80 "C 3 h (92%); ii KO 18-C-6 DMSO-DME 1 1 r.t. 60 h (147) (81 YO); (148) (7%)fki NaH BnBr BuiNI THF 0 "C to r.t. 12 h then 1M HCl 50 "C 2 h 45 min (73 YO); iv rn-CPBA TsOH.H,O cat. CH,Cl, r.t. 3 h (91 %) interactions in controlling the chemistry of these and related systems. Following our earlier route reduction of (152) with DIBAL-H gave the lactol (153) together with some over-reduced product (154).Ozonolysis of this mixture with triphenylphosphine work-up then gave the separable lactols (155) and (156). The tricyclic lactol (155) was then further transformed to the methyl acetal (157) by anomeric exchange with methanol under acidic conditions. Compound (1 57) was crystalline and allowed unambiguous assignment of structure within the reaction sequence by X-ray crystallographic analysis. Finally hydrogenolysis of (1 57) in the presence of an essential trace amount of hydrochloric acid gave the pivotal intermediate (1 58).l14 At this point it is pertinent to emphasize that (1 58) was prepared in enantiomerically pure form from the bromoketone (145) in 12 steps and 19% overall 3.4 The Preparation of Prototype Coupling Fragments A flexible synthetic programme which gives access to a number of potential coupling intermediates from a common precursor is essential if a comprehensive study of C-8-C-14 bond forming reactions is to be undertaken.As outlined above our approach fulfils this requirement by providing an advanced intermediate (158) which may be readily transformed into a range of prototype compounds for coupling. For example oxidation of (158) and (159) proceeds well using PDCS0 to give the corresponding C-9 ketones (160) and (161) in which the C-10 position is activated for coupling. We have also examined several oxygen transposition re-actions to provide C-10 ketones. Compound (158) was dehydrated via its mesylate (162) using 1,8-diazabicyclo- [5.4.0]undec-7-ene (DBU) in boiling toluene.It is likely that elimination proceeds through a syn-exo mode134 rather than the alternative anti-endo mode. It is noteworthy that attempted direct dehydration of (1 58) with Martin's sulph~rane'~~ and the Burgess failed. Martin's sulphurane is known to affect dehydration via a trans-coplanar E mechanism for secondary carbinols and so its failure in this instance may be attributed to mechanistic requirement for disfavoured anti-endo elimination. Indeed the reaction of em-norborneol with Martin's sulphurane is rapid and quantitative giving nortricyclene not norbornene. 135 The failure of the Burgess salt is somewhat more surprising since this reagent is known to favour sjmcoplanar elimination and has been used successfully for the transformation of exo- norborneol to norbornene.The highly polarized double bond found in compounds such as (163)13' introduces the potential for regioselective hydro- 131 NATURAL PRODUCT REPORTS 1993-S. V. LEY A. A. DENHOLM AND A. WOOD OTBDMS OBn OTBDMS I ~ BnO& Me vii- HO& Me O1 I0 OTBDMS (157) i LDA THF -78 "C then MoOPD -78 "C to r.t.; ii ButMe,SiC1 imidazole DMF r.t. 14 h (81% two steps) a:/3 1:4; iii KDA THF -78 "C; HMPA; CH,=CHCH,Br -78 "C to 0 "C (800Y~); iv DIBAL toluene -78 "C; v 0,,CH,Cl, -78 "C then Ph,P r.t. 14 h (155) (75Y0),two steps a:p 1:4; vi Amberlyst 15 MeOH 3 A sieves MeCN r.t. 15 min (83%) a:p 1:3; vii H, 10% Pd/C HCl MeOH r.t. (98 Yo) i I OTBDMS OTBDMS (158) X=OMe (160) X=OMe (159) X=OAC (161) X=OAC i PDC 4 .& sieves CH,Cl, (160) (91 %); (161) (76%) OTBDMS OTBDMS "0,wMi 0-0- MsO,MMe ii MMe O1 O1 O1 OTBDMS OTBDMS OTBDMS (158) (162) (163) i MsCl Et,N CH,CI, r.t.10 min; ii DBU toluene 110 "C 38 h (95 YO),two steps 10-2 NATURAL PRODUCT REPORTS 1993 i 9-BBN THF 67 "C 20 min then 3M NaOH 27.5 % aq. H,O, 0 "C to r.t. 1 h (95 %); ii PDC 4 sieves CH,CI, r.t. 16 h (166) (75 %); (165) (23%); iii LDA THF -78 "C then MeI -78 "C to r.t. (69%) ".OMH H O M H ii HO& Ph -I___)c O1 O1 O1 OTBDMS OTBDMS OTBDMS (155) (168) (169) 1 iii iv Ph +..A Ho& I I v I -&f OTBDMS OTBDMS OTBDMS OTBDMS OTBDMS OTBDMS (174) (173) (109) i H, 10% Pd/C trace HCl MeOH r.t.(87%); ii BF;Et,O PhSeH CH,CI, 0 "C 10 min (60%); iii MsC1 Et,N CH,Cl, r.t. (84%); iv DBU PhMe 110 "C 21 h (78 "/o); v 9-BBN THF 68 "C Somin then 3M KOH 27.5 Oh aq. H,O, 0 "C to r.t. 5 min then 2-(phenylsulfonyl)- 3-(p-nitrophenyl)oxaziridine,r.t. 10 min (92%); vi PDC 4A sieves CH,Cl, r.t. 12 h (173) (76%); (174) (20%); vii LHMDS THF -78 "C then MeI -78 "C to r.t. (93 YO) boration. Reaction of (163) with 9-borabicyclo[3.3. llnonane The Shibasaki intermediate (1O9)lo3 may also be prepared (9-BBN) occurred from the least hindered em-face and gave an from the previously described lactol. This route exploits many inseparable mixture of regioisomeric alcohols (1 58) and (1 64) of the transformations previously developed with the exception following oxidative work-up.The regioselectivity of this of the protocol for enol ether introduction which was adopted reaction may be attributed to a C-94- 10 n-bond -C-1-C-2 c* because anomeric exchange with benzeneselenenol was higher interaction which reduces nucleophilicity at C-9. yielding than with thiophenol. The selenoacetal (169) was Oxidation of (1 58) and (1 64) produced the ketones (1 65) and readily dehydrated to give (170). In a neat three step sequence (1 66) which were readily separated by flash chromatography. hydroboration of (1 70) using 9-BBN with oxidative work-up The C-10 ketone (166) was then stereoselectively monoalkylated was followed by selective selenide oxidation with the Davis to give the potential coupling fragment (167).l14 oxa~iridinel~~ and concomitant selenoxide elimination to give NATURAL PRODUCT REPORTS 1993-4.V. LEY A. A. DENHOLM AND A. WOOD '&' ii c(176) X=OMe (1 75) X=SePh OTBDMS OTBDMS (163) + iii OH OTBDMS (178) (177) i Dimethyldioxirane acetone/CH,Cl, 1 1 r.t. 14 h (98 %); ii Amberlyst 15 PhSeH 4 A sieves MeCN r.t. (44 YO);iii 2-(phenylsulfonyl-)3- (p-nitrophenyl)oxaziridine Py CH,Cl, r.t. 10 min (57 Oh); iv TBAF THF r.t. 5 min (95 YO) i H, 10% Pd/C MeOH r.t. (97 Oh); ii Amberlyst 15 PhSeH 4 A sieves MeCN r.t. 15 min (58 %); iii 2-(phenylsulfonyl)-3-(p-nitrophenyl)-oxaziridine Py CH,Cl, r.t. 10 min (82%); iv TBAF THF r.t. 3 h (95 YO) the regiosomeric alcohols (171) and (172). Oxidation of this mixture with PDCB0 gave the ketones (173) and (174) which could be separated by flash chromatography.The major isomer (173) was then alkylated to give (109),'14 identical in all respects to the previously reported material.lo3 The syntheses delineated above exemplify the flexibility of our route which allows the preparation of many novel hydrofuranacetals for incorporation into the total synthesis of azadi rac h tin. 3.5 The Preparation of Enantiomerically Pure Insect Antifeedants Based on Azadirachtin In addition to its central role in our total synthesis programme the tricyclic acetal intermediate (158) is also invaluable as a chiral educt for the synthesis of model antifeedants based on azadirachtin (l).ll4* 133 One important target molecule for our antifeedant studies incorporates an oxirane unit to mimic the C-13-C-14 oxirane found in azadirachtin.This model may be synthesized from the tricyclic olefin (163). Epoxidation of (163) with m-CPBA was sluggish giving the oxirane (175) in only moderate yield after 48 h however dimethyl di~xiranel~~ proved more efficient providing (175) in essentially quantitative yield after 14 h. The stereochemical outcome of this reaction was expected on steric grounds and was proved by NOE difference NMR spec-troscopy. The previously described procedure was used to introduce the enol ether function in order to overcome problems encountered with anomeric exchange using thiophen01.l~~ The selenoacetal (1 76) underwent smooth elimination of benzene- seleninic acid on oxidation and yielded the antifeedant model (178) following removal of the silicon protecting group.Finally a single antipode of the previously synthesized racemic antifeedant (122) was also prepared using the route developed for (178) by substituting an hydrogenation step in place of epoxidation. 4 Decalin Synthesis Synthesis of the decalin fragment of azadirachtin (1) is a challenging task requiring the introduction of a number of contiguous stereogenic centres several of which are fully substituted and consequently must be established with the correct relative configuration since no potential for equi- libration exists. It is clear that any successful approach must be concise and employ reactions which achieve significant gains in molecular complexity. The Diels-Alder cycloaddition140 is one of the most powerful transformations available to the organic chemist allowing the construction of two carbon-carbon CT bonds and up to four stereogenic centres in a single operation.The intramolecular variant of this reaction has even greater p0tentia1.l~~ The tethering of diene and dienophile components gives the opportunity for the reversal of regioselectivity termed pericyclic Urnpol~ng,'~~ and stereoselection which is inde- pendent of secondary orbital These factors taken together with the obvious entropic advantages make the intramolecular Diels-Alder (IMDA) reaction an ideal choice for the construction of complex polycyclic molecules. This transformation underpins our successful synthesis of the decalin fragment of azadirachtin ; however before discussing this approach it is pertinent to summarise other contributions to the area.4.1 Other Approaches to Azadirachtin As mentioned previously Shibasaki and co-~orkers~~~ have an approach to azadirachtin which also requires the construction of a highly functionalized decalin. While no reports on the synthesis of this fragment have yet appeared in the literature Shibasaki has recently disclosed a new method for decalin ~ynthesis~~~.~~~ which is based on an asymmetric variant of the Heck reaction14s developed in his laboratories. Mori and Watanabel*' have a conceptually different ap- proach towards azadirachtin which involves the formation of NATURAL PRODUCT REPORTS 1993 OR’ Mm2c@oR2 0.6,: Ox0 CHO 0 OH LDA A 1 Me&H OTBDMS_CHZN2 H OTBDMS AH OTBDMS the C-8-C-14 bond at a relatively early stage.The authors envisage coupling of the A ring of fragment (179) with the aldehyde (180) to give a decalin (181) which already bears a C-8 norbornyl substituent suitable for further elaboration to the dihydrofuranacetal component of azadirachtin. A concise enantioselective synthesis of an advanced precursor (185) of the coupling fragment (180) has already been accomplished starting with the enzymatic reduction of the prochiral diketone (182). Ireland-Claisen rearrangement14* of the enolate derived from (183) furnishes the pro C-8 quaternary stereogenic centre of (184) in a highly diastereoselective fashion. In model studies for B ring annulation the pro C-6-C-7 bond was constructed by addition of the sulfoxide anion of (186) to the aldehyde (187).It is envisaged that subsequent 6-endo-trig cyclization of the enone intermediate (189) derived from the sulfoxide (188) by Pummerer rea~rangement,~~~ will furnish the decalin system (190). 4.2 Early Approaches to a Decalin Fragment Our synthetic analysis of the azadirachtin decalin residue is transform driven and makes use of the IMDA reaction to establish much of the molecular framework of this fragment. The synthesis of the triene precursor (191) is presented below. Although normally unreactive towards ketones ethyl-2-triphenylphosphoranylidene acetate (192) reacts readily with 1,2-diketones such as butan-1,2-dione (193) to give the corresponding y-keto-+unsaturated as geometric isomers e.g.(194) and (195). The major E-isomer (195) was converted to the 1,3-dioxolane enal(l96) in a standard series of operations involving protection lithium aluminium hydride reduction and oxidation with manganese dioxide.151 The OTBDMS C02Me I C02Me I i (186) LDA then (187); ii H,CCHOEt p-TSA substituted dithiane (198) required for coupling with (196) was easily obtained from the bromoacetal (197). Dithiane anion coupling of (198) with enal (196) required the use of two equivalents of the internally coordinated lithio-anion of (198). Previous studies have demonstrated the need for such stoi-chiometry when stabilized anions of this manner are em-ployed.153 Additionally the use of N,N,N,N-tetramethyl-ethylene diamine (TMEDA) was crucial paralleling previous observations on the reactivity of 2-substituted 2-lithio-1,3-dithianes with P-oxygen functionality.Alkylation of the resulting allylic alcohol (199) was accomplished with 2- NATURAL PRODUCT REPORTS 1993-S. V. LEY A. A. DENHOLM AND A. WOOD OTBDMS 09 OTBDMS 0-0 PPh Me0 OMe XBr+Q (197) n + V n -'9 (198) *Me vi iii LiAlH, Et,O -50 "C,inverse addition (98 YO); i CH,Cl, r.t, 48 h (88 %); ii HO(CH,),OH PPTS C,H, A 60 h (100YO); iv MnO, CHCl, 72 h (89%);v LDA THF HMPA (80%); vi (196) Bu"Li TMEDA THF -30 "C 1 h then (194) 10 min (93YO); vii KH C,H, TMEDA (80%); viii PPTS aq. acetone A (94%);ix HO(CH,),OH PPTS C,H, A (79%) (bromomethyl)prop-2-enoate (200) using potassium hydride and TMEDA in benzene.With the requisite carbon framework now in place selective aldehyde protection with an acid stable acetal was required before triene formation could be carried out. Propane-1,3-diol is known to be more selective than ethylene glycol for the mono-protection of molecules containing non-equivalent carbonyl and 1,3-dioxanes are known to be more resistant to hydrolysis than their ketonic counter- part~.~~~ Following this precedent the mixed acetal (201) was hydrolysed and the resulting ketoaldehyde chemoselectively protected as the 1,3-dioxane (202). With this triene precursor at hand the IMDA cyclization could now be tested. In view of literature precedent it was initially anticipated that the IMDA reaction would exhibit an exo-product stereochemical bias following advanced peripheral bond forma- tion in the transition ~tate.~~'.'~~ However a more detailed analysis of the four possible transition states A B C and D revealed the possibility of an interesting and significant perturbation associated with the bulky dithiane side chain.An examination of steric interactions suggested that in the endo-mode B substantial transannular interactions and Ale3- exist thus disfavouring this process. Furthermore in exo-arrangement D unfavourable interactions between the diene methyl substituent and dithiane containing side chain R inhibit the formation of (206). Since peripheral bond formation should be advanced in the transition states shown transannular effects were expected to be attenuated.Nevertheless examin- ation of the required endo-mode A versus the unwanted exo- mode C indicated a likely selectivity for A where the largest substituent in the linking chain adopts a pseudoequatorial disposition. This crude analysis predicts a reaction coordinate which favours population of the desired transition state. NATURAL PRODUCT REPORTS 1993 RO RO Me02C' OTBDMS 09 OTBD~ 09 (203) (205) i TBSOTf Et,N CH,Cl, -20 "C (87%); ii A 135 OC DMSO (203) (60%); (205) (24%) Indeed following formation of the silyl enol ether (2O7)l6O we found that thermolysis in dimethyl sulfoxide (DMSO) provided only two products in a 5 :2 ratio and high yield.The C=C stretching frequency of the major and minor products was 1648 cm-' and 1681 cm-l respectively the former value being indicative of the more highly strained trans-fused endo-product (203).162 The H-6 resonances of the major and minor products at 3.29 ppm and 3.47 ppm respectively also corroborate assignment of the major product as (203) in which the more shielded H-6 proton is anti to the carbomethoxy moiety. The C-5 stereochemistry of the minor product (205) was assigned by analogy to related systems modelled using the Macromodel program.'63. 164 Having devised a route to compound (203) containing three of the required stereogenic centres having the correct relative configurations we next sought methods for B ring annulation. Intramolecular Mukaiyama aldol cy~lization'~~ was explored with a variety of Lewis acids following literature precedent,ls6 but resulted only in deprotection.Fortunately cyclization of the ketoaldehyde (208) under basic conditions gave a dia-stereoisomeric mixture of aldols (209) and (210) in good yield. Single crystal X-ray analysis of aldol(210) enabled unambiguous structure assignment for this compound and also confirmed our structure for the major cycloadduct (203). Interestingly attempted deprotection of the minor cyclo- adduct (205) under acidic conditions resulted in concomitant intramolecular aldol condensation giving a single crystalline product (21 l) X-ray analysis of which allowed unambiguous structure assignment of the minor cycloadduct (205).The facility of the intramolecular cyclization in this example reflects the kinetically preferred formation of a cis-decalin by axial attack on the intermediate A ring enolate. As a corollary it was envisaged that intramolecular Michael addition might be used to introduce the C-94-10 bond with the correct relative stereochemistry. Cyclization of (208) is unusual in that it proceeds to-give a trans-decalin by equatorial bond formation therefore it seemed likely that a highly electrophilic C-9 substituent would be required to encourage NATURAL PRODUCT REPORTS 1993-4. V. LEY A. A. DENHOLM AND A. WOOD (203) 0 OH 0 OH Me02C He-@,+ (210) Me02C -He (YL, (209) i AcOH H,O THF 65 "C (73%); ii NaOMe MeOH 0 "C (209) (16%); (2101 (75%) 0 OH (205) (21 1) (21 4) i p-TSA acetone H,O 24 h (72%) i NaC1 DMSO H,O A 4 h (81 %) 0 0 i -C02Me C02Me 'S H i Dimethyl malonate piperidine AcOH 80 "C (90 YO); ii NaOMe MeOH 0 "C (60 %) this relatively unfavoured process.Knoevenagel condensa- ti~n'~~ of (208) with dimethyl malonate gave the Michael acceptor (212) in high yield and subsequent base mediated cyclization afforded a single product (214) in which the C-9-C- 10 bond is P-configured reflecting its pseudoaxial disposition in the transition state (213). The structure determination of (214) was crucial to our synthesis and difficult to deduce by NMR techniques; for- tunately single crystal X-ray analysis was possible and clearly illustrated the equatorial displacement of the malonyl residue and the trans-fused decalin arrangement.The triester (214) was readily decarboxylated under standard conditionslo7 giving (215). In order to progress the synthesis of azadirachtin (1) from this point the oxidation levels of C-1 C-3 C-7 all required some adjustment. It was planned to incorporate C-3 oxygen functionality via the intermediacy of an enone which in turn could be introduced using selenium based methodology. 16* NATURAL PRODUCT REPORTS 1993 i Me02C -Me02C -(215) (216) i LDA NPSP THF ; ii 3-(pnitrophenyl) -2-phenylsulfonyloxaziridine,aq. NaHCO, CH,Cl, (62 %) C02Me C02Me 0 -0 Me02C -(216) (217) (217) (218) i MeI CaCO, CH,CN H,O A (70%) i Li(ButO),AIH THF 0 "C (96%) C02Me ___t ___t Me02C -Me02C -(217) (219) i NaBH, CeC1;7HZO MeOH (78 YO), 2 1 a:P;ii MnO, CH,Cl, (60%) Following this silylcupration and silyl Baeyer-Villiger oxi-dation according to Fleming's protocol seemed appropriate.169 Dehydrogenation of (21 5) was accomplished by successive selenenylation using N-phenylselenophthalimide(NPSP)170and selective Se-oxidation with the Davis ~xaziridinel~~ to give (21 6) following syn-elimination of the intermediate selenoxides. Silylcupration of the enone (216) was unsuccessful and so an alternative approach based on a C-2-C-3 oxirane was con- ceived. It was considered expedient to remove the oxidation sensitive dithiane moiety before attempting epoxidation. The dithiane group is notoriously difficult to remove as is reflected in the number of procedures which exist to this end.171 Iodomethane in the presence of aqueous base172 proved efficient in our case giving the desired ketone (217) in reasonable yield.In order to avoid problems of chemodifferentiation at a later stage we elected to reduce the C-7 ketone prior to epoxidation. The stereoselective reduction of cyclohexanones has been the subject of much debate.173s174 It is thought to be controlled by two opposing factors. Firstly sterically undemanding nucleo- philes show a strong preference for axial attack. A number of theories have been postulated to account for this observation. The torsional strain model of Felki~~l~~ and Anh176 provides one of the most widely accepted explanations with equatorial approach encountering severe torsional interactions in contrast to axial approach in which near perfect staggering occurs.An alternative stereoelectronic model has been proposed by Cie~lak'~~ and assumes an electron deficient transition state in which the a* of the developing bond is stabilized by hyperconjugative interactions with neighbouring syn-coplanar C-H bonds. This model assumes an order of a-donicity in which aC-H > aC-C and has been the subject of some ~riticism.~~~~~ 174 The second factor concerns more indirect steric interactions such as 1,3-diaxial interactions encountered in axial attack. With sterically demanding nucleophiles and axially substituted cyclohexanones these early destabilizing inter-actions can overturn the intrinsic bias for axial attack.178+179 To our surprise reduction of (217) with the bulky reagent lithium tri-tert-butoxyaiuminium hydride led exclusively to the C-7 p-alcohol (218) as the product of axial attack! In order to avoid the need for C(7)OH inversion we decided to explore alternative reducing agents.Reduction with sodium borohydride and cerium trichloride heptahydratelgO gave a mixture of diastereoisomeric diols (219) in which the C(7)OH was exclusively a-configured. The result is also somewhat surprising. The preferential 1,2- versus 1 ,Creduction of enones using the Luche reagentls0 is attributed to accelerated alkoxy- borane formation and Anh has predicted that axial attack will be favoured by these harder Additionally a high preference for axial 1,2-attack is observed in the reduction of cyclohexenones and has been attributed to both stereo-electronicls1 and torsional influences.lS2Bearing these factors in mind one might then have predicted a diequatorial product on reduction of (217) with the Luche reagent. Having achieved the desired stereocontrol at C-7 the enone moiety was reintroduced by allylic to give (220). Treatment of (220) with alkaline hydrogen peroxidelg3 afforded the expected a-epoxide (221) as the product of enone antiparallel attack.ls4 Regioselective C-2 reduction using aluminium-mercury amalgam then gave the hydroxy ketone (222). Extended reaction led to over-reduction to the unwanted NATURAL PRODUCT REPORTS 1993-S.V. LEY A. A. DENHOLM AND A. WOOD (220) i H,O, K,CO, MeOH (95 YO); ii Al Hg EtOH NaHCO, (95 %) __t (222) i NaBH, MgBr;Et,O NaHCO, THF (223) (67%); (224) (13%) Ph HO"' Me02C -Me02C -(223) i PPTS C,H, PhCHO 80 "C (95%) a Me0,C - Me02C - (215) (226) c@ -O2Me iii Me02C %-He-Me02C -(228) (227) i HO(CH,),OH p-TSA C,H, A (100 %) ;ii Ni(R) EtOH A (87 yo); iii LDA THF -78 "C then MoOPD -78 "C to r.t. (64%) /3-configured C( 1)OH isomer in agreement with Pradhan's rationalization of the stereochemical outcome of the dissolving metal reduction of cyclic ketones in the presence of proton donors. lE5 Stereoselective reduction of the C-1 carbonyl group of (222) seemed unlikely using standard methodology186 and necessi- tated some experimentation.It was discovered that sodium (2211 (223) H borohydride in tetrahydrofuran (THF) containing sodium bicarbonate and magnesium bromide caused reaction to occur selectively to afford the diaxial diol (223) along with a small amount of the unwanted isomer (224). The role of the magnesium cation in this reaction is crucial in blocking the a-face by complexation and so directing external reduction from the p-face. We believe this blocking protocol may be of more general use in other reactions where stereoselective reduction is required. Finally protection of the 1,3-diol was accomplished using benzaldehyde to give the benzylidene acetal (225). Having established a protocol for the introduction and protection of the required A ring syn-diol161 our attention was next directed towards C-19Me oxidation in order to construct the C-9 C-10 tetrahydrofuranacetal moiety of azadirachtin.4.3 A Remote Oxidation Approach The oxidation of unactivated C-H bonds is one of the most challenging tasks to have confronted organic chemistry. The Barton remote ~xidation'~' and subsequent modifications18* have found widespread use. In particular lead tetaacetatelBg has been used in the construction of cyclic ethers such as the nagilactoneslgO and ent-kaur- 16-ene.'" More recently tetra- valent selen~ranes'~~ and hypervalent iodine reagents such as iodosoben~enediacetate~~~ have been introduced. These re-agents offer advantages associated with a reduced risk of over- oxidation.Our initial remote oxidation studies were performed on a simplified decalin derivative (228) prepared as delineated below. Reductive removal of the C-7 dithiane was considered prudent in order to avoid competing S-oxidation. Oxidation of the ester enolate of (227) with MoOPD13' was highly stereoselective. This may be attributed to participation of the reactive conformer (229) in which the Z-enolate suffers 140 NATURAL PRODUCT REPORTS 1993 Me02C - p@ H OH 0 __t Me0,C 5 H&- Me02C - (228) i TPAP NMO 4 A sieves CH,Cl, r.t. (63 %); ii NaBH, MeOH -30 "C (82%) (233) PO' vii ___c Me0,C '-6 (240) (234) i NaBH, MeOH -30 "C 2 h (96%); ii TsCl Pyridine r-t. 96 h (65 'YO);iii LiOH MeOH:H,O (3 l) 'at.16 h (100%); iv Cs,CO, CH,CN 60 "C 16 h (28%); v LDA THF -78 "C then MoOPD -78 "C to r.t. (70%); vi TPAP NMO 4 A sieves CH,Cl, r.t. 16 h (73 %); vii NaBH, THF -10 "C 10 min (70%) electrophilic attack from its Re-face as a consequence of shielding by the C( 1)- 1,3-dioxolane. Remote oxidation of (228) using iodosobenzenediacetate gave a complex mixture of products including that derived from oxyl radical p-scission (230).193b The only cyclized material (23 1) was obtained in low yield and was over-oxidized at C-19.82 It was hoped that the epimeric hydroxyester (233) might give a more useful oxidation product. Inversion of configuration at C-11 was easily achieved by an oxidation/reduction sequence in which hydride was delivered from the least hindered side of the intermediate pyruvate.Unfortunately remote oxidation of (233) once more gave only fragmentation products. It seemed likely that free rotation about the C-9 C-11 bond was responsible for the poor performance of our remote ID4 The successful application of this trans- NATURAL PRODUCT REPORTS 1993-S. V. LEY A. A. DENHOLM AND A. WOOD 141 P O i Me02C '-6 Me02C '-6 (220) (240) i PhI(OAc), I, C6H6,A 4 h (240) (53%); (241) (35%) (240) (242) (243) i NaBH, THF -12 "C (61 Yo);ii AgOCOCF, Na,HPO, 4 A sieves CH,Cl, r.t. 1 h (20%) TBDMSO (244) (245) n OH I iii f CHo (248) i PhMe A 7 h (84%); ii AcOH:THF:H,O 3 I I 55 "C 16 h (85%); iii KOH MeOH r.t. 1 h (247) (57%); (248) (31 %) formation in conformationally restricted suggested that the implementation of such a strategy might prove beneficial in our case.The bridged hydroxylactone (234) seemed to offer %n ideal solution with a calculated C-9 distance of 2.84 A82 lying just outside the ideal 2.5-2.7 A range.Ig4 The synthesis of (234) proceeded as shown below. It is noteworthy that lactonization [(237) -,(238)] was achieved by a 6-exo-tet-cyclization. This inefficient reaction was necessi- tated by our failure to synthesize a /?-configured C(7)OH isomer of (235). Oxidation of (234) with iodosobenzenediacetate was suc- cessful giving the neopentylic iodide (240) along with the ketolactone (241) which could be recycled. Reduction of (240) with sodium borohydride was both chemo- and stereo-selective giving the hydroxylactone (242).To our disappointment attempted silver(1) mediated etherifi- cation caused A ring fragmentation to give (243) as a consequence of the trans-coplanar C-1 axial C-0 bond.IS6 Whilst modification of our approach to remove the potential for such a reaction was possible it was not considered expedient since C( l)OH inversion would ultimately be required. Hence we elected to explore an alternative approach based on C-10 angular hydroxymethylation.1s7 4.4 An Angular Hydroxymethylation Approach In order to explore C-9,C- 10 tetrahydrofuran annulation via a C-10 hydroxymethylation reaction the de novu synthesis of a new decalin lacking a C-10 methyl group was needed. This in turn required the synthesis of a new triene (244) and its evaluation in the IMDA reaction.The synthesis of (244) closely parallels that described for (207) starting from E-methyl 4- 0xopent-2-enoate~~~ and will not be described here.82 Our early analysis of the stereochemical course of the IMDA reaction suggested that triene (244) lacking a methyl substituent on the diene would favour the endo-cyclization mode A over the competing em-mode C to a greater extent than its original counterpart (207) because of reduced transannular interactions. In difference to our predictions thermolysis of (244) gave the cis-fused em-product (245) almost exclusively !82 Acidic hy- drolysis of (245) gave the keto aldehyde (246) which was subjected to base mediated intramolecular aldol condensation giving the decalins (247) and (248).The major product (247) was crystalline and allowed the unequivocal assignment of relative stereochemistry within this series through X-ray diffraction analysis. The reduced stereoselectivity observed for the intramolecular aldol condensation of (246) is interesting and is in direct contrast to that observed for (205). Clearly our initial appraisal of the factors affecting diasteroselectivity in the IMDA reaction was not sufficiently sophisticated and further experimentation was necessary to allow a more detailed analysis (see Section 4.6).Ig9 4.5 An Intact Hydroxymethylene Residue Approach Owing to the problems associated with the late introduction of the C- 10 hydroxymethylene residue a new strategy was defined in which latent functionality for this moiety was introduced prior to IMDA cyclization.lg99 2oo The decalin intermediate (249) now became our target from which tetrahydrofuran annulation would be possible via 5-exo-trig cyclization with a suitable hydroxymethyl anion synthetic equivalent. By analogy with earlier work B ring annulation was to be achieved by intramolecular aldol condensation. The 1,3-disposition of functionality at C-1 and C-19 threatened to be problematic under our aldol conditions and so the homologous system (250) was considered a better synthetic precursor. Retrosynthetic analysis of (250) generated the triene (25 1) in which the 1,3-diene component is constrained to planarity by annulation. This triene shows considerable homology with (207) and was expected to behave in a similar fashion on IMDA cyclization with the added advantage of increased reactivity caused by diene planarity.The synthesis of (251) differs from that developed for (207) in that etherification is performed prior to 1,3-diene construction. Coupling of the aldehyde (252)163 with an excess of the lithiated dithiane (198)15,.153 gave the alcohol (253) after a careful low temperature acid quench to prevent 1,3-silyl migration. Alkylation of the potassium alkoxide derived from (253) with methyl 2-(bromomethy1)propenoate (200)154 pro- ceeded in quantitative yield to give the intermediate ether (254) which was desilylated with hydrogen fluoride in the presence of pyridine buffer.201 Oxidation of the resulting alcohol (255) with catalytic TPAP79 was incomplete probably due to catalyst poisoning by the dithiane moiety.In contrast activated DMSO ~xidation'~ furnished the aldehyde (256) in good yield. Wadsworth-Horner-Emmons202olefination of (256) failed because of the highly basic conditions prescribed for this NATURAL PRODUCT REPORTS 1993 Literature precedent207 has shown the Tebbe complex2o8 to be a highly selective methylenating reagent for reactive carbonyl groups. This reagent functions as an in situ source of a Schrock- type titanium carbene2O9 and may be used efficiently at low temperature in the presence of Lewis 210 Methylen-ation of (258) was carried out between -40 "Cand -30 "C over 2 h in the presence of pyridine207" and the resulting triene (251) subjected to IMDA cyclization after only limited purification.As predicted Tebbe methylenation was selective for the more reactive s-cis constrained lactone moiety and the subsequent IMDA reaction was rapid reflecting the constrained nature of the 1,3-diene of (251). Once again analysis of the crude reaction mixture by NMR techniques suggested the major cycloadduct to be the cis-fused em-isomer (260). This assignment was confirmed by subsequent X-ray diffraction analysis of a crystalline derivative (264) prepared from the major cycloadduct. Once again our earlier rationale which attributed stereo- selection in the IMDA cyclization to steric influences of the bulky dithiane containing side chain proved incorrect.With a reasonable data set now available a revision of the IMDA cyclization model was made in the hope that a better understanding of this reaction might lead to the development of a new synthetic strategy. reaction. Recently Masamune Roush and co-~orkers~~~ followed by Rathke and Novak204 have reported a mild E-selective modification of this reaction. On subjecting the aldehyde (256) and a-diethoxyphosphono-y-butyrolactone205 to these conditions a readily separable mixture of geometric isomers (257) and (258) was obtained. The transformation of the em-alkylidene lactone (258) into triene (25 1) required the chemoselective methylenation of the y-butyrolactone carbonyl group. Alkylidenation of esters with Wittig reagents is not a synthetically viable operation due to their high basicity.206 OMe TBDMSO I Me0,C --d 4-" CO2Me (249)X = OP (250)X = CH20P .TBDMSO J:Me 1 ii OMe i (198) Bu"Li TMEDA -30 "C 90 min then (252) 5 min (54%); ii KH THF r.t. 17 min then methyl 2-(bromomethy1)propenoate(200) 30 min (88 YO); iii HF pyridine r.t. 16 h (77 Yo);iv DMSO (COCl), Et,N THF (70%); v a-diethoxyphosphono-y-butyrolactone,LiCl MeCN DIPEA added over 1.5 h 22 h (257) (13 %); (258) (42%) NATURAL PRODUCT REPORTS 1993-S. V. LEY A. A. DENHOLM AND A. WOOD 4.6 Factors Influencing Intramolecular Diels-Alder Cyclization Since its discovery some thirty years ago211 it has been well established that the IMDA reaction14' is less sensitive to secondary orbital interactions than its bimolecular counterpart.As a consequence Alder's rule142 is not adhered to unless the reaction is performed at low temperature or in the presence of Lewis acid 212 Tethering of the reactive components means that the reaction is largely dominated by structural factors such as the length and nature of the linking chain and the diene/dienophile substitution pattern. Based on theory,213 rate and stereochemical results2l5 it has been proposed that all Diels-Alder reactions with non-symmetrical components have concerted but asynchronous reaction pro- files.216 For the IMDA reaction of nonatrienes having donor substituents at C-2 and acceptors at C-8 clf (207) (244) and (25 l) the electronic preference for advanced peripheral bond formation is counteracted by entropic factors which favour internal bond formation giving a more or less synchronous reaction coordinate.216b 07 OMe -c" (258) C02Me 0-OMe 8 (260) The fact that IMDA cyclization of trienes (244) and (251) showed similar stereoselection strongly in favour of the cis-fused em-products (245) and (260) suggests comparable electronic properties and favoured transition states in these two examples. In contrast triene (207) shows reversed selectivity indicating different transition state properties in this case. The origin of this disparity lies in the presence of a C-3 methyl group on the conformationally flexible diene unit of (207). Molecular mechanics calculations indicate that A'.' strain present between this C-3 methyl group and the C-2 siloxyl group causes the diene to twist out of plane by as much as 20-30°.217Hence a more asynchronous reaction coordinate is encouraged the extreme case of which would represent a double Michael addition.218 By comparison the reduced A1v2 strain in (244) and the constraints imposed by furan annulation in (25 1) result in planar dienes with more synchronous reaction profiles.For the trienes under discussion the presence of a stereogenic centre in the linking tether means that the diene n-faces are diastereotopic and consequently a minimum of four competing transition states must be considered. lii Me02C *-0 + mk 1 (259) i Tebbe reagent py THF toluene 2 1 -40 "C to -15 "C 2 h; ii toluene 60 "C 5 h (1 8 %) 2 steps 0-OMe i Me0,C'w< 0 (264) (263) i p-TSA aq.acetone A 4.5h (44%) 1 :1 ;ii HO(CH,),OH p-TSA C,H, A (63 YO); iii 3,5-dinitrobenzoyl chloride pY r.t. 30 min (70%) NATURAL PRODUCT REPORTS 1993 A 1,3 n nA lS3 i,ii,iii -=PEt ____t OEt OFJaaoR x " PhMepSi p MeO2C '-6 X X = PhMe2Si i (PhMe,Si),Cu(CN)Li, -78 "C 2 h; ii CO, P(OEt), -78 "C to r.t. (265) 24 h; iii (MeO),SO, r.t. 34 h (80%) 3 steps EtO EtO PhMe2Si Ph Me,Si (267) i DIBAL THF -25 "C 12 h; ii p-TSA 2% water/acetone (77%) 2 steps; iii NaClO, 2-methyl-2-butene t-butanol/water 0 "C to r.t. 1.5 h; iv CH,N, (94%) 2 steps; v NBS PPh, (69%) Transition states C and D encounter highly unfavourable steric interactions involving the dithiane substituted side chain and are disfavoured in all three cases.For more synchronous reaction coordinates the presence of A1s3 219 and transannular interactions in the transition state A mean that it is less populated than B in which only developing pseudo- 1,3-diaxial interactions are encountered. Hence precursors having planar dienes e.g. (244) and (251) give predominantly cis- fused exo-cycloadducts via transition state B. For less synchro- nous reaction coordinates advanced peripheral bond formation exerts a torque about the newly forming bond.216b In the case of A this reduces the C-14-9 dihedral angle attenuating both A1,3 strain and transannular interactions. For B this twist asynchro- nicity increases the C-14-9 dihedral angle introducing A1*3 strain into the transition state.Hence for non-planar dienes cyclization mode A becomes prevalent. It was now clear that triene modification was necessary to promote efficient endo-cyclization. It was argued that an E-disposed C-l auxiliary X having sufficient steric demand would favour cyclization in this mode. Additionally the required transdiaxial relationship of X and the C-5 carbomethoxy group in the product (266) should allow both stereocontrolled reduction at C-1 and stereospecific introduction of oxygen at C-3. The requirement for bulk and latent hydroxyl functionality meant that a silicon derived residue e.g. PhMe,Si was an ideal choice. 4.7 A Silicon Directed IMDA Approach The construction of triene (265) required preparation of the /3-silyl-a-(bromomethy1)acrylate (267).Silyl cuprates undergo stereospecific syn-addition to triple NATURAL PRODUCT REPORTS 1993-S. V. LEY A. A. DENHOLM AND A. WOOD 145 TBDMSO PhMe2Si i di+ '=c" -C02Me HO (267) (253) + OMe OMe I TBDMSO ii,iii rd; -G< PhMe2Siyo (2,3) PhMe2siY C02Me (272) O C02Me vk =-OVMe + S=A S PhMe2siYo C02Me C02Me PhMe2Siwo (270) (274) (253) KH r.t. 60 min then (267) 0 "C to r.t. 30 min (272) (60%); (271) (18 YO);ii HF pyridine MeCN r.t. to 35 "C 34 h (85 YO);iii DMSO (COCl), Et,N (73 Yo);iv a-diethoxyphosphono-y-butyrolactone,LiC1 DMF DIPEA slow addition (270) (34YO); (274) (13Yo);(273) (49 Yo) 0-7 OMe i -PhMe2Sivo 0-OMe 0-OMe I (275) (276) i Tebbe reagent cat.py THF:toluene; ii DIPEA hydroquinone toluene 80 "C 4 h (21-57%) (275):(276) 5:2 bonds to yield configurationally stable vinyl cuprates220 which The substituted acrylate (269) was transformed into (267) can be trapped with a variety of electrophiles.221 Additionally under standard conditions as summarized below. a$-disubstituted acrylates have been assembled from propio- The a-alkylidene lactone (270) was assembled in an analogous lates using a three component coupling sequence.222 Although manner to compound (258). Alkylation of (253) with the silicon no reports on the use of silyl cuprates with this methodology substituted acrylate (267) was complicated by competing SN' have appeared these species do add regioselectively to the displacement to give (271) along with the required (272).terminus of non-conjugated alkynes.221v223 Unfortunately Modified Wadsworth-Horner-Emmons coupling of the al- treatment of methyl propiolate with (PhMe,Si),Cu(CN)Li dehyde (273) proved problematic and required extensive under a variety of conditions failed to give the desired reaction. optimization.200 We next decided to explore the silylcupration of the propion- Preparation of the triene (265) was achieved as before by aldehyde acetal (268). The related stannylation of propion-chemoselective methylenation using the Tebbe reagent.20s In aldehyde acetals has been reported recently.224 The reaction of order to minimize dienol ether decomposition (265) was used (268) with (PhMe,Si),Cu(CN)Li was successful giving an directly in the IMDA reaction.Warming the triene (265) in intermediate vinyl cuprate which was configurationally stable toluene containing hydroquinone as an anti-oxidant and Hunigs above 0°C and could be carboxylated using the method of base as a proton scavenger gave the trans-fused endu-Capella et ~21.~~~ to give (269) following methylation. cycloadduct (275) and the cis-fused exo-cycloadduct (276) in 11 NPR 10 NATURAL PRODUCT REPORTS 1993 07 OMe i p-TSA 0.5% aq. MeCN 55 OC 5.5 h then 6% aq. MeCN r.t. 2 h (278) (45%); (279) (8%); (280) (10%); ii p-TSA 0.5 to 5.7% aq. MeCN 53 "Cto r.t. 6.2 h (59%) 0-7 OMe PhMe2siYo moderate yield. The stereochemical outcome of the IMDA cyclization was very pleasing since it clearly demonstrated the endo-selectivity imported by the sterically demanding dimethyl- (pheny1)silyl moiety.The relative stereochemistry of (275) and (276) was established by detailed NMR studies and also by X-ray diffraction analysis of a later derivative (vide infra). In addition to the Diels-Alder cycloadducts a third minor product the furan (277) was also isolated following thermolysis of (265).225 This unexpected by-product may arise by an intramolecular ene reaction226 of (265) followed by a [1,5]-H shift. Intramolecular aldol cyclization of (275) proceeded with exclusive a-attack of the A ring enol to give the trans-decalins (278) (279) and (280). The /I-configured C(9)OH isomers (278) and (280) predominated reflecting the influence of the develop- ing B ring 1,3-diaxial interactions in controlling transition state population.The methyl acetal (280) could be converted in reasonable yield to the hemiacetal (278) which was crystalline and allowed unequivocal stereochemical assignment by X-ray analysis. At this point it is pertinent to emphasize that in going from the triene (265) to (278) we have constructed three C-C bonds and five stereogenic centres with the correct relative configuration for azadirachtin in only three steps. 4.8 The Dimethyl(pheny1)silyl Group as a Stereocontrol Element for Intramolecular Diels-Alder Reactions The capacity of the dimethyl(pheny1)silyl auxiliary to function as an endo-directing group in the IMDA cyclization of (265) prompted us to explore its influence on our earlier examples.The requisite trienes (281) and (282) were prepared using standard methodology. lg9 The results of their cyclization are summarized in the table below together with the previously described systems. In all cases the dimethyl(pheny1)silyl group caused increased endo-selectivity . 4.9 Elaboration of an &Ring Syn-1,3-diolfor Total Synthesis Studies Elaboration of (278) required initial opening of the hemiacetal moiety which was achieved by prolonged treatment with NATURAL PRODUCT REPORTS 1993-4. V. LEY A. A. DENHOLM AND A. WOOD P'O OP2 P'O P'O xhcoc02Me Endo Ex0 ~~ Triene Entry Substitution Conditions Endo Ex0 TBDMSO (244) 7hr 1 X=H 111% <1 10 P,P=(CH& toluene vi I (281) I 14hr 1 3.4 2 X = PhMe2Si xwo C02Me P=Me ~~ 5hr (2511 3 60°C 1 :8 X=H toluene -X 2.4 1 bco 4 X = PhMe2Si I toluene C02Me 85c TBDMSO 5 135% 2.1 1 X=H I DMSO vz (282) 3hr 6 110% >12 1 X = PhMe2Si toluene OH OPiv i PhMe2Si"' PhMe2Si'" -Me02C -0 h0,C -0 (278) i Pivaloyl chloride py DMAP 45 "C 3 d (81 %) pivaloyl chloride.The extended reaction time needed for this exclusively from the p-face to give the a-configured C-1 alcohol interconversion reflects the low concentration of hydroxy (287) along with a small amount of the saponified material ketone (283) present under equilibrium conditions. (288). Although sodium borohydride does not normally reduce Treatment of the isomeric aldol (279) with pivaloyl chloride esters alko~y~~' and hydroxyboranes228 are known to be more under the same conditions also effected hemiacetal ring opening reactive and in this case intramolecular hydride transfer via an although concomitant C(9)OH esterification occurred to a eight membered cyclic transition state favoured by short B-0 lesser extent due to destabilizing 173-diaxial interactions of this and B-H bond lengths and conformational rigidity,229 cannot axial group with the C-7 dithiane be ignored.Reduction of (284) with sodium borohydride occurred Gratifyingly it proved possible to convert both reduction NATURAL PRODUCT REPORTS 1993 __t :H a Me0,c -0 (279) (285) i Pivaloyl chloride py DMAP 45 "C 36 h (285) (59 %); (286) (22 %) OPiv I OPiv PhMe,Si ''' PhMe,Si"* n Me0,C O-0 Me0,C '-0 (284) (287)R=Piv (288) R=H i NaBH, MeOH THF r.t.90 min (287) (82%); (288) (14%) OPiv OPiv rk PhMesi"' Me0,C -0 &a iiii OPiv OPiv OPiv PhMe2Si'" (289) 1 MeI CaCO, 1 1 H,GMeCN A 7 h (98 %); ii DBU r.t. 135 min (100%); iii PhCOCN Et,N 2 5 CH,Cl,-MeCN 0 "C 45 min (79%); iv MeI CaCO, 1 1 H,O-MeCN A 7 h (100%) products into a common enone intermediate (289). The who have shown the silyl group to be a masked hydroxy equatorial C(9)OH group of (288) proved resistant to p-equivalent. The silyl Baeyer-Villiger oxidation of (289) was elimination and so a route involving selectiveesterification with performed under modified Fleming conditions200to give the benzoyl cyanide and subsequent base mediated elimination was diaxial diol(290) which was readily protected as the benzylidene adopted.230 acetal (291).With the enone (289) now available the stage was set for At this point it was considered expedient to resolve the unmasking the C-3hydroxyl group by oxidative cleavage of the racemic compound (291). Reduction with L-Sele~tride,~ carbon-silicon bond. This stereospecific transformation has occurred exclusively by equatorial 1,2-addition to afford the 231 K~rnada,~~~ allylic alcohol (292) in high yield. The racemic alcohol (292) been developed by Fleming,169-and Tama~~~~ NATURAL PRODUCT REPORTS 1993-S. V. LEY A. A. DENHOLM AND A. WOOD OPiv OPiv OPiv (289) (290) (2911 i Hg(O,CCF,), 1 1 HOAc TFA r.t.10 min then CH,CO,H 0 "C to r.t. 2 h (85 YO);ii PhCHO PPTS C,H, A 24 h (83 YO) OPiv OPiv OPiv I li ii,iii OPiv OPiv R=H iv (-)-(295) iv K(+)-(295)R=H R=TBDMS (+)-(296)R=TBDMS (-)-(296) i (-)-(1S,4R) Camphanic acid chloride py DMAP r.t. 21 h (293) (43 %); (294) (44 %); ii K,CO, MeOH 11 h; iii Pivaloyl chloride py 45 min (+)-(295) (95 YO);(-)-(295) (90 %) 2 steps; iv TBSOTf 2,6-lutidene 0 "C 25 min (96 %) was then transformed into the diastereoisomeric camphanate esters (293) and (294) which were readily separable by HPLC. Methanolysis of the camphanates was accompanied by partial pivalate ester saponification and necessitated re-esterification of the crude product mixture to allow isolation of the enantiomerically pure allylic alcohols (+)-(295) and (-)-(295).These were converted into the antipodal silyl ethers (+)-(296) and (-)-(296) at which point the assignment of absolute configuration was possible by X-ray diffraction analysis which showed the dextrorotatory material to have the 3(R) configu-ration now known to be correct for the natural 4.10 Tetrahydrofuran Annulation Construction of the 'northern ' tetrahydrofuranacetal residue of azadirachtin first required the degradation of the C-10 angular side chain of (296) by one carbon atom.200q225 Clark have and Heath~ock~~~ shown that ozone reacts chemo-selectively with enol ethers in the presence of other double bonds provided care is taken to avoid over-oxidation. Fur- thermore indicator dyes with intermediate reactivity towards ozone have been used to control the chemoselective ozonolysis of 01efins.~~' These procedures seemed to offer an ideal method for our required one carbon degradation.Saponification of (+)-(296) and oxidation of the resulting primary alcohol (297) gave the aldehyde (298). Silyl enol ether formationls0 and ozonolysis in the presence of Sudan Red 7B dye then gave the desired degradation product (299) in good yield. With the decalin intermediate (299) in hand our attention was turned to the final steps in the synthesis. Our analysis led to the development of new methodology for tetrahydro-furanacetal annulation which relied upon a novel 6 -,5 membered ring contraction 225 The selection of an acyl anion synthetic equivalent compatible NATURAL PRODUCT REPORTS 1993 OR 0 (+)-(296) R=Piv (+)-(297) R=H i LiOH 10% aq.EtOH 60 "C 5 h then CH,N, (91 YO);ii Periodinane py CH,Cl, r.t. 25 min (90%); iii TBSOTf Et,N -15 "C to -5 "C 2.5 h; iv O,/O, Sudan Red 7B -78 "C then PPh, -78 "C to r.t. 12 h (85%) C0,Me &: H H H H 0 Ph i,ii -"'OTBDMS (299) (300) i Zn(BH,), -10 "C THF 3 h; ii Cyanoacetic acid TsCl py2,' 20 min (98 %) with intramolecular Michael addition and a-ketolactone forma- tion required careful consideration. A large number of carbonyl anion equivalents These normally employ groups capable of stabilizing an adjacent carbanion which can be transformed into a carbonyl function at a later stage. The number of synthetic equivalents for the pyruvate anion are however limited because of the sensitivity of the ultimate dicarbonyl species.The cyanoacetate residue is particularly useful in this context since it possesses an anion stabilizing group with low steric demand which may be transformed under mild conditions to a carbonyl group. Consequently the C( 19)OH cyanoacetate ester (300)238 was chosen for our studies and prepared as shown. The B ring enone was prepared by desilylation of (300) and oxidation of the resulting allylic alcohol (301) with PDC.80 Treatment of (302) with lithium hexamethyldisilazane (LHMDS) resulted in rapid 6-exo-trig cyclization to give the a-cyanolactone (303). Surprisingly the oxidation of a-cyanoesters to a-ketoesters has found only scant application in organic synthesis despite the similarity of this transformation to the oxidation of 1,3-dicarbonyl compounds.240 The reactivity of the intermediate a-ketolactone derived from (303) necessitated a-hydroxylation under neutral conditions in a non-nucleo-philic environment.Dimethyl dioxirane140 is an efficient and mild reagent for the epoxidation of enol and silyl enol ethersz4 under neutral conditions without causing rearrange- ment of the highly acid sensitive products. Pleasingly oxidation of (303) with dimethyl dioxirane and treatment of the resulting crude cyanohydrin with a catalytic amount of PPTS in methanol provided the trio1 (304) as a mixture of C-11 epimers in excellent yield. X-ray diffraction analysis of the crystalline 11(S) isomer allowed unambiguous assignment of struc-ture.200.225 The degradation of azadirachtin had made relatively large quantities of decalin fragments available at this point in time and so it was decided to use a protection strategy for (304) which was identical to that used for the natural product derived decalins (see Section 2.8).The preparation of a fully protected decalin fragment (305) of azadirachtin was now complete. This compound may find use in a total synthesis of the natural product which would initially involve the coupling of left and right hand units. These efforts are assisted by the availability of relatively large quantities of both fragments. 5 Structur*Act ivity ReIationships While in Section 1.5 we have commented upon the biological screening of azadirachtin itself by various groups relatively little apart from our own studies has been reported upon structure-activity relationships.We have undertaken much of our work to make designed and specific chemical modifications to the azadirachtin skeleton to investigate the resulting effects on biological activity. It is impossible in this review to comment in detail on these studies ;nevertheless certain structural trends are now beginning to emerge which could lead to the design of simple structural mimics of azadirachtin. To give an indication of these data larvae of the African leafworm Spodoptera littoralis (Boisduval) were used to assess the antifeedant activity of the compounds in a choice bioassay. Larvae 24-30 h into the final stadium were placed individually in Petri dishes (8.5 cm diam.) with two glass-fibre discs (Whatman GF/A NATURAL PRODUCT REPORTS 1993-S.V. LEY A. A. DENHOLM AND A. WOOD 0 0 Ph ii c &' H f Me02C -6 (300) R=TBS c(301) R=H Ph iv,v J (304) (303) I'BAF 4 A sieves THF r.t. 4 h (93 %); ii PDC 4 A sieves CH,Cl, r.t. 2.75 h (88%); iii LHMDS THF 0 "C to r.t. 70 min (100%); iv Dimethyl dioxirane acetone 0 "C 22 min; v PPTS MeOH 5.5 h (70%) 2 steps C0,Me C02Me .-Table 1Antifeedant Index [(C-T)/(C+T)]YOof test compounds [mean f(sem)]. Concentration (p.p.m.) applied to discs Compound" 10 1 HO'" (1) 100 (0.00) 98.8 (1.11) (6) 54 (15.1) 72 (12.7) (10) -97 (3.9) (17) 98 (1.4) 81 (3.4) (304) (39) -100 (0.0) (40) 100 (0.0) 79 (10.6) (42) 47 (15.0) 49 (9.6) ii 1 (45) 44 (21.4) 50 (13.2) CO,Me OBn (46) 21 (14.0) 28 (19.0) (47) 25 (7.7) 16.6 (19.2) Ph (49) 52 (13.0) 66 (8.3) (50) 44 (17.0) 16 (12.0) (52) 24 (22.6) 37 (32.7) + (53) 100 (0.0) 100 (0.0) 0.1' 0.1' (54) 92 (3.2) 55 (12.7) (55) 97 (2.0) 75 (8.1) (66) 23 (12.3) 21 (6.0) (80) 63 (12.8) 61 (13.1) (100) -96 (0.1) (305) (306) (101) 16 (13.2) 22 (15.2) i PhCHO PPTS C,H, A 4.6 h (74%); ii BnBr Ag,O DMF r.t.(104) 64 (8.8) 41 (15.2) (105) 100 (0.0) 29 (13.8) 3.5 h (305) (61 Yo);(306) (19%) (1 06) 31 (10.8) 33 (6.9) (121) 69.1 (2.24) 54.8 (7.25) (122) 100 (0.0) 98.8 (1.11) 15 (28.8) 30 (25.6) 2.1 cm diam.).The discs were made palatable by the addition (307) (308) 100 (0.0) 100 (0.0) of a 100 pl aliquot of 50 mM sucrose and allowed to dry. One (309) 100 (0.0) 98 (1.6) disc acted as a control and the other was treated with 100 pl of (310) 95 (2.3) 66 (12.6) a solution containing the test compound at either 1 p.p.m. or (31 1) 100 (0.0) 26 (14.0) 10 p.p.m. The dried discs were weighed before being presented (312) 46 (12.1) 35 (7.4) to the larvae. The bioassay was terminated after the larvae had a = 15-20 replications. eaten approximately 50% of one of the discs or after 24 h if larvae failed to eat 50% of either disc. The discs were reweighed and the Antifeedant Index calculated where C and T represent the mass eaten of the control and treatment disc conditions are used.However against the African leafworm in respectively. A potent antifeedant would be represented by a a choice test as described above one can say that the value greater than 75% at the lower concentrations. hydroxyfuranacetal moiety is clearly important for high levels Table 1 shows brief data for only one insect species and 31 of potency. We believe that the stereochemistry at C-7 is crucial screened compounds. One must be very careful not to make and that the bridging oxygen substituent at C-6 may play some sweeping generalizations when different insects and feeding role. The precise spatial and electrostatic requirements of all NATURAL PRODUCT REPORTS 1993 n TBDMSO svs $1 0 I OMe (PhMe2Si)2Cu(CN)Li2 1 , --< OEt OEt I C02Me Ph Degradation (49) OH (53) OH OH OH (45) "L(101) (47) NATURAL PRODUCT REPORTS 1993-S.V. LEY A. A. DENHOLM AND A. WOOD I53 (309) OH OH AcO“’ (312) the various oxygen substituents need more detailed studies to define a clearer molecular picture of the interactions and recognition phenomena. These studies are well underway. 6 Conclusions It is very clear from previous chapters that the Indian neem tree and in particular the active component azadirachtin provide exciting new opportunities for environmentally safe control of insect populations. Although continued synthetic and biological effort will be necessary to realize the full potential of these novel behaviour modifying chemicals we can look forward to intense scientific interest over the next few years.Our synthetic efforts and those of others are now strongly directed towards completing the total synthesis of azadirachtin. In our work once methodology has been established to introduce the crucial C-8-C-14 bond our accumulated knowl- edge on the chemistry of azadirachtin will allow the definition of realistic ‘end-game ’ strategies supported by plentiful supplies of relay material. In reality it is likely that future crop protection will rely upon the synergistic interactions of several insect control techniques. Insect antifeedants may provide one component of this integrated approach. Present work in the antifeedant area is concerned with an increased understanding of their mode of action at a molecular level and the application of this knowledge to the development of highly species-specific substances for the control of pest insects.New ways will be sought to combat insects which continue to present widespread problems particularly in the third world through resistance or immunity to currently available pesticides. Antifeedants offer the prospect of a new generation of insect control chemicals which will not pollute our environment poison our food or harm beneficial species. In an era of increased environmental awareness we have an important opportunity to contribute to the safer management of our planet’s resources. During the course of our synthetic programme we have had opportunity to assess a wide range of azadirachtin-derived compounds and we have built up a detailed SAR picture.This provides an understanding of the conformational electronic and lipophilic requirements for activity which may be used to design simpler compounds capable of mimicking the mode of action of azadirachtin. 7 References 1 J. A. Pickett Chem. Bri. 1988 24 137. 2 T. A. van Beek and Ae. De Groot Rec. Trav. Chim. Pays-Bas 1986 105 513. 3 (a) R. H. Gonzalez E. J. Buyckx and L. Brader ‘Prospects for New Control Practices of Agricultural Pests in Developing Countries’ in ‘Natural Products and the Protection of Plants’ ed. G. B. Marini-Bettolo Pontlficiae Academiae Scientiarium Scripta Varia 1977,41,687; (6) H. Rembold Trans.Bose Res. Inst. 1980 43 53; (c) W. J. Lewis ‘Semiochemicals Their Role with Changing Approaches to Pest Control’ Chapter 1 in ‘Semio- chemicals Their Role in Pest Control’ ed. D. A. Norlund R. L. Jones and W. J. Lewis 1981 John Wiley New York p. 3. 4 W. S. Bowers ‘The Search for Fourth-generation Pesticides’ Chapter 13 in ‘Current Themes in Tropical Science ’ Volume 2 ed. D. L. Whitehead and W. S. Bowers 1983 Pergamon Press Oxford p. 47. 5 D. J. Warthen and E. D. Morgan ‘Insect Feeding Deterrents’ Chapter 2 in Handbook of Natural Pesticides Vol. VI ed. E. D. Morgan and N. B. Mandava 1990 CRC Press Boca Raton p. 23. 6 (a)C. G. Jones and R. D. Firn Phil. Trans. R. SOC.Lond. B 1991 333,273; (b)D. H. Wdiams M. J. Stone P. R. Hanck and S. K.Rahman J. Nut. Prod. 1989 52 1189. 7 K. Munakata Pure Appl. Chem. 1975 42 57. 8 S. V. Ley and P. L. Toogood Chem. Bri. 1990 26 31. 9 J. H. Butterworth and E. D. Morgan J. Chem. Soc. Chem. Commun. 1968 23. 10 P. S. Jones S. V. Ley E. D. Morgan and D. Santafianos ‘The Chemistry of the Neem Tree’ in ‘ 1988 Focus on Phytochemical Pesticides. Volume 1 The Neem Tree’ ed. M. Jacobson 1989 C.R.C. Press Inc. p. 19. 11 M. Jacobson ‘The Neem Tree Natural Resistance Par Ex-cellence’ in ‘Natural Resistance of Plants to Pests Roles of Allelochemicals’ ed. M. B. Green and P. A. Hedin 1986 ACS Symposium Series 296 American Chemical Society Washington DC p. 220. 12 ‘Natural Pesticides from the Neem Tree (Azadirachta indica A. Juss)’ ed. H. Schmutterer K.R. S. Ascher and H. Rembold 1981 GTZ Press FRG. 13 ‘Natural Pesticides from the Neem Tree (Azadirachta indica A. Juss) and Other Tropical Species’ ed. H. Schmutterer and K. R. S. Ascher 1984 GTZ Press FRG. 14 ‘Natural Pesticides from the Neem Tree (Azadirachta indica A. Juss) and Other Tropical Species’ ed. H. Schmutterer and K. R. S. Ascher 1981 GTZ Press FRG. 15 ‘Neem’s Potential in Pest Management Programs Proceedings of the USDA Neem Workshop’ ed. J. C. Locke and R. H. Lawson United States Department of Agriculture Agricultural Research Service ARS-86 1990 p. 136. 16 ‘Neem (Azadirachta indica) for Pest Control and Rural De-velopment in Asia and the Pacific’ ed. S. Ahmed Special session on neem from the 17th Pacific Science Congress 1991 in press.17 ‘Neem A Tree for Solving Global Problems ’ National Academy Press Washington DC 1992 p. 28. 18 M. G. Jotwani and K. P. Scrisvastana in ‘Natural Pesticides from the Neem Tree (Azadirachta indica A. Jus) and Other Tropical Species’ ed. H. Schmutterer and K. R. S. Ascher 1984 GTZ Press FRG p. 43. 19 S. Radwanski and G. E. Wickens ‘Vegetative Fallows and Po- tential Value of the Neem Tree (Azadirachta indica) in the Tropics’ Econ. Bat. 1981 35 398. 20 (a) S. Radwanski ‘Neem Tree. 2 Uses and Potential Uses’ World Crops Livestock 1977 29 11I; (b) S. Radwanski ‘Neem Tree. 3 Further Uses and Potential Uses’ World Crops Livestock 1977 29 167; (c) W. H. Lewis and M. P. F. Elvin-Lewis ‘Neem (Azadirachta indica) Cultivated in Haiti ’ Econ.Bot. 1983 37 69. 21 (a)K. M. Nadkarni and A. K. Nadkarni Indian Materia Medica vol. 1 3rd edition 1954 Popular Book Depot Bombay India p. 776; (6) K. L. Dey and W. Mair ‘The Indigenous Drugs of India ’ 2nd edition Pama Primlane Chronica Botanica 1973 New Delhi India 186. 22 M. Volkonsky Achs. Inst. Pasteur Alger. 1937 15 427. 23 D. Arigoni 0.Jeger and L. Ruzicka Helv. Chim. Acta. 1955,38 222. 24 (a) S. Siddiqui ‘A Note on the Isolation of Three New Bitter Principles from the Neem Oil’ Curr. Sci. 1942 11 278; (b) S. Siddiqui T. Mahmood B. S. Siddiqui and S. Faizi Phyto-chemistry 1986 25 2183; (c) M. Harris R. Henderson R. McCrindle K. H. Overton and D. W. Turner Tetrahedron 1968 24 1517. 25 (a)E. J. Corey and R. W. Hahl Tetrahedron Lett.1989,30,3023. (b) D. Lavie and M. K. Jain J. Chem. SOC. Chem. Commun. 1967 278. 26 G. Podder and S. B. Mahoto Heterocycles 1985 23 2321. 27 C. R. Henderson R. McCrindle A. Malera and K. H. Overton Tetrahedron 1968 24 1525. 28 C. Mitra J. Sci. Ind. Res. India 1956 15B 425. 29 W. Kraus M. Bokel A. Bruhn R. Cramer I. Klaiber A. Klenck G. Nagl H. Pohnl J. Sadlo and B. Vogler Tetrahedron 1987 43 2817. 30 H. Rembold ‘Isomeric Azadirachtins and their Mode of Action’ in ‘ 1988 Focus on Phytochemical Pesticides. Volume 1 The Neem Tree’ ed. J. Jacobson 1989 C.R.C. Press Inc. p. 47. 31 H. Rembold H. Forster and J. Sonnenbichler 2. Naturforsch Teil C 1987 42 4. 32 A. Klenk M. Bokel and W. Kraus J Chem. SOC. Chem. Commun. 1986 523. 33 H.Rembold G. K. Sharma Ch. Czoppelt and H. Schmutter Z. Ang. Ent. 1982 93 12. 34 J. N. Bilton H. B. Broughton P. S. Jones S. V. Ley Z. Lidert E. D. Morgan H. S. Rzepa R. N. Sheppard A. M. Z. Slawin and D. J. Williams Tetrahedron 1987 43 2805. 35 (a) I. Kubo T. Matsumoto and A. Matsumoto Tetrahedron Lett. 1984 25 4729; (6) I. Kubo A. Matsumoto and T. Matsumoto Tetrahedron 1986 42 489. 36 W. Kraus ‘Constituents of Neem and Related Species. A Revised Structure of Azadirachtin’ in ‘New Trends in Natural Product Chemistry (Studies in Organic Chemistry) ’ Volume 26 ed. A-u. Rahman and P. W. Le Quesne 1986 Elsevier Amsterdam 237. 37 T. R. Govindachari G. Sandhya and S. P. Ganeshraj Chroma-tographia 1991 31 303. 38 W. Kraus M. Bokel A. Klenk and H.Pohnl Tetrahedron Lett. 1985 26 6435. 39 A. V. B. Sankaram M. Marthandamurthi K. Bhaskaraiah M. Subrahmanyam N. Sultana H. C. Sharma and K. Leischner ‘ 16th International Symposium on the Chemistry of Natural Products’ IUPAC Japan Kyoto 1988 Abstract Papers No. S-1539 p. 41. 40 V. K. Ermel H.-0. Kalinowski and H. Schmutterer J. Appl. Ent. 1991 112 512. 41 H. Chenault and S. J. Danishefsky J. Org. Chem. 1989,54,4249. 42 J. D. Warthen Jr. ‘Azadirachta indica A Source of Insect Feeding Inhibitors and Growth Regulators’ U.S. Dep. Agric. Rev. Man. ARM-Ne-4 1979. 43 (a) S. V. Ley D. Santafianos W. M. Blaney and M. S. J. Sim- monds Tetrahedron Lett. 1987 28 221; (b) S. V. Ley J. C. Anderson W. M. Blaney Z. Lidert E. D. Morgan N. G. Robin- son D.Santafianos M. s.J. Simmonds and P. L. Toogood Tetrahedron Lett. 1989 30 5175; (c) W. M. Blaney M. S. J. Simmonds S. V. Ley J. C. Anderson and P. L. Toogood Ento-mol. exp. appl. 1990 55 149. 44 H. Schmutterer and H. Rembold 2. Angew. Entomol. 1980 89 179. 45 (a)R. B. Yamasaki and J. A. Klocke J.Agric. Food Chem. 1987 35 467; (b) M. S. J. Simmonds W. M. Blaney S. V. Ley J. C. Anderson and P. L. Toogood Entomol. exp. appl. 1990,55 169. 46 M. Jacobson ‘Pharmacology and Toxicity of Neem’ in ‘1988 Focus on Phytochemical Pesticides vol. 1 The Neem Tree’ ed. J. Jacobson 1989 C.R.C. Press Inc. p. 133. 47 For a case study in the use of modern structure-determination techniques from the viewpoint of azadirachtin see D. A. H. Taylor Tetrahedron 1987 43 2779.48 D. Lavie M. K. Jain and S. R. Shpan-Gabrielith J. Chem. SOC. Chem. Commun. 1967 910. 49 J. H. Butterworth E. D. Morgan and G. R. Percy J.Chem. Soc. Perkin Trans. I 1972 2445. 50 J. H. Butterworth and E. D. Morgan J. Insect Physiol. 1971 17 969. NATURAL PRODUCT REPORTS 1993 51 P. R. Zanno I. Muira K. Nakanishi and D. Elder J. Am. Chem. SOC.,1975 97,1975. 52 V. P. Gullo I. Muira K. Nakanishi A. F. Cameron J. D. Con- nolly F. D. Duncanson A. E. Harding and D. A. H. Taylor J. Chem. SOC. Chem. Commun. 1975 969. 53 J. N. Bilton H. B. Broughton S. V. Ley Z. Lidert E. D. Mor- gan H. S. Rzepa R. N. Sheppard A. M. Z. Slawin and D. J. Williams J. Chem. SOC. Chem. Commun. 1985 969. 54 H. B. Broughton S. V. Ley Z. Lidert A. M. Z. Slawin D.J. Williams and E. D. Morgan J. Chem. SOC. Chem. Commun. 1985 46. 55 D. Gagnaire and M. Vincenden J. Chem. SOC. Chem. Commun. 1977 509. 56 J. Polonsky Z. Baskevitch H. E. Gottlieb E. W. Hagaman and E. Wenkert J. Org. Chem. 1975 40 2499. 57 J. N. Bilton P. S. Jones S. V. Ley N. G. Robinson and R. N. Sheppard Tetrahedron Lett. 1988 29 1849. 58 C. J. Turner M. S. Tempesta R. B. Taylor M. G. Zagorski J. C. Termini D. R. Schroeder and K. Nakanishi Tetrahedron 1987 43 2789. 59 S. V. Ley P. J. Lovell A. M. Z. Slawin S. C. Smith D. J. Williams and A. Wood Tetrahedron in press. 60 (a) S. V. Ley ‘Synthesis of Insect Antifeedants’ in ‘Pesticide Science and Biotechnology’ ed. R. Greenhalgh and T. R. Roberts 1987; (b) P. L. Toogood PhD Thesis University of London 1989.61 (a) H. Vorbruggen and K. Krolikiewicz Angew. Chem. 1975,87 417; (b)G. Simchen and W. Kober Synthesis 1976 259. 62 S. V. Ley P. J. Lovell S. C. Smith and A. Wood Tetrahedron Lett. 1991 32 6183. 63 S. V. Ley J. C. Anderson W. M. Blaney E. D. Morgan R. N. Sheppard M. S. J. Simmonds A. M. Z. Slawin S. C. Smith and A. Wood Tetrahedron 1991 47 923 1. 64 D. Neuhaus R. N. Sheppard and I. R. C. Bick J. Am. Chem. SOC.,1983 105 5996. 65 (a) J. A. Klocke and R. B. Yamasaki USP 5,001,149 1991 ; (b) Z. Lidert USP 4,943,434 1990. 66 S. V. Ley J. C. Anderson W. M. Blaney Z. Lidert E. D. Mor- gan N. G. Robinson and M. S. J. Simmonds Tetrahedron Lett. 1988 29 5433. 67 J. C. Anderson PhD Thesis University of London 1990. 68 F.Sweet and R. K. Brown Can. J. Chem. 1968 46 707. 69 (a)J. Theim H. Karl and J. Schwentner Synthesis 1978 696; (b) S-H. Chen R. F. Horvath J. Joglar M. J. Fisher and S. J. Danishefsky J. Org. Chem. 1991 56 5834. 70 A. R. Chamberlin and R. L. Mulholland Jr. Tetrahedron 1984 40 2297. 71 (a)T. Sato J. Otera and H. Nozaki SYNLETT 1991,903; (b)T. Sato J. Otera and H. Nozaki Tetrahedron 1989 45 1209. 72 S. V. Ley ‘Insect Antifeedants’ in ‘Pesticide Chemistry’ ed. H. Frehse VCH New York 1990 p. 97. Proceedings of the Seventh International Congress of Pesticide Chemistry Hamburg 1990. 73 M. Iwata and H. Ohrai Bull. Chem. SOC. Jpn. 1981 54 2837. 74 E. d’Incan S. Sibille and J. Perichon Tetrahedron Lett. 1986,27 4175. 75 T. Mukaiyama Angew. Chem.Int. Ed. Engl. 1979 18 707. 76 (a) R. H. Cornforth J. W. Cornforth and G. Popjak Tetra-hedron 1972 18 1351; (b) G. I. Poos G.E. Arth R. E. Beyler and L. H. Sarett J. Am. Chem. SOC. 1953 75 422. 77 P. Sundararaman and W. Herz J. Org. Chem. 1977 42 813. 78 (a) A. J. Mancuso and D. Swern Synthesis 1981 165; (b)T. T. Tidwell Synthesis 1990 857. 79 (a) W. P. Griffith S. V. Ley G. P. Whitcombe and A. D. White J. Chem. SOC. Chem. Commun. 1987 1625; (b)W. P. Griffith and S. V. Ley Aldrichim. Acta 1990 23 13. 80 (a) W. M. Coates and J. R. Corrigan Chem. Ind. 1969 1594; (6) E. J. Corey and G. Schmidt Tetrahedron Lett. 1979 20 399. 8 1 Chromate ester formation may become kinetically significant for hindered systems see (a) J. Roceck F. H. Westheimer A.Eschenmoser L. Moldovanyi and J. Schreiber Helv. Chim. Acta 1962 45 2554; (b)R. Baker and T. J. Mason J. Chem. SOC. (B) 1972,988; (c) R. Baker and T. J. Mason Tetrahedron Lett. 1969 5013. 82 S. C. Smith PhD Thesis University of London 1991. 83 For a related example see M. Kageyama T. Tamura M. H. Nantz J. C. Roberts P. Somfai D. C. Whritenour and S. Masa-mune J. Am. Chem. Soc. 1990 112 7407. 84 (a) D. B. Dess and J. C. Martin J. Org. Chem. 1983 48 4155; (b) D. B. Dess and J. C. Martin J. Am. Chem. SOC. 1991 113 NATURAL PRODUCT REPORTS 1993-4. V. LEY A. A. DENHOLM AND A. WOOD 7277; (c) D. A. Evans S. W. Kaldor T. K. Jones J. Clardy and T. J. Stout J. Am. Chem. SOC.,1991 112 7001. 85 (a) E. J. Corey S. Kim S.Yoo K. C. Nicolau L. S. Melvin Jr.D. J. Brunelle J. R. Falck E. J. Trybulski R. Lett and P. W. Sheldrake J. Am. Chem. SOC. 1978 100 4620; (b)E. Fanton J. Gelas and D. Horton J. Chem. SOC.,Chem. Commun. 1980 21. 86 (a) R. Albert K. Dax R. Pleschbo and A. Stutz Carbohydr. Res. 1985 137 280; (b) T. Yamanoi T. Akiyama E. Ishida H. Abe M. Amemiya and T. Inazu Chem. Lett. 1989 335; (c) M. T. Crimmins W. G. Hollis Jr. and G. J. Lever Tetrahedron Lett. 1987 28 3647. 87 E. J. Corey and R. A. Sneen J. Am. Chem. SOC. 1956 78 6229. 88 J. J. Cawley and F. H. Westheimer Chem. Znd. (London) 1960 656. 89 S. Baskaran I. Islam M. Raghanan and S. Chandrasekaran Chem. Lett. 1987 1175. 90 E. J. Corey and J. W. Suggs Tetrahedron Lett. 1975 16 2647. 91 Y. Quindon H. E. Morton and C. Yoakum Tetrahedron Lett.1983 24 3969. 92 (a) R. Kuhn I. Low and H. Trishmaun Chem. Ber. 1957 90 203; (b) L. van Hijfte and R. D. Little J. Org. Chem. 1985 50 3940. 93 J-C. Florent and C. Monneret Synthesis 1982 29. 94 K. B. Sharpless M. A. Umbreit M. T. Nieh and T. C. Flood J. Am. Chem. Soc. 1972 94 6538. 95 S. M. Lee J. A. Klocke and M. F. Balandrin Tetrahedron Lett. 1987 28 3543. 96 J. E. Baldwin J. Chem. SOC. Chem. Commun. 1976 738. 97 G. A. Olah and S. C. Narang Tetrahedron 1982 38 2225. 98 G. Dominguez M. C. de la Torre and B. Rodriguez J. Org. Chem. 1991 56 6595. 99 J. Heathcote and J. Hibbert ‘Aflatoxins Chemical and Biological Aspects’ Elsevier Oxford 1978. 100 D. H. R. Barton H. T. Chung A. D. Gross L. M. Jackman and M. Martin-Smith J.Chem. SOC., 1961 5061. 101 (a) Y. Kojima N. Kato and Y. Tereda Tetrahedron Lett. 1979 20 4667; (b) Y. Kojima and N. Kato Tetrahedron 1981 37 2527; (c) Y. Kojima and N. Kato Agric. Biol. Chem. 1980 44 855; (d) Y.Kojima and N. Kato Tetrahedron Lett. 1980 21 5033; (e)M. Jalali G. Boussac and J. Y. Lallemand Tetrahedron Lett. 1983 24 4307; (f)M. Jalali-Naini and J. Y. Lallemand Tetrahedron Lett. 1986,27,497;(g)A. P. Brunetiere M. Leclaire S. Bhalnager and J. Y. Lallemand Tetrahedron Lett. 1989 30 341 ;(h) M. Pezechk A. P. Bruntiere and J. Y. Lallemand Tetra-hedron Lett. 1986 27 3715; (i) A. P. Brunetiere and J. Y. Lallemand Tetrahedron Lett. 1988 29 2179; (j) S. L. Schreiber and K. Satake J. Am. Chem. SOC.,1984 106 4187; (k) S. L. Schreiber and K.Satake Tetrahedron Lett. 1986 27 2575; (I) J. Yoshida S. Yano T. Ozawa and N. Kawabata J. Org. Chem. 1985 50 3476; (m) T. Nakata S. Nagao and T. Oishi Tetra-hedron Lett. 1985,26,6465;(n)B. B. Snider and R. A. H. F. Hui J. Org. Chem. 1985 50 5167; (0)S. Toni T. Inokuchi and Y. Yukawa J. Org. Chem. 1985 50 5875; (p) J. J. Chilot A. Doutheau J. Gore and A. Saroli Tetrahedron Lett. 1986 27 849; (4)T. Matsumoto and T. Sei Agric. Biol. Chem. 1985 51 249; (r) E. B. Villhauer and R. C. Anderson J. Org. Chem. 1987 52 1186; (s) G. Mehta H. S. P. Rao and K. R. Reddy J. Chem. Soc. Chem. Commun. 1987,78; (t) C. P. Gorst-Allman and P. S. Steyn J. Chem. SOC. Perkin Trans. 1 1987 163; (u) K. Tadano H. Yamada Y. Idogaki and T. Suami Tetrahedron Lett.1988 29 655; (v) J. Vader R. Koopmans Ae. de Groot A. van Veldhuizen and S. van der Klerk Tetrahedron 1988 44,2663; (w)M. C. Pirrung J. Zhang and A. T. McPhail J. Org. Chem. 1991 56 6269. 102 (a) Y. Ueno 0.Moriya K. Chino M. Watanabe and M. Okawara J. Chem. SOC., Perkin Trans. 1 1986 1351; (b) D. Pflieger and B. Muckensturm Tetrahedron Lett. 1987 28 1519; (c) M. C. Pirrung V. K. Chang and C. V. DeArnicis J. Am. Chem. Soc. 1989 111 5824; (d) S. Dumas L. Ghosez A. Hesbain-Frisque I. Marko and B. Ronsmans J. Am. Chem. Soc. 1985 107 2129. 103 Y. Nishikimi T. Iimori M. Sodeoka and M. Shibasaki J. Org. Chem. 1989 54 3354. 104 T. Hiyama K. Nishide and K. Kobayashi Tetrahedron Lett. 1984 25 569. 105 K. Iseki M. Shinoda C. Ishiyama Y. Hayashi S-i.Yamada and M. Shibasaki Chem. Lett. 1986 559. 106 R. K. Hill ‘Cope Oxy-Cope and Anionic Oxy-Cope Rearrange- ments’ in ‘Comprehensive Organic Synthesis’ ed. B. M. Trost I. Fleming and L. A. Paquette 1991 Pergamon Press Oxford vol. 5 p. 839. 107 A. P. Krapcho Synthesis 1982 805 and 893. 108 R. M. Hansen and K. B. Sharpless J. Org. Chem. 1986,51 1922. 109 L. D.-L. Lu R. A. Johnson M. G. Finn and K. B. Sharpless J. Org. Chem. 1984 49 728. 110 G. B. Payne J. Org. Chem. 1962 27 3819. 111 (a) E. Vedejs J. Am. Chem. SOC.,1974 96 5944; (b) E. Vedejs D. E. Engler and J. E. Telschow J. Org. Chem. 1978 43 188. 112 (a)D. A. Evans and K. T. Chapman Tetrahedron Lett. 1986,27 5939; (b) D. A. Evans K. T. Chapman and E. M. Carreira J. Am. Chem. SOC.,1988 110 3560.113 S. V. Ley D. Neuhaus N. S. Simpkins and A. J. Whittle J. Chem. SOC.,Perkin Trans. I 1982 2157. 114 J. C. Anderson S. V. Ley D. Santafianos and R. N. Sheppard Tetrahedron 1991 47 6813. 115 J. Meinwald and E. Frauenglass J. Am. Chem. SOC.,1960 82 5235. 116 B. Renger H. Hugel W. Wykypiel and D. Seebach Chem. Ber. 1978 2630. 117 (a)G. Buchi and S. Weinreb J. Am. Chem. Soc. 1971,93,746; (b) B. M. Trost J. M. Balkovec and M. K. T. Mau J. Am. Chem. SOC., 1986 108 4974. 118 T. Dust in ‘Comprehensive Organic Chemistry’ ed. D. H. R. Barton and W. D. Ollis Pergamon Press Oxford 1979 vol. 3 p. 157. 119 T. V. Lee S. M. Roberts M. J. Dimsdale R. F. Newton D. K. Rainey and C. F. Webb J. Chem. Soc. Perkin Trans. I 1978 1176. 120 S.Butt H. G. Davies M. J. Dawson C. G. Lawrence J. Leaver S. M. Roberts M. K. Turner B. J. Wakefield W. F. Wall and J. A. Winders Tetrahedron Lett. 1985 26 5077. 121 (a) E. W. Collington C. T. Wallis and I. Waterhouse Tetra-hedron Lett. 1983 24 3125; (b) H. Grenter J. Dingwall P. Martin and D. Bellus Helv. Chim. Acta 1981 64 2812. 122 L. A. Paquette K. H. Fuhr S. Porter and J. Clardy J. Org. Chem. 1974 39 467. 123 G. R. Krow ‘The Baeyer-Villiger Oxidation ’ in ‘Comprehensive Organic Synthesis’ ed. B. M. Trost I. Fleming and S. V. Ley Pergamon Press Oxford 1991 vol. 7 p. 671. 124 (a) F. Franke R. D. Guthrie Aust. J. Chem. 1978 31 1285; (b) Y. Torisawa M. Shibasaki and S. Ikegami Tetrahedron Lett. 1979 19 1865; (c)K. K. Ogilvie S. L. Beaucage A.L. Schifman N. Y.Theriault and K. L. Sadana Can. J. Chem. 1978,56,2768. 125 F. J. McQuillin and M. S. Baird ‘Alicyclic Chemistry’ Cam- bridge University Press 1983 208. 126 (a)Z. Grudzinski and S. M. Roberts J. Chem. Soc. Perkin Trans I 1975 1767; (b)E. Mitch and A. S. Dreiding Chimica (Switz.) 1960 14 424. 127 J. C. Anderson and S. V. Ley Tetrahedron Lett. 1990 31 431. 128 E. J. Corey K. C. Nicolau M. Shibasaki Y.Machida and C. S. Shiner Tetrahedron Lett. 1975 51 3183. 129 S. Czernecki C. Georgoulis and C. Provelenghiou Tetrahedron Lett. 1976 16 3535. 130 J. A. Dale D. D. Dull and H. S. Mosher J. Org. Chem. 1969 34 2543. 131 J. C. Anderson and S. C. Smith SYNLETT 1990 107. 132 D. Seebach Chem. Ber. 1985 21 632. 133 J. C. Anderson and S.V. Ley Tetrahedron Lett. 1990 31 3437. 134 (a) N. A. LeBel ‘Advances in Alicyclic Chemistry’ ed. H. Hart and G. B. Karabatsos Academic Press New York 1971 vol. 3 278; (b)W. H. Saunders Jr. and A. F. Cockerill ‘Mechanisms of Elimination reactions ’,Wiley-Interscience New York 1973 125 ; (c)H. C. Brown and K. T. Liu J. Am. Chem. Soc. 1970,92,200; (d)R. A. Bartsch and R. H. Kayser J. Am. Chem. SOC.,1974,96 4346; (e) H. Kwart A. H. Gaffrey and W. A. Wilk J. Chem. SOC., Perkin Trans. II 1984 565. 135 R. J. Arhart and J. C. Martin J. Am. Chem. SOC.,1972,94 5003. 136 E. M. Burgess H. R. Penton Jr. and E. A. Taylor J. Org. Chem. 1973 38 26. 137 (a)S. L. Schreiber and D. B. Smith J. Org. Chem. 1989,54,9; (b) R. G. Linde 11 M. Egbertson R. S.Coleman A. B. Jones and S. J. Danishefsky J. Org. Chem. 1990 55 2771. 138 F. A. Davis and A. S. Sheppard Tetrahedron 1989 45 5703. 139 W. Adams Y-Y.Chan D. Cremer J. Gauss D. Scheutzow and M. Schindler J. Org. Chem. 1987 52 2800. 140 W. Carruthers ‘Cycloaddition Reactions in Organic Synthesis ’ ed. J. E. Baldwin and P. D. Magnus 1990 Pergamon Press p. 1. 141 D. Craig Chem. SOC. Rev. 1987 16 187. 142 (a) K. Alder and G. Stein Angew. Chem. 1937 50 514; (6) K. Alder Liebigs Ann. Chem. 1951 571 157; (c) K. Alder and M. Schumacher Fortschr. Chem. Org. Naturstofle 1953 10 1. 143 (a) K. J. Shea A. J. Staab and K. S. Zandi Tetrahedron Lett. 1991 32 2715; (6)D. Craig and J. C. Reader Tetrahedron Lett. 1990 31 6585. 144 Y. Sato M. Sodeoka and M.Shibasaki J. Org. Chem. 1989 54 4738. 145 Y. Sato M. Sodeoka and M. Shibasaki Chem. Lett. 1990 1953. 146 Y. Sato S. Watanabe and M. Shibasaki Tetrahedron Lett. 1992 33 2589. 147 K. Mori and H. Watanabe ‘IUPAC 7th International Congress of Pesticide Chemistry’ Hamburg Book of Abstracts ’ 1990 vol. 1 p. 251. 148 (a)R. E. Ireland R. H. Mueller and A. K. Willard J. Am. Chem. SOC., 1976 98 2868; (b) R. E. Ireland and C. S. Wilcox Tetra-hedron Lett. 1977 17 2839 and 3975; (c) R. E. Ireland P. Wipf and J. D. Armstrong J. Org. Chem. 1991 56 3572. 149 M. Kennedy and M. A. McKervey ‘Oxidation Adjacent to Sulphur’ in ‘Comprehensive Organic Synthesis’ ed. B. M. Trost I. Fleming and S. V. Ley 1991 Pergamon Press Oxford vol. 7 p. 193. 150 R.J. K. Taylor Synthesis 1977 564. 151 A. J. Fatidi Synthesis 1976 133. 152 (a)F. Sher J. L. Isidor H. R. Taneja and R. M. Carlson Tetra-hedron Lett. 1973 577; (b) R. A. Eilson E. R. Lukenbach and C.-W. Chiu Tetrahedron Lett. 1975 499; (c) J. Leroy and C. Wakselman Synth. Commun. 1984 14 239. 153 (a)A. M. Doherty M. P. Edwards S. V. Ley and H. M. Organ Tetrahedron 1986 42 3723; (b) E. J. Corey L. 0.Weigel A. R. Chamberlin and B. H. Lipshutz J. Am. Chem. SOC., 1980 102 1439. 154 (a) P. Block Jr. Org. Synth. 1960 40 27; (b) J. M. Cassady G. A. Howie J. M. Robinson and I. K. Stamas Org. Synth. 1983 61 77. 155 J. E. Cole W. S. Johnson P. A. Robins and J. Walker J. Chem. Soc. 1962 244. 156 (a)M. S. Newman and R. J. Harper J. Am. Chem. Soc.1958,80 6350; (b) S. W. Smith and M. S. Newman J. Am. Chem. Soc. 1968 90,1249 and 1253. 157 D. F. Taber C. Campbell B. P. Guan and I. C. Chin Tetra-hedron Lett. 1981 22 5141. 158 W. R. Roush and S. M. Peseckis J. Am. Chem. SOC.,1981 103 6696. 159 (a) F. Johnson Chem. Rev. 1968 68,375; (b) R. W. Hoffman Chem. Rev. 1989 89 1841. 160 L. N. Mander and S. P. Sethi Tetrahedron Lett. 1984 25 5953. 161 (a) M. G. Brasca H. B. Broughton D. Craig S. V. Ley A. A. Somovilla and P. L. Toogood Tetrahedron Lett. 1988,29 1853; (b) S. V. Ley A. A. Somovilla H. B. Broughton D. Craig A. M. Z. Slawin P. L. Toogood and D. J. Williams Tetrahedron 1989 45 2143. 162 (a) H. 0.House and G. H. Rasmusson J. Org. Chem. 1963 28 31 ; (b)A. Ichihera R. Kimura S.Yamada and S. Sakamura J. Am. Chem. SOC.,1980 102 6353; (c) L. Velluz J. Valls and G. Nomine Angew. Chem. Int. Ed. Engl. 1965 4 181; (d) W. R. Roush and H. R. Gillis J. Org. Chem. 1980 45,4283; (e)W. R. Roush and S. E. Hall J. Am. Chem. Soc. 1981 103 5200. 163 D. Craig PhD Thesis University of London 1986. 164 MACROMODEL the Batchmin program and associated docu- mentation are available from W. C. Still Columbia University New York. 165 I. M. Mukaiyama Angew. Chem. Int. Ed. Engl. 1965 16 817. 166 (a) G. S. Cockerill and P. Kocienski J. Chem. SOC., Chem. Commun. 1983 705; (b) G. S. Cockerill P. Kocienski and R. Threadgold J. Chem. Soc. Perkin Trans. 1 1985 2093; (c) G. S. Cockerill P. Kocienski and R. Threadgold J. Chem. SOC., Perkin Trans.I 1985 2101 ; (d) A. Alexakis M. Chapdelaine G. H. Posner and A. W. Runquist Tetrahedron Lett. 1978 19 4205. 167 G. Jones Org. React. 1967 15 204. 168 (a) ‘Organoselenium Chemistry’ ed. D. Liotta 1987 J. Wiley & Sons New York; (b) C. Paulmier ‘Selenium Reagents and Intermediates in Organic Synthesis ’ Pergamon Press Oxford 1986. 169 (a)I. Fleming R. Henning and H. Plant J. Chem. SOC., Chem. Commun. 1984 29; (b) I. Fleming and P. E. J. Sanderson Tetrahedron Lett. 1987 28 4229. 170 K. C. Nicolau D. A. Clareman W. E. Barnette and S.P. Seitz J. Am. Chem. SOC., 1979 101 3704. NATURAL PRODUCT REPORTS 1993 171 P. C. Bulman-Page M. B. van Niel and J. C. Prodger Tetra-hedron 1989 45 7643. 172 S. Takano S. Hatakeyama and K. Ogasawara J.Chem. Soc. Chem. Commun. 1977 68. 173 (a)G. Frenkling K. F. Kohler and M. T. Reetz Angew. Chem. Int. Ed. Engl. 1991 30 1146; (b) D. C. Wigfield Tetrahedron 1979 35 449. 174 Y-D. Wu J. A. Tucker and K. N. Houk J. Am. Chem. SOC. 1991 113 5018. 175 (a) M. Cherest H. Felkin and N. Prudent Tetrahedron Lett. 1968 9 2199; (b) M. Cherest and H. Felkin Tetrahedron Lett. 1968 9 2205. 176 J. Huet Y. Maroni-Barnaud N. T. Anh and J. Seyden-Penne Tetrahedron Lett. 1976 17 159. 177 (a)A. S. Cieplak J. Am. Chem. Soc. 1981 103 4540; (b) A. S. Cieplak B. D. Tate and C. R. Johnson J. Am. Chem. SOC.,1989 111 8447. 178 G. Catelani L. Monti and M. Ugazlo J. Org. Chem. 1980 45 919. 179 B. Rickborn and M. T. Wuesthoff J. Am. Chem. SOC., 1970 92 6894.180 (a) J-L. Luche and A. L. Gemal J. Am. Chem. Soc. 1979 101 5848; (b)J-L. Luche and A. L. Gemal J. Am. Chem. SOC.,1981 103 5454. 181 E. Toromanoff in ‘Topics in Stereochemistry’ ed. N. L. Allinger and E. L. Eliel Interscience New York vol. 2 p. 157. 182 Y-D. Wu K. N. Houk J. Florez and B. M. Trost J. Org. Chem. 1991 56 3656. 183 G. Solladik and J. Hutt J. Org. Chem. 1987 52 3564. 184 M. E. Jung ‘Selectivity Strategy and Efficiency in Modern Organic Chemistry ’ in ‘Comprehensive Organic Synthesis ’ ed. B. M. Trost I. Fleming and M. F. Semmelhack 1991 Pergamon Press Oxford vol. 4 p. 45. 185 (a)S. K. Pradhan Tetrahedron 1986,42,6351; (b)J. W. Huffman Acc. Chem. Res. 1983 16 399. 186 (a) D. A. Evans and A. H. Hoveyda J. Org. Chem. 1990 55 5190; (b) K.Narasaka and F. Pai Tetrahedron 1984 40,2233. 187 (a) D. H. R. Barton J. N. Beaton L. E. Gelher and M. M. Pechet J. Am. Chem. SOC., 1960 82 2640; (b) A. L. Nussbaum and C. H. Robinson Tetrahedron 1962 17 35; (c) J. F. Arnett E. J. Corey and G. N. Widiger J. Am. Chem. SOC., 1975,97,430. 188 (a) D. H. R. Barton and M. J. Akhtar J. Am. Chem. SOC., 1961 83,221 3 ;(b)A. Padwa and C. Walling J. Am. Chem. SOC., 1961 83,2207; (c) A. Padwa and C. Walling J. Am. Chem. Soc. 1963 85 1597; (d)F. D. Greene M. L. Savitz F. D. Osterhottz H. H. Lau W. N. Smith and P. M. Zanet J. Org. Chem. 1963 28 55; (e) K. Heusler and J. Kalvoda Angew. Chem. Int. Ed. Engl. 1964 3 525; (f) D. Bartholomew and I. T. Kay Tetrahedron Lett. 1984 25 2035; (g) S.Gojkovic S. Konstantinovic and M. L. Mihailovic Tetrahedron 1973 28 3675. 189 ‘Oxidation in Organic Chemistry’ ed. W. Trananovsky 1982 Academic Press vol. 5-D p. 1. 190 S. D. Burke L. A. Silks and S. M. S. Strickland Tetrahedron Lett. 1988 29 2761. 191 K. Fuji E. Fujita N. Ito T. Kajimato M. Node and J. Tamada J. Chem. SOC.,Chem. Commun. 1986 1164. 192 R. L. Dorta C. G. Francisco R. Freire and E. Suarez Tetra-hedron Lett. 1988 29 5429. 193 (a) J. I. Concepcion C. G. Francisco R. Hernandez J. A. Salazar and E. Suarez Tetrahedron Lett. 1984 25 1953; (b) P. Armas R. Carrau J. I. Concepcion C. G. Francisco R. Hernan- dez and E. Suarez Tetrahedron Lett. 1985 26 2493; (c) C. Betancor R. Carrau R. Hernandez and E. Suarez J. Chem. SOC.,Perkin Trans.1 1987 937; (d) C. G. Francisco R. Freire M. S. Rodriguez and E. Suarez Tetrahedron Lett. 1987 28 3397; (e)R. Freire J. J. Marrero M. S. Rodriguez and E. Suarez Tetrahedrom Lett. 1986 27 383. 194 A. E. Dorigo and K. N. Houk J. Org. Chem. 1988 53 1650. 195 (a) R. Breslow R. Rajagopalan and J. Schwartz J. Am. Chem. SOC.,1981 103 2905; (b)R. Breslow and U. Maitra Tetrahedron Lett. 1984 25 5843; (c) R. Breslow and R. Batra Tetrahedron Lett. 1989 30 535. 196 C. A. Grob Angew. Chem. Int. Ed. Engl. 1969 8 535. 197 T. H. Chan and A. E. Schwerdtfeger J. Org. Chem. 1991 56 3294. 198 P. F. Schuda C. B. Ebner and S. J. Polock Synthesis 1987 1055. 199 H. C. Kolb S. V. Ley R. N. Sheppard A. M. 2. Slawin S. C. Smith D. J. Williams and A. Wood J.Chem. Soc. Perkin Trans. 1 1992 2763. NATURAL PRODUCT REPORTS 1993-S. V. LEY A. A. DENHOLM AND A. WOOD 200 (a)H. C. Kolb and S. V. Ley Tetrahedron Lett. 1991 32 6187; (b)H. C. Kolb S. V. Ley A. M. Z. Slawin and D. J. Williams J. Chem. SOC.,Perkin Trans. I 1992 2735. 201 B. M. Trost C. G. Caldwell E. Murayama and J. Heissler J. Org. Chem. 1983 48 3252. 202 W. S. Wadsworth Jr. Organic Reactions Wiley New York 1977 25 73. 203 M. A. Blanchette W. Choy J. T. Davis A. P. Essenfield S. Masamune W. R. Roush and T. Sakai Tetrahedron Lett. 1984 25 2183. 204 M. W. Rathke and M. Novak J. Org. Chem. 1985 50 2624. 205 (a) T. Minami I. Niki and T. Agawa J. Org. Chem. 1974 39 3236; (b)K. Lee and D. F. Weimer J. Org. Chem. 1991,56,5556. 206 A.P. Uijttewaal F. L. Jonkers and A. van der Gen J. Org. Chem. 1979 44,3157. 207 (a)D. A. Evans R. Zahler S. H. Pine and R. H. Grubbs J. Am. Chem. SOC.,1980 102 3270; (b) S. H. Pine R. J. Pettit G. D. Geib S. G. Cruz C. H. Gallego T. Tijerina and R. D. Pine J. Org. Chem. 1985 50 1212. 208 (a) F. N. Tebbe G. W. Parshall and G. S. Reddy J. Am. Chem. SOC.,1978 100 361 1 ;(6) H.-U. Reissig ‘Methylenations with the Tebbe-Grubbs Reagents ’ in ‘Organic Synthesis Highlights ’ ed. J. Mulzer H. J. Altenbach M. Braun K. Krohn and H.-U. Reissig 1991 VCH Weinheim p. 192. 209 (a) R. R. Schrock J. Am. Chem. SOC.,1976 98 5399; (b)K. H. Doertz Angew. Chem. Int. Ed. Engl. 1984 23 587. 210 K. A. Brown-Wensley S. L. Buckwald L. Cannizzo L. Clawson S. Ho D. Meinhardt J.R. Stille D. Straus and R. H. Grubbs Pure Appl. Chem. 1983 55 1753. 211 (a) G. Breiger J. Am. Chem. SOC.,1963 85 3783; (b) L. H. Klemm and K. W. Gopinath Tetrahedron Lett. 1963 4 1243. 212 (a)W. P. Roush and H. R. Gillis J. Org. Chem. 1982 47 4825; (6) D. A. Evans K. T. Chapman and J. Bisaha Tetrahedron Lett. 1984 25 4071. 213 (a) K. N. Houk J. Am. Chem. Soc. 1973 95 4092; (6) K. N. Houk and R. W. Strozier J. Am. Chem. SOC.,1973 95 4094. 214 R. Sustmann and J. Sauer Angew. Chem. Int. Ed. Engl. 1980,19 779. 215 A. I. Konovalev G. I. Komasheva and M. P. Loskutov J. Org. Chem. USSR 1973 9 2064. 216 (a)M. S. J. Dewar J. Am. Chem. SOC.,1984 106 209; (b)F. K. Brown and K. N. Houk Tetrahedron Lett. 1985 26 2297. 217 H. B. Broughton personal communication.218 G. H. Posner Chem. Rev. 1986 86 831. 219 For related examples see (a) K. A. Parker and T. Iqbal J. Org. Chem. 1987 52 4397; (b) M. P. Edwards S. V. Ley and S. G. Lister Tetrahedron Lett. 1981 22 261 ;(c) M. P. Edwards S. V. Ley S. G. Lister B. P. Palmer and D. J. Williams J. Org. Chem. 1984 49 3503. 220 J. P. Marino and R. J. Linderman J. Org. Chem. 1983 48,4621. 221 I. Fleming T. W. Newton and F. Roessler J. Chem. Soc. Perkin Trans. I 1981 2527. 222 J. P. Marino and R. J. Linderman J. Org. Chem. 1981,46,3696. 223 L. Capella A. Degl’Innocenti G. Reginato A. Ricci and M. Taddei J. Org. Chem. 1989 54 1473. 224 (a)I. Beaudet J-L. Parrain and J-P. Quintard Tetrahedron Lett. 1991 32 6333; (6) I. Marek A. Alexakis and J-F.Normant Tetrahedron Lett. 1991 32 6337. 225 H. C. Kolb PhD Thesis University of London 1991. 226 (a)W. Oppolzer and V. Snieckus Angew. Chem. Int. Ed. Engl. 1978 17 476; (b)D. F. Taber ‘Intramolecular Diels-Alder and Alder Ene Reactions’ 1984 Springer Berlin. 227 ‘Best Synthetic Methods Borane Reagents’ A. Pelter K. Smith and H. C. Brown 1988 Academic Press 125. 228 J. W. Reed and W. L. Jolly J. Org. Chem. 1977 42 3963. 229 G. Stork and F. H. Clarke Jr. J. Am. Chem. SOC.,1961,83,3114. 230 M. Havel J. Valek J. Pospisek and M. Soucek Collect. Czech. Chem. Commun. 1979 44,2443. 231 (a)I. Fleming and H.-F. Chow Tetrahedron Lett. 1985 26 397; (b) I. Fleming J. H. M. Hill D. Parker and D. Waterson J. Chem. SOC.,Chem. Conimun. 1985 318; (c) I. Fleming and J.D. Kilburn J. Chem. Soc. Chem. Commun. 1986 305 and 1198; (d) I. Fleming S. K. Armstrong and R. J. Pollitt J. Chem. Res. (S) 1989 19. 232 K. Tamao T. Kakui M. Akita T. Iwahara R. Kanatani J. Yoshida and M. Kumada Tetrahedron 1983 39 983. 233 (a) K. Tamao M. Kumada N. Ishida and T. Tanaka Organo-metallics 1983 2 1694; (b) K. Tamao and N. Ishida J. Organomet. Chem. 1984,269 C37; (c)K. Tamao T. Yamagauchi and Y. Ito Chem. Lett. 1987 171. 234 H. C. Brown and S. Krishnamurthy J. Am. Chem. SOC.,1972,94 7 159. 235 S. V. Ley H. Lovell and D. J. Williams J. Chem. Soc. Chem. Commun. 1992 1304. 236 R. D. Clark and C. H. Heathcock J. Org. Chem. 1976,41 1396. 237 T. Veysoglu L. A. Mitscher and J. K. Swayze Synthesis 1980 807. 238 D. Seebach Angew.Chem. Int. Ed. Engl. 1979 18 239. 239 J. H. Brewster and C. J. Ciotti Jr. J. Am. Chem. SOC.,1955 77 6214. 240 T. Kan H. Hashimoto M. Yanagiya and H. Shirahama Tetra-hedron Lett. 1988 29 5417. 241 For example see D. Boschelli A. B. Smith 111 0.D. Stringer R. H. Jenkins Jr. and F. A. Davis Tetrahedron Lett. 1981 22 4385. 242 (a) W. Adam D. Golsch and L. Hadjiarapoglou Tetrahedron Lett. 1991 32 1041; (b) S. W. Baertsci K. D. Raney M. P. Stone and T. M. Harris J. Am. Chem. SOC.,1988 110 7929; (c) W. Adam L. Hadjiarapoglou and X. Wang Tetrahedron Lett. 1989 30 6497.

ISSN:0265-0568    

DOI:10.1039/NP9931000109

出版商:RSC    

年代:1993

数据来源: RSC

摘要:

Diterpenoids J. R. Hanson School of Molecular Sciences University of Sussex Brighton Sussex BN 7 9QJ Reviewing the literature published in 1991 (Continuing the coverage of literature in Natural Product Reports 1992 Vol. 9 p. 1) 1 Introduction 2 Acyclic and Related Di terpenoids 3 Bicyclic Di terpenoids 3.1 Labdanes 3.2 Clerodanes 4 Tricyclic Diterpenoids 4.1 New Natural Products 4.2 Chemistry of the Tricyclic Diterpenoids 5 Tetracyclic Diterpenoids 5.1 Kaurenes 5.2 Beyerenes 5.3 Atiserenes 5.4 Aphidicolin and Related Compounds 5.5 Grayanotoxins 5.6 Gibberellins 6 Macrocyclic Diterpenoids and their Cyclization Products 7 Miscellaneous Diterpenoids 8 References I Introduction This report follows the pattern of its predecessors' and covers the literature published between January and December 1991.Over the last few years there has been a considerable interest in taxol since it possesses value as a potential chemotherapeutic agent for the treatment of ovarian cancer where it shows a unique mode of action. It is worth noting that many other diterpenoids of quite different structures have also been shown to possess tumour inhibitory activity. A number of these have been isolated as a result of studies on Chinese medicinal plants. Amongst the novel variations in diterpenoid skeleta that have been reported recently are a number in which ring expansion has taken place incorporating one of the pendant carbon atoms into the ring system affording a further group of structures which do not follow a simple isoprene rule.Further diterpenoids have also been identified in which one of the rings has been cleaved. 2 Acyclic and Related Diterpenoids Phytol palmitate has been obtained from Leucas nutans (Labiatae)2 and Pentatropis spiralis (A~clepiadaceae).~ Various geranyllinalool derivatives [e.g. (1) from Croton salutaris (E~phorbiaceae)],~ geranyl-geraniol derivatives [e.g. (2) from Diplostephium meyenii (A~teraceae)],~ and geranylnerol deriva- tives [e.g. (3) from Siegesbeckia orientalis (Compositae)],' have been described. The epoxide (4) zoapatol A which has been isolated' from Montanoa tomentosa (Compositae) has a plausible biogenetic relationship to the oxepane diterpenoids of the zoapatanol group.A number of acyclic diterpenoids possess a terminal furan ring exemplified by conyzaleucolide A (5) obtaineds from Conyza hypoleuca (Compositae). Acyclic diterpenoids and their relatives have also been detected in marine organisms. Thus the eleganolone diterpenoid (6) was amongst a series obtainedg from the alga Bifurcaria bifurcata whilst halitunal (7) was isolatedlo from the marine alga Halimeda tuna. 0 /OH (4) OH 159 NATURAL PRODUCT REPORTS 1993 w TO2 .,H (9) R CH~CH(OAC).CH~OH and R = CH2CH(OH).CH20Ac xco2H The monocyclic bisabolene analogue (8) is an insecticidal component of Croton linearis (Euphorbiaceae) showing a potentially useful neurotoxic effect on Cylas formicarious elegantulus which is a pest of sweet potatoes." 3 Bicyclic Diterpenoids 3.1 Labdanes Some labdane glycerides (9) have been obtained12 from the antarctic nudibranch Austrodoris kerguelensis.The absolute stereochemistry of salvic acid (10) has been establi~hed'~ by an inter-relationship with methyl dihydroeperuate. The conifers continue to be a source of labdanes. A series of isocupressic acid derivatives (1 1) were ~btained'~ from Juniperus communis whilst the 19-acetate of the trio1 (12) was ~btained'~ from J. sabina. Imbricataloic acid and isocupressic acid are the predominant resin acids of Pinus ponderosa needles.l6 In continuation of some studies on Premna species (Verbenaceae) examination of P.oligotricha afforded" ent-12-oxolabda-8,13-dien-15-oic acid (13) and the unusual epidioxide (14). The structure of the latter was confirmed by X-ray analysis. Phytochemical studies by various groups on the Compositae have yielded many labdanes. Some examples are given in Table 1. Notable amongst these isolates are the ring A secolabdanes and the friedo-labdanes which lie biogenetically between the labdanes and the clerodanes. Compound (29) was obtained as Table 1 Some Labdanes from the Compositae Species Structure Ref. Leyssera gnaphaloides 15 18 Brickellia lemmonii 16 19 Baccharis petiolata 17 20 B. pedunculata 18 21 Aristeguetia buddleaefolia 19 22 Blepharisperum zanguebaricum 20,21 23 Stevia seleriana 22 24 Happlopappus pulchellus 23,24 H.arbutoides 25,26 25 H.parvifolius 27-33 26 COPH HO (19) R' = CH20H CHO or C02H (20) R' = =0,a-OH H2 R2 = CH20H CHO or W2H R2 = H2 H2 =O CO2H (21) R' = =0,a-OH H2 R2 = H2 H2 =O C02H CH20H (23) (24) 161 NATURAL PRODUCT REPORTS 1993-5. R HANSON CHO &oI a C02H H02C OH a '.,H - OH 'a. H (39) \ / / . 0 . 0 vcb-;-+y a photo-cyclization product of (28). Haplopappus parvifolius also contained26the enol-ether (31) which may arise by cleavage of the epidioxide (30). The lactone haploparriolide (32) represented another cleavage of ring B whilst the aromatic diterpenoids (33)-(35) are further constituents of this species. X-Ray crystallographic studies have the structure (36) of dubiin whilst prehispanolone (37) has been isolatedzs from the Chinese medicinal herb Yi Mu Cao Leonurus heterophyllus (Labiatae).Glycosides derived from labda-8( 17) 13-dien-3P,15,18-triol have been from Rubus foliolosus which is also used as a Chinese traditional medicine. The gaudichaudiosides A-E (e.g.,38) are glycosides obtained30 from the sweet-tasting plant Baccharis gaudichaudiana whilst the xyloside (39) has been reported31 in Conyza steudellii (Compositae). E~amination~~ of the marine tunicate Lisso-clinurn voeltzkowi (Urochordata) gave a highly cytotoxic rare succinimide dichlorolissoclimide (40). 1L A significant number of patents have appeared on forskolin and its relatives revealing a continued interest in this area.A synthesis of 14C-forskolin,also suited to the preparation of l1C-labelled material has been described33whilst further NMR and crystal structure studies in this series have been rep~rted.~~.~~ The biological activity of a number of derivatives has been examined.36 The availability of some labdanes from various commercial wood extracts has made them useful starting materials for chemical transformations. Thus dimethyl agathate has been converted to potential perfumery intermediate^^^ and to 4,8p-methyltestolactone (41).38The ozonolysis of neoabienol scla-reol isoabienol and sclareol oxide has been in~estigated.~~ 42 The competitive intramolecular participation of hydroxyl groups in the opening of epoxides has been examined43using (42) which was derived from the ozonolysis of dihydromanool.The assignment of the conformation of the 10-and 11-NPR 10 OH membered medium ring lactones (43) and (44) has been in the context of their differing reactivity. The further cyclization of bicyclic diterpenoids has continued to attract interest with on the cyclization of 12,13-epoxylabdanes to 12-oxypimaranes and to tetracyclic diterpe- noids in the presence of boron trifluoride :etherate catalysis. Oxymercuration of the diene (45) the pyran ring of a manoyl oxide (46). The transformations of manoyl oxide into its 12P-hydroxy derivative (47) and of 2-oxomanoyl oxide into the 20-oic acid have been de~cribed.~'. 48 Stimulated by interest in the biological activity of the series a hydroxyl group was intr~duced~~*~~ onto C-6 and C-17 of grindelic acid (48) via allylic bromination and the formation of a 6,8( 17)-diene.A number of microbiological transformations of labdanes have been reported including that of grindelane derivatives by Aspergillus niger,51 and sclareol by a Cunninghamella species,52 Mucor plumbe~s,~~ 54 and by Bacillus cereus.55 3.2 Clerodanes The cis-clerodane (49) has been isolated56 from a liverwort Schistochila aligera along with a rearranged pimarane (50) NATURAL PRODUCT REPORTS 1993 possessing the trans A/B ring fusion. X-Ray crystallography was used to confirm the structure of (51) obtained5' from Cistus palinhae (Cisti ceae). The clerodane malonate ester (52) was from Baccharis lejia (Compositae) whilst hardwickiic acid (53) is one of the most antimicrobial constituents of Croton sonderianus (Euphorbia~eae).~~ A report has appearedG0 of the conversion of hardwickiic acid into its 1 1-dehydro derivative which had been isolated from Croton oblongifolius.Both the cis and trans dehydrocrotonins (54) have now been obtainedG1 from Croton cajucara and shown to inhibit the growth of insects. During an examination of pesticidial plants the relative cleroinermin (55)has been obtained62 from Clerodendron inermi (Verbenaceae). The cis and trans-clerodanes (56)-(58) have been from some Chrysocoma (Compositae) species. The oxygenation pattern of three clerodanes the pilosanols A-C (59)-(61) which have been isolatedG4 from the roots of Portulaca pilosa (Portulacaceae) is in accord with a mechanism (see scheme 1) for the ring expansion that leads to portulal.The continuing investigation of Teucrium (Labiatae) species has led to the isolation of further clerodanes examples of which are given in Table 2. Many of these plants are medicinal herbs. Some inter-relationships in this area have been used to NATURAL PRODUCT REPORTS 1993-5. R. HANSON OH 0 Scheme 1 Table 2 Some Clerodanes from Teucriurn Species 0 Species Clerodanes Ref. T. bident at um T. gracile T.japonicum T. oliverianum T. oxylepis (subsp. marianum) T. pernvi bidentatin (62) teugracilin A-C (63) teuponin (64) teucrolivins A-C (65)-(67) teucrolivins D-F (68)-(70) teucrolivins G and H (71) (72) teucroxylepin (73) teupernin A-C (74) (75) (teupernin B = bidentatin) 65 66 67,68 69 70 71 72 73 OAc (70) OAc (71) R =Ac (72) R = H p 0A p OAc (73) (74) (62) R=O (63) (75) R = BOH 0- Hi H (77) R’ = 02CCHMe.Et R2 = H R3 = AC OAc (78) R’ = O&-C(Me)=CHMe R2 = H R3 = Ac (79) R’ = H R2= OH R3 = 02CC(Me)=CHMe (65) establish the stereochemistry of these highly oxygenated clerodanes.Thus montanin C 12-epiteupolin 11 teugnapha-lodin and teubutilin have been ~orrelated’~ with 19-acetyl- gnaphalin whilst montanin A has been linked75 with isocroto- caudin which has led to a correction of the structure of the latter to (76). Teubotrin has been tran~formed~~ into some of its relatives such as teuscordinon whilst the elimination of C-19 of eriocephalin has led77 to teuscorolide and teucvin.The antifungal activity of jodrellins A and B suggests7* that these substances may contribute to the antifungal as well as the anti- OAc OAc insect defense mechanism of these plants. The ajugavensins A-C (77)-(79) have been from (66) R =Ac (68) R=B-OAc Ajuga genevensis (Labiatae). Sulviu (Labiatae) species are also (67) R = H (69) R = 0 medicinal herbs that are known to produce clerodanes. NATURAL PRODUCT REPORTS 1993 0 PO J? 9..($ 92::: (80) R’ = H R2= OAC 0 00 (81) R’ =OH R2= H 00 $H pkH+ Po’ 00 0 Scheme 2 . $pO 0 (84) R’= H R2=OH (87) (85) R’ = H R2 = OAC (86) R’ = OAC R2= H Examination of S. lavanduloides gaveao the seco-clerodanes salviandulines A (80) and B (81) whilst salvireptanolide (82) was obtaineda1 from S.reptans. The latter also gave the epoxide (83). A series of clerodanes (84)-(86) and aromatic seco-clerodanes such as rhyacophiline (87) was obtaineds2 from S. rhyaciphila. The fragmentation of ring B may occur as in scheme 2. 6-Hydroxycolumbin (88) and penianthic acid (89) have been isolateds3 from Penianthus zenkeri (Menispermaceae) whilst tinosporicide (90) was obtaineda4 from Tinospora malabarica (Menispermaceae) a plant used which is used to treat fever. A number of kolovanes the corymbotins A-I (e.g. 91) have been isolateda5 from Casearia corymbosa (Flacourtiaceae) whilst the anti-tumour casearins A-R (e.g. 92) were obtaineda6* from C.sylvestris. 4 Tricyclic Diterpenoids 4.1 New Natural Products The ‘H and 13C NMR spectra of totarol and some of its derivatives and a number of resin acids have been assigned.88-as Examination of some conifers have afforded tricyclic diter- penoids. Thus 19-hydroxy-totarol and 12-methoxydehydro-abietic acid were obtaineds0 from Dacrydium pierrei whilst the acid (93) was isolatedg1 from the leaves of the economically important Chinese pine Pinus armandii. The endoperoxides (94) and (95) were obtaineds2 from the needles of Abies marocana. Kirenol (96) and 16-acetylkirenol were isolateds3 from the Chinese antirheumatic drug Siegesbeckia glabrescens. The Chinese drug Shi-Hu Ephemerantha lonchophylla (Orchi-daceae) containss4 the glucoside ephemeranthoside (97).A number of pimaranes isolated recently have been shown to contain a A9(l1)-double bond. These are exemplified by (98)s5 from Tugarinovia mongolica and (99)96 obtained from a Korean diabetic drug Eragrostis ferruginea (Gramineae). The latter has an unusual 8P-hydrogen atom cis to the methyl group at C-10. Continuing studies on the Velloziaceae have given” NATURAL PRODUCT REPORTS 1993-5. R. HANSON C02Me CH20H (94) (95) both 9a:13a and 9p:13p. (96) R = Hand Ac (97) -'\ -'\ & @ @OH '8. C02H H (99) (102) R = CHZOH (103) R = CHO '*.,H rn Wo H '* (107) R= H (113) R = Me OH $& ".,H ~ ~~ Table 3 Abietanes from Salvia Species Species Abietane Ref. S. miltiorrhiza (roots) danshexinkun (104) 99 salviolone (105) 100 miltipolone (106) S.mellfera salvicanol (1 07) 101 S. paramiltiorrhiza paramiltioic acid (1 08) 102 S. przewalskii przewalskin (1 09) I03 S. nipponica taxodione I04 S. trijuga trijuganone C (1 10) 105 S. wiedamanii (111) and (112) 106,107 -OM= the pimaranes (100) and (101) from V. bicolor and the cleistanthanes (102) and (103) from V. de~linans.~~ Investigations of Salvia species including the Chinese drug Dan-Shen (S. miltiorrhiza) have continued to afford highly oxidized abietanes. Recent isolates are given in Table 3. A number of 9( 1&2O)-abeoabietane rearrangement products have been isolated. These include isosalvicanol (1 13) from Lepechinia meyeni (Labiatae),lo8 heudelotinone (1 14) from Ricinodendron heudelotii (Euphorbiaceae),log and faveline (1 15) NATURAL PRODUCT REPORTS 1993 (120) R=OH (121) R=H 0 HO (125) (126) 7,8-a-epoxide from Cnidoscolus phyllacanthus (Euphorbiaceae).The phena- lenone pygmacone (1 16) is another rearrangement product which was obtained"' from Pygmacopremna herbacea (Verbe-naceae) a plant which is used in Ayurvedic medicine. Several Coleus (Labiatae) species also find application in Chinese folk medicine. Examination of C. esquirolii afforded112 esquirolin B (117) and D (118) whilst (119) was obtained from C. xanthanthus. The helioscopinolides D (120) and E (121) were obtained113 from Euphorbia calyptrata. 16a-Hydroxytriptolide (1 22) (from Tripterygium wilfordii) has been reported114 as possessing a strong anti-inflammatory and immunosuppressive action whilst a revised structure has been propo~ed"~ for triptophenolide (123).The acid (124) was isolated116 from T. hypoglaucum. Podocarpus nagi has been a rich source of biologically-active diterpenoid lactones. Recent isolates include 2a-hydroxynagi- lactone F (125),1173-deoxy-2a-hydroxynagilactoneE (126),118 3-epinagilactone C (127),118 and nagilactone J (128).l19 The effect of the nagilactones on the growth of lettuce seedlings has been described. 120 Some of the cytotoxic nagilactones have been isolated from Podocarpus totara infected with mistletoe (Ileostylus rnicranthus).121 The hymatoxins A-E (e.g. 129) are phytotoxins from the fungus Hypoxylon mammatum an organism which is responsible for canker formation on aspen and poplar trees.122 4.2 Chemistry of the Tricyclic Diterpenoids Various aspects of the chemistry of the tricyclic diterpenoids OH R (129) R = H and OH The conversion of royleanone to drimane sesquiterpenoids obtained from Aspergillus oryzae has established12' that these have the normal A/B stereochemistry.The absolute configu- ration of auricularic acid was established12* by its partial synthesis from methyl (+)-13-oxo-podocarp-8( 14)-en- 19-oate. The conversion of abieta-8,11,13-triene to (1 5R)-16-hydroxy-ferruginol has been reported. 129 Some other transformations of dehydroabietic acid into intermediates for the synthesis of the coleons have been described.130 Some rearrangement products from the acetylation of totaryl methyl ether have been is01ated.l~~ The activation of the aromatic ring of methyl 0-methyl-podocarpate by metal complex formation continues to be studied.132 Several reports have appeared on the conversion of these diterpenoids into steroid analogue^.'^^-^^^ The modification of ring A of podo-carpic acid with the object of synthesizing quassinoids has been rep0~ted.l~' The attachment of butenolides to the pimarane skeleton and the evaluation of their cardiotonic activity has been described. 138 5 Tetracyclic Diterpenoids 5.1 Kaurenes A number of kaurene 19-malonate and succinate esters have been isolated from Calocephalus knappii (Compositae) and Odixia angusta (Comp~sitae).'~~.140 Esquirolin A from Coleus esquirolii is the 17-monoacetate of ent-kauran- 16p 17-di01.l~~ This plant also affords tricyclic diterpenoids. Abbeokutone has been isolated142 from Glycydendron amazonicum. The structure including the epoxidation of podocarpa-6,8,11,13-tetrane~,~~~ of the phyllocladene isomer calliterpenone has been established the selective oxidation of pirnarane~,~~~ and the rearrangement by X-ray crystallography. 143 Phytochemical investigations of of methyl 8,14,8-epo~ypimaranesl~~ have been reported. The Sideritis canariensis varn. pannosa (Labiatae) have afforded144 X-ray crystal structure of methyl (8R 12R)-8,12-epoxy-iso- canadiol (1 30) and sicanadiol (1 3 1) together with a number of pimara- 15-en-l9-oate obtained by the oxymercuration of known tetracyclic diterpenoids.Examination of S. ferrensis methyl communate has been described.126 gave ferrediol(1 32).145 It is interesting to note the co-occurrence NATURAL PRODUCT REPORTS 1993-5. R. HANSON (137) R' = a-OAc R2=0 R3= &OH (138) R' = R2 = 0 R3 = @OH (149) R' = a-OAc R2 = P-OAc R3 = 0 (150) R' = a-OH R2 = P-OAc R3 = 0 (151) R' = a-OAc R2= P-OH R3= 0 (145) R' = H R2 = OAC R3 = 0 (146) R' = H R2= OAc R3 = a-OH (147) R' =OH R2= H R3 =O of ent-trachylobane atiserene and ent-kaurene diterpenoids in these species. The X-ray crystal structure of grandiflorenic acid (ent-kaur- 9( 1l) 16-dien- 19-oic acid) has that the 9( 1 1)-double bond has a major effect on its conformation relative to ent- kaur- 16-en- 19-oic acid.Some derivatives of ent- 12P-hydroxy- kaur-9( 1I) 16-dien- 19-oic acid have been isolated14' from Lasianthea fruticosa (Compositae). Studies on the microbiological transformation of kaurenoid di terpenes by Gibberella fujikuroi have continued. The presence of a 15-hydroxyl group in ent-7a 15P-dihydroxykaurene in- hibited the oxidation of C-19 beyond the hydroxyl level with hydroxylation occurring predominantly at C-1 lP.14s Different biosynthetic modifications of ring B of ent-kaurenoic acid by (139) R' = OH R2 = 0 (141) R'=OH R2=Me (140) R' = H R2 = FOH (142) R' = OAC R2= Me (143) R' = H R2 = CHZOH Table 4 Some Tetracyclic Di terpenoids from Rabdosia Species Species Diterpenoid Structure Ref. R. dawoensis R.loxothyrsa Zsodon (Rabdosia) R. phyllostachys R. pseudo-irrorata R. sculponeata R. yuennanensis pharicus dawodesin A (1 37)zindognin A (1 38) rabdoloxin A (139) rabdoloxin B (140) isodopharicins A phyllostachysin B (144) pseurata D-F (145)-( 147) sculponeatin D (148)rabyuennane A-C (149)-(151) B and C (141)-(143) 157 158 159,160 161 162 163 164 G. fujikuroi lead to separate groups of metabolite. The bio- transformation of 6-substituted ent-kaur- 16-enes by G.fujikuroi has been to lead to seco-ring B derivatives. Stevioside continues to attract considerable attention with numerous patents being published on its purification modi- fication and application. A review has appeared.150 The enzymology of the glucosylation of steviol in Stevia rebaudiana has been exarninedl5l whilst cultured cells of Eucalyptus perriniana and Coflea arabica are also able to glucosylate stevio1.152 Enzymatic transfructosylation of the related rebau- dioside A has been examined153 in order to enhance its sweetness.The synthesis of nitrophenyl esters of steviol has been ~ep0rted.l~~ Evidence of the structures of oryzalide A (1 33) B (134) and oryzalic acid (1 35) has been pre~ented.'~~ These antimicrobial diterpenes were obtained from strains of rice that are resistant to bacterial leaf-blight. Some unusual Diels-Alder adducts of ent- 15-oxokaur- 16-enes and labdadienes (e.g. 136) have been isolated156 from Xylopia emarginata (Annonaceae). Rabdosia species (Labiatae) include a number of Chinese medicinal herbs. Examination of these has continued to yield novel diterpenoids a number of which possess tumour inhibitory activity.Some of these are given in Table 4. Some simple model 168 0 C02Me (157) OH compounds such as (1 52) based on these compounds have been synthesizedl'j5 as potential tumour inhibitors whilst some tumour-inhibitory analogues (e.g. 153) have been synthesized from fujena1.1'j6 Some molecular rearrangements of the tetra- and pentacylic diterpenoids have been reviewed and the super-acid catalysed isomerization of phyllocladene has been examined.l'j7 The rearrangement of the ketol(l54) with boron trifluoride etherate to inter alia (155) and (156) has been reported.168 5.2 Beyerenes ent-Beyeren- 18-oic acid and the 3,4-secotrachylobanic acid (1 57) have been isolated1'j93 170 from the antimicrobial extract of Croton sonderianus (Euphorbiaceae).The unstable 19-aldehyde elasclepial(l58) (ent-14P-tigloyloxybeyer-15-en- 19-al) has been ~btained"~ from the roots of Elaeoselinum asclepium (Umbel- liferae). The absolute configuration of the trio1 (1 59) has been e~tablished'~~ by X-ray crystallographic methods. 5.3 Atiserenes In recent years some atiserene diterpenes have been isolated from Euphorbia species. ent-( 149- 16P 17-Trihydroxyatisan-3- one (160) was isolated173 from the heartwood of E. fidjiana whilst ent-16P-hydroxyatisan- 19-oic acid (161)174 and the acetate (162)175 have been isolated from the roots of E. sieboldiana. Compound (1 6 1) was incorrectly numbered in the original paper.A further report on the structure of (163) has appeared.17'j 5.4 Aphidicolin and Related Compounds The biological activity of this series of compounds has stimulated interest in their synthesis. The stereochemistry of the reactions of ring D of aphidicolin have been examined in the context of Further compounds of this type have been isolated from Scoparia dulcis (Scrophulariaceae) and it NATURAL PRODUCT REPORTS 1993 + I (163) (164) R' = COCH2CO2H R2= H (165) R' = COCH,*C02H R2= OR' (166) R' = H R2=OH H2R CH20H R' (167) R = H and OH (168) R' = OAc R2 = Me R3 = H (169) R' = H R2 = CH~OAC,R3 = H (170) R' = H R2 = Me R3 = OH (171) R' = H R2 = CHZOH R3 = H has been noted that there are two chemotypes of S.dulcis producing either bicyclic scoparic acid or tetracyclic scopadulcic acid relative^.'^^^ 179 Some relatives of scopadulcic acid the thyrsiflorins A-C (1 64)-( 166) have been isolated1ao from Calceolaria thyrsijlora (Scrophulariaceae) and their structure established by X-ray crystallography. The ent-stemarane (1 67) has been reportedla' from C.polifolia along with thyrsiflorin A. Although these are represented with the opposite absolute stereochemistry there is some ambiguity in the original literature on this point. The stemodanes (168)-( 171) have been obtainedla2 from Stemodia chilensis. The microbiological transformation of stemodin by Cunninghamella echinulata Polyangium cellulosum and Rhizopus arrhizus has been described.la3-5.5 Grayanotoxins Rhodojaponin 111 grayanotoxin 111 and kalmanol have been identified185 as the insect antifeedants in Rhododendron molle.NATURAL PRODUCT REPORTS 1993-5. R. HANSON 1 69 (172) R=H (174) (173) R=OH 0 (178) R=H (179) R=OH Y HO (182) R=H2 (183) R=O 1 OH I OH ' 5.6 Gibberellins A number of books and reviews on the gibberellins have appeared.ls6lgl The partial synthesis of the methyl esters of gibberellin Aa5(1 72) and gibberellin A, (1 73) from gibberellic acid has been reported. lg217-Hydroxy- 16,17-dihydrogibberel- lin A (174) has been foundlS3 in the seeds of Cytisus laburnum (Leguminosae). The gibberellin content of immature apple seed,lS4 maize,lS5 navel orange (Citrus sinensis),lg6 and ~pinach'~'has been analysed.Efficient syntheses of gibberellin A, (175) and 20-norgibber- ellin A, (1 76) have been described.198. lg9 The preparation of gibberellin hapten-protein conjugates and gibberellin affinity probes by the addition of thiols to the 16-enes has been examined.2oo The mass spectra of 7-thiogibberellins have been reported201 whilst the analysis of the NMR spectra in terms of the conformation of gibberellic acid has been made.202 Various aspects of the metabolism of the gibberellins have been studied including the divergence of the 13-hydroxylated and non- 13-hydroxylated pathway in Pisum sativ~m.~~~ The partial purification of two gibberellin 2P-hydroxylases from Phaseofus vulgaris and their inhibition by acylcyclohexanedione derivative^^^"^^^ has been reported.The 8 13-isogibberellin (177) is reported206 to inhibit a gibberellin 3P-hydroxylase from Phaseolus vulgaris. 19-Norgibberell- 16-enes inhibit gibberellic acid biosynthesis in Gibberella fujik~roi.~~' The biotrans-formation of a gibberellin 20+ 19-lactone by G. fujikuroi has been described. 208 I n The occurrence and synthesis of the antheridlogens nas men revie~ed.~~~~~~~ The biosynthesis of antheridic acid (180) from (9,15)-cyclogibberellin A (1 78) and its 3a-hydroxy derivative (1 79) has been observed211 in Anemia phyllitidis. 6 Macrocyclic Diterpenoids and their Cycl izat ion Products Some anomalies have been noted212 in the application of Mosher's method in the determination of the absolute stereochemistry of some marine cembranolides.The isolation has been reported213 of a monomeric counterpart (181) of the biscembranolides obtained previously from a Sarcophyton species. Sarcophytonin E (182) has been obtained214 from an Okinawan soft coral. It is converted to the corresponding butenolide (183) by autoxidati~n.~~~ (-)-Sarcophytol A and ( + )-marasol (1 84) have been isolated216 from a Caribbean sponge Pfexaura Jexuosa whilst eupalmerin (1 85) was ob- tained217 from Eunicea mammosa. The stereochemistry of some of the 13-membered cembranolides from Lobophytum pauci- frorum has been analysed.218 Comparison of X-ray crystal- lographic data with NMR data for a 7&epoxycembranoid that the solid state conformation was retained in solution.The synthesis of cembranes using titanium induced coupling reactions has been reviewed220 whilst the synthesis of the furanocembrane unit in lophotoxin and pukalide has been reported.221The cyclization of an epoxyneocembrene (186) to a secotrinervitane (1 87) with boron trifluoride etherate has been described.222 Some cembranes and cubitanes including calyculone D (1 88) HI * HO--@. HO (192) R' = Ac R2 = BZ (193) R' = Bz R2 = AC have been isolated223 from the sea whip Eunicea calyculata whilst the pseudo-pterane (189) was from the octocoral Pseudopterogorgia acerosa. Its unusual diepoxide structure was confirmed by X-ray analysis. The kansuiphorins A-D (190)-(193) are a group of cytotoxic diterpenes which have been isolated225* 226 from the roots of the Chinese medicinal plant Kansui (Euphorbia kansui).Some modifications of ingenol have been from E. lathyris. There has been considerable interest in the chemistry of taxol in the light of its value as an effective anti-cancer drug.228 A number of new taxanes have been isolated including brevifoliol (194) from Tuxus bre~ifolia,~~' a group of esters (e.g. 195) from T. chinensi~,~~~ and yunnanxane (1 96) from T. yunnanensis.231 The rearrangement of taxol to form (197) has been reported.232 Structure activity relationships in this series have NATURAL PRODUCT REPORTS 1993 Me "CH202C( CH2)' ,Me (190) R=bond (191) R=+ AcO OAc *'OH H 0 -m . "OCGH=CH.C,H, ; OH (205) R = H (206) R = OH been examined.233- 234 The partial synthesis of compounds with a 4(20)-5-oxetane ring has been 7 Micellaneous Diterpenoids Marine organisms have continued to provide a diversity of skeletal types of diterpenoid.Various collections of the alga Dictyota divaricata have afforded a xenicane (198),235 a prenyl germacrene ( 199),236 several dolabellanes (e.g. 200 and 201),23s9 237 an isodolestane (202),237 and a dolestane (203).238 Examination of D. indica gave239 dictinol(204) dictindiol (205) and dictintriol(206). Other dolabellanes have been from the gorgonian Euncea laciniata. The structure (207) has been assigned to isoreiswigin which was from the sponge Epipolasis reiswigi. The NATURAL PRODUCT REPORTS 1993-5.R. HANSON HO OH (213) I OMe asbestinin (208) was isolated242 from the gorgonian Briureum asbestium. Some further litophynins [F G and H (209-211)] have been obtained from a soft Litophyton The brorno-lactone angasiol acetate (212) has been from the sea hare Aplysiu juliuna. Some further spongiane diterpenes exemplified by (21 3) have been from a Great Barrier Reef sponge. The structure of cheloviolene A (214) from the sponge Chelonuplysilla violucea has been established246 by X-ray crystallography. Some related metabo- lites the chelonaplysins have been from other sponges of this family. Shahamin K (2 15) and the spongianes (216) and (217) were from a nudibranch of the genus Chromodoris. The absolute stereochemistry of 9-epidictyol B (218) has been established using the CD exciton chirality method.249 The unusual structure (219) has been for the algal metbolite balearone.Analysis of the NMR spectra of a series of fusicoccons has been in a study of the relationship between phytotoxicity (209) R’ =OH R2 = R3 = H (210) R1,R2= 0,R3= H (211) R’ = R3 = OH R2 = H (216) R’ = H R2 =OAc (217) R’ = R2 = OAc and conformation. The structure (220) has been assigned252 to mulinenic acid which was obtained from Mulinum crassifolium. Further trinervitanes (e.g.,221) have been extracted253 from the defensive secretions of the termite Nusutitermes nigriceps. The chemistry of laurenene has continued to attract attention with on its conversion to a new bridged tetracyclic ring system exemplified by (222).8 References 1 J. R. Hanson Nut. Prod. Rep. 1992 9 1. 2 M. Hasan D. K. Birdi and V. U. Ahmad J. Nut. Prod. 1991,54 1444. 3 N. Rasool V. U. Ahmed and A. Malik Phytochemistry 1991 30 1331. 4 H. Itokawa Y. Ichihara K. Takeya H. Morita and M. Moti- dome Phytochemistry 199 1 30 407 1. 5 M. Bittner A. Schuster and J. Jakupovic Phytochemistry 1991 30 1329. 6 C. Zdero F. Bohlmann R. M. King and H. Robinson Phyto-chemistry 1991 30 1579. 7 L. Quijano F. Gomez-G. E. Sierra-R and T. Rios Phyto-chemistry 1991 30 1947. 8 C. Zdero F. Bohlmann and G. M. Mungai Phytochemistry 1991 30 575. 9 L. Hougaard U. Anthoni C.Christopherson and P. H. Nielsen Phytochemistry 199I 30 3049. 10 F.E. Koehn S. P. Gunasekera D. N. Niel and S. C. Cross Tetrahedron Lett. 1991 32 169. 11 I. C. Alexander K. 0.Pascoe P. Manchard and I. A. D. Williams Phytochemistry 1991 30 1801. 12 M. T. Davies-Coleman and D. J. Faulkner Tetrahedron 1991 47 9743. 13 A. G. Gonzalez E. M. Rodriguez-Perez J. G. Diaz and J. Ber- mejo Barrera J. Nat. Prod. 1991 54 609. 14 A. San Feliciano E. Caballero B. Del Rey and I. Sancho Phytochemistry I99 1 30 3 134. 15 A. San Feliciano J. M. Miguel del Corral M. Gordaliza and M. Angeles Castro Phytochemistry 1991 30 695. 16 D. F. Zinkel and T. V. Magee Phytochemistry 1991 30 845. 17 S. Habtemariam A. I. Gray C. Lavaud G. Massiot B. W. Skel- ton P. G. Waterman and A. H. White J. Chem. SOC. Perkin Trans.I 1991 893. 18 F. Tsichritzis and J. Jakupovic Phytochemistry 1991 30 21 1. 19 C. Zdero F. Bohlmann and R. M. King Phytochemistry 1991 30 1591. 20 C. Zdero F. Bohlmann and H. M. Niemeyer Phytochemistry 1991 30 1597. 21 J. Jakupovic A. Schuster and D. C. Wasshausen Phytochem-istry 1991 30 2785. 22 C. Zdero F. Bohlmann and R. M. King Phytochemistry 1991 30 2991. 23 C. Zdero F. Bohlmann and G. M. Mungai Phytochemistry 1991 30,3297. 24 E. M. Escamilla and A. Ortega Phytochemistry 1991 30 599. 25 C. Zdero F. Bohlmann and H. M. Niemeyer Phytochemistry 1991 30 3669. 26 C. Zdero F. Bohlmann and H. M. Niemeyer Phytochemistry 1991 30 3683. 27 M. T. Davies-Coleman R. B. English and D. E. A. Rivett S. Afr. J. Chem. 1991 44,80.28 P. M. Hon C. M. Lee H. S. Shang Y. X. Cui and H. N. C. Wong Phytochemistry 1991 30 354. 29 K. Ohtani C. Yang C. Miyajima J. Zhou and 0.Tanaka Chem. Pharm. Bull. (Japan) 1991 39 2443. 30 F. Fullas R. A. Hussain E. Bordas J. M. Pezzuto D. D. Soejar- to and A. D. Kinghorn Tetrahedron I99 1 47 85 15. 31 A. A. Ahmed Phytochemistry 1991 30 611. 32 C. Malochet-Grivois P. Cotelle J. F. Biard J. P. Henichart C. Debitus C. Roussakis and J. F. Verbist Tetrahedron Lett. 1991 32 6701. 33 T. Sasaki 1. Ogihara-Umeda H. Nishigor S. Ikegami M. Senda K. Kitani K. Ogawa and T. Nozaki J. Labelled Compd. Radio- pharm. 1991 29 557. 34 H. Kogler and H. W. Fehlhaber Magn. Reson. Chem. 1991 29 993. 35 A. Carpy J. M. Leger J. S. Tandon and A. K. Saxena,Z.Kristal-Iogr.1991 194 229. 36 J. D. Robbins A. Laurenza R. W. Kosley G. J. O’Malley B. Spahl and K. B. Seaman J. Med. Chem. 1991 34,3204. 37 A. Fernandez Mateos C. Maroto Almena and J. de Pascual Teresa Anal. Quim. 1991 87 267. 38 A. Fernandez Mateos 0.Ferrero Barrueco J. de Pascual Teresa and R. Rubio Gonzalez Tetrahedron 1991 47 4375. 39 M. N. Koltsa G. N. Mironov A. N. Aryku and P. F. Vlad Khim. Prir. Seodin. 1991 43 40 A. N. Aryku G. N. Mironov M. N. Koltsa and P. F. Vlad Khim. Prirod. Seodin. 1991 50. 41 A. N. Aryku M. N. Koltsa and P. F. Wad Khim. Prir. Soedin. 1991 209. 42 A. N. Aryku M. N. Koltsa P. F. Vlad 0.S. Kukovineta V. N. Odinokov and G. A. Tolstikov Khim. Prir. Soedin. 1991 343. 43 P. K. Grant K. R. Hanton S.F. Tsai and T. M. Yap. Aust. J. Chem. 1991 44,433. 44 P. K. Grant K. R. Hanton G. P. Lynch J. Simpson and G. C. Slim Aust. J. Chem. 1991 44,897. 45 A. F. Barrero R. M. Quintana and J. Altarejos Tetrahedron 1991,47,4441. 46 Y. Amate A. Garcia-Granados F. A. Lopez and A. Saenz de Buruaga Synthesis 1991 371. 47 R. C. Cambie S. C. Moratti P. S. Rutledge and P. D. Wood- gate Aust. J. Chem. 1991 44,469. 48 R. C. Cambie S. C. Moratti P. S. Rutledge and P. D. Wood- gate Aust. J. Chem. 1991 44,487. 49 S. Hiranuma T. Shimizu and H. Yoshioka Chem. Pharm. Bull. (Japan) 1991 39 2167. 50 S. Hiranuma T. Shimizu Z. H. Qian and H. Yoshioka SYN-LETT. 1991 725. 51 A. J. Aladesanmi and J. J. Hoffmann Phytochemistry 1991 30 1847. 52 S.A. Kouzi and J. D. McChesney J. Nat. Prod, 1991 54 483. NATURAL PRODUCT REPORTS 1993 53 G. Aranda J. Y. Lallemand A. Hammoumi and R. Azerad Tetrahedron Lett. 1991 32 1783. 54 G. Aranda M. S. El Kortbi J. Y. Lallemand A. Neuman A. Hammoumi I. Facon and R. Azerad Tetrahedron 1991 47 8339. 55 S. A. Kouzi and J. D. McChesney Xenobiotica 1991 21 1311. 56 F. Nagashima M. Tori and Y. Asakawa Phytochemistry 1991 30 849. 57 J. G. Urones P. Basabe I. S. Marcos D. Diez Martin V. Jimenez M. J. Sexmero B. Gomez A. M. Z. Slawin and D. J. Williams Phytochemistry 1991 30,3471. 58 C. Labbe M. Castillo and M. Hernandez Phytochemistry 1991 30 1607. 59 J. D. McChesney A. M. Clark and E. R. Silveira J. Nat. Prod. 1991 54 1625. 60 S. S. Zaman N.C. Barua and R. P. Sharma Znd. J. Chem. (B) 1991 30 1054. 61 I. Kubo Y. Asaka and K. Shibata Phytochemistry 1991 30 2545. 62 P. Raha A. K. Das N. Adityachaudhuri and P. L. Majumder Phytochemistry 1991 30 38 12. 63 C. Zdero and F. Bohlmann Phytochemistry 1991 30 607. 64 A. Ohsaki Y. Kasetani Y. Asaka K. Shibata T. Tokoroyama and T. Kubota Phytochemistry 1991. 30 4075. 65 H. Sun X. Chen T. Wang L. Pan Z. Lin and D. Chen Phyto-chemistry 1991. 30 1721. 66 M. Bruno G. Dominguez A. Lourenco F. Piozzi B. Rodriguez G. Savona M. C. De La Torre and N. A. Arnold Phyto-chemistry 1991 30 3693. 67 Z. Min N. Xie S. Zhao C. Wang and Q. Zheng Chin. Chem. Lett. 1991 2 371 (Chem. Abstr. 1991 115 115054). 68 X. Ning Z. Pei S. X. Zhao C. Wang Z.Min and Q. Zheng Phytochemistry 1991 30 4175. 69 M. Bruno A. A. Omar A. Perales F. Piozzi B. Rodriguez G. Savona and M. C. De La Torre Phytochemistry 1991 30 275. 70 M. C.De La Torre M. Bruno F. Piozzi G. Savona B. Rodriguez and A. A. Omar Phytochemistry 1991 30 1603. 71 M. C. De La Torre M. Bruno F. Piozzi G. Savona A. A. Omar A. Perales and B. Rodriguez Tetrahedron 1991 47 3463. 72 M. J. Sexmero Cuadrado M. C. De La Torre B. Rodriguez M. Bruno F. Piozzi and G. Savona Phytochemistry 1991 30 4079. 73 N. Xie Z. Min S. Zhao B. Wu Q.Zheng and P. Zhang Phytochemistry 199 1 30 1963. 74 A. Lourenco M. C. De La Torre B. Rodriguez M. Bruno F. Piozzi and G. Savona Phytochemistry 1991 30 613. 75 A. Lourenco M. C. De La Torre and B. Rodriguez Tetrahedron Lett.1991 32 7305. 76 P. Y. Malakov M. C. De La Torre and B. Rodriguez Tetra-hedron 1991 47 10129. 77 G. Dominguez M. C. De La Torre and B. Rodriguez J. Org. Chem. 1991 56 6595. 78 M. D. Cole P. D. Bridge J. E. Dellar L. E. Fellows M. C. Corn- ish and J. C. Anderson Phytochemistry 1991 30 1125. 79 P. Y. Malakov G. Y. Papanov M. C. De La Torre and B. Rod- riguez Phytochemistry 30 4083. 80 A. Ortega J. Cardenas A. Toscano E. Maldonado A. Aumelas M. R. van Calsteren and C. Jankowski Phytochemistry 1991 30 3357. 81 B. Esquivel 0.Esquivel J. Cardenas A. Adela-Sanchez T. P. Ramamoorthy R. Alfredo-Toscano and L. Rodriguez- Hahn Phytochemistry 1991 30 2335. 82 M. C. Fernandez B. Esquivel J. Cardenas A. A. Sanchez R.Alfredo-Toscano and L. Rodriguez-Hahn Tetrahedron 1991 47 7199. 83 H. Achenbach and H Hemrich Phytochemistry 1991 30 1957. 84 Atta-ur-Rahman S. Ahmad M. I. Choudhary and S. Malik Phytochemistry 1991 30 356. 85 T. B. Chen and D. F. Wiemer J. Nat. Prod. 1991 54 1612. 86 H. Itokawa N. Totsuka H. Morita K. Takeya Y. Iitaka E. P. Schenkel and M. Motidome Chem. Pharm. Bull. (Japan) 1990 38 3384. 87 H. Morita M. Nakayama H. Kojima K. Takeya H. Itokawa E. P. Schenkel and M. Motidome Chem. Pharm. Bull. (Japan) 1991 39 693. 88 B. P. Ying and I. Kubo Phytochemistry 1991 30 1951. 89 L. L. Landucci and D. F. Zinkel Holzforschung 1991 45 341 (Chem. Abstr. 1991 116 41 797). NATURAL PRODUCT REPORTS 1993-J. R. HANSON 90 Y. Xu S.Fang and Q. He Zhiwu Xuebao 1991,33 646 (Chem. Abstr. 1992 116 170 132). 91 J. M. Fang C. I. Lang W. L. Chen and Y. S. Cheng Phyto-chemistry 1991 30 2793. 92 A. F. Barrero J. F. Sanchez E. J. Alvarez-Manzaneda M. Munoz Dorado and A. Haidour Phytochemistry 1991 30 593. 93 K. Liu and E. Roder Planta Med. 1991 57 395. 94 Y. Tezuka H. Hirano T. Kikuchi and G. Xu Chem. Pharm. Bull. (Japan) 1991 39 593. 95 S. Huneck Pharmazie 1991 46 60 (Chem. Abstr. 1991 114 244 255). 96 K. Nishiya T. Kimura K. Takeya H. Itokawa and S. R. Lee Phytochemistry 1991 30 2410. 97 A. C. Pinto P. P. S. Queiroz and W. S. Garcez J. Braz. Chem. SOC.,1991 2 25. 98 A. C. Pinto L. M. M. Valente and M. G. Pizzolatti Phyto-chemistry 1991 30 3136. 99 Y. Ikeshiro I.Hashimoto Y. Iwamoto I. Mase and Y. Tomita Phytochemistry I99 1 30 279 1. 100 G. Haro M. Mori M. 0.Ishitsuka T. Kusumi Y. Inouye and H. Kakisawa Bull. Chem. SOC. (Japan) 1991 64,3422. 101 A. G. Gonzalez L. S. Andres J. G. Luis I. Brito and M. L. Rodriguez Phytochemistry 1991 30 4067. 102 X. Sun H. Luo T. Sakai and M. Niwa Tetrahedron Lett. 1991 32 5797. 103 B. Li F. Niu Z. Lin H. Zhang Z. Wang and H. Sun Phyto-chemistry 199 1 30 38 15. 104 Y. Ikeshiro I. Mase and Y. Tomita Planta Med. 1991 57 588. 105 X. Z. Lu H. W. Luo J. Ji and H. Cai Yaoxue Xuebao 1991,26 193 (Chem. Abstr. 1991 115 89110). 106 G. Topci and A. Ulubelen Phytochemistry 1991 30 2412. 107 A. Ulubelen G. Topci S. Chen P. Cai and J. K. Snynder J. Org. Chem.1991 56 7354. 108 M. Bruno G. Savona F. Piozzi M. C. De La Torre B. Rodri- guez and M. Marlier Phytochemistry 1991 30 2339. 109 S. F. Kimbu F. Keumedjio B. L. Sondengam and J. D. Con- nolly Phytochemistry I99 1 30,6 19. 110 Y. Endo T. Ohta and S. Nozoe Tetrahedron Lett. 1991 32 3083. 111 A. V. B. Sankaram and M. Marthandamurthi Phytochemistry 1991 30 359. 112 C. Li Z. Lin H. Zheng J. Zhang and H. Sun Chin. Chem. Lett. 1991 2 223. 113 D. Borghi L. Baumer M. Ballabio E. Arlandini N. Crespi-Perellino A. Minghetti and F. F. Vincieri J. Nat. Prod. 1991,54 1503. 114 P. C. Ma X. Y. Lu J. J. Yang and Q. T. Zheng Yaoxue Xuebao 1991 26 759 (Chem. Abstr. 1992 116 143775). 115 D. F. Yu B. H. Hu G.P. Chen C.X. Yang J. Yang J. Y.Xu and L.Z. Li Yaoxue Xuebao 1990 25 929 (Chem. Abstr. 1991 114 160 745). 116 L. Zhang Z. X. Zhang D. K. An and C. Kong Yaoxue Xuebao 1991 26 515. 117 I. Kubo M. Himejima and B. P. Ying Phytochemistry 1991 30 1467. 118 I. Kubo and B. P. Ying Phytochemistry 1991 30 1967. 119 I. Kubo and B. P. Ying Phytochemistry 1991 30 3476. 120 I. Kubo M. Sutsina and K. S. Tan Phytochemistry 1991 30 455. 121 S. J. Bloor and B. P. J. Molloy J. Nat. Prod. 1991 54 1326. 122 K. Borgschulte S. Rebuffat W. Trowitzsth-Kienast D. Schom- burg J. Pinon and B. Bodo Tetrahedron 1991 47 8351. 123 R. C. Cambie A. C. Grimsdale P. S. Rutledge M. F. Walker and P. D. Woodgate Aust. J. Chem. 1991 44 1553. 124 M. John S. Rudolph and E. Haslinger Liebigs Ann. Chem. 1991 885.125 N. Sam B. A. San-Miguel M. Taran and B. Delmond Tetra-hedron 1991 47 9187. 126 A. F. Barrero J. F. Sanchez J. Altarejos A. Perales and R. Torres J. Chem. SOC. Perkin Trans. I 1991 2513. 127 G. Dominguez J. A. Hueso-Rodriguez M. C. De La Torre and B. Rodriguez Tetrahedron Lett. 1991 32 4765. 128 A. Abad M. Arno M. Peiro and R. J. Zaragoza Tetrahedron I99 1 47. 3829. 129 T. Matsumoto H. Terao and S. Imai Bull. Soc. Chem. (Japan) 1991 64,2855. 130 S. Imai H. Terao and T. Matsumoto Chem. Pharm. Bull. (Japan) 1991 39 3041. 131 J. G. Bendall R. C. Cambie M. R. Metzler S. C. Moratti P. S. Rutledge and P. D. Woodgate Aust. J. Chem. 1991 44 1347. 132 R. C. Cambie L. G. Mackay P. S. Rutledge M. Tercel and P. D. Woodgate J. Organomet.Chem. 1991 409 263. 133 R. C. Cambie M. R. Metzler P. S. Rutledge and P. D. Wood- gate Aust. J. Chem. 1991 # 1383. 134 A. Abad C. Agullo M. Arno L. R. Domingo J. Rozalen and R. J. Zaragoza Can. J. Chem. 1991 69 379. 135 A. Abad C. Agullo M. Arno A. C. Cunat L. R. Domingo and R. J. Zaragoza Anales de Quim. 1991 87 116. 136 A. Abad C. Agullo M. Arno L. R. Domingo and R. J. Zara- goza Anal. Quim. 1991 87 270. 137 R. C. Cambie M. P. Hay L. Larsen C. E. F. Rickard P. S. Rut-ledge and P. D. Woodgate Aust. J. Chem. 1991 44,821. 138 A. San Feliciano M. Modarde E. Caballero B. Hebrero F. Tome P. Prieto and M. J. Montero Eur. J. Med. Chem. 1991 26 749. 139 J. Jakupovic U. Ganzer F. Bohlmann and R. M. King Phyto-chemistry 199 1 30 265 1.140 C. Zdero F. Bohlmann and A. Anderberg Phytochemistry 1991 30 2703. 141 C. Li G.Zhang Z. Lin H. Zheng and H. Sun Yunnan Zhiwu Yanjiu 1991 13 216. 142 W. F. Tinto G. Blyden W. F. Reynolds and S. McLean J. Nat. Prod. 1991 54 1127. 143 W. H. Wong C. Wei S. E. Luke and T. C. W. Mak Acta Crystallogr. Sect. C 1991 47 906. 144 B. M. Fraga R. Guillermo M. G. Hernandez T. Mestres and J. M. Arteaga Phytochemistry 1991 30 3361. 145 B. M. Fraga M. G. Hernandez J. M. H. Santana and J. M. Arteaga Phytochemistry 1991 30 913. 146 W. F. Reynolds A. J. Leugh J. F. Sqwyer R. G. Enriquez B. Ortiz and F. Walls Acta Crystallogr. Sect. C 1991 47 973. 147 M. Ahmed J. Jakupovic and V. Castro Phytochemistry 1991 30 1712. 148 B. M. Fraga M. G.Hernandez and P. Gonzalez Phytochemistry 1991 30 2567. 149 M. Alam J. R. Hanson and F. Y. Sarah Phytochemistry 1991 30 807. 150 A. D. Kinghorn and D. D. Soejarto Food. Sci. Technol. 1991,48 157. 151 H. Shibata S. Sonoke H. Ochiai H. Nishihashi and M. Yamada Plant. Physiol. 1991 95 152. 152 Y.Orihara K. Saiki and T. Furuya Phytochemistry 1991 30 3989. 153 H. Ishikawa S. Kitahata K. Ohtani and 0.Tanaka Chem. Pharm. Bull. (Japan) 1991 39 2043. 154 X. Liu Q. Su W. Shan and H. Hansheng Wuhan Daxue Xuebao Ziran Kexueban 1991 126 (Chem. Abstr. 1992 116 129300). 155 Y. Kono J. Uzawa K. Kobayashi Y. Suzuki M. Uramoto A. Sakurai M. Watanabe T. Teraoka and D. Hosokawa Agric. Biol. Chem. 1991 55 803. 156 W. Vilegas J. D. A. Felicio N.F. Roque and H. E. Gottlieb Phytochemistry 1991 30 1869. 157 Q. Zhao G. Wang Z. Zheng H. Xue Y. Zhang H. Sun Z. Shen and Z. Lin Yunnan Zhiwu Yanjiu 1991 13 205 (Chem. Abstr. 1992 116 124850). 158 H. Sun Z. Lin S. Shen Y. Takeda and T. Fujita Phyto-chemistry 1991 30 603. 159 Z. Wang P. Cheng Z. Min Q. Zheng C. Wu M. Xu Y. Gue M. Mizuno M. Iinuma and T. Tanaka Phytochemistry I99 1 30 3699. 160 Z. Wang and P. Cheng Chin. Chem. Lett. 1991 2 847 (Chem. Abstr. 1992 116 194622). 161 Y. Chen L. Sun and H. Sun Yunnan Zhiwu Yanjiu 1991,13,331 (Chem. Abstr. 1992 116 710 109). 162 Y. Li and Y. Chen Phytochemistry 1991. 30 283. 163 R. Zhang H. Zhang Y. Zhen and H. Sun Chin. Chem. Lett. 1991 2 293. 164 Y. Chen X. Shi and P. Zheng Phytochemistry 1991 30 917.165 K. Fuji H. J. Xu H. Tatsumi H. Imamhori N. Ito M. Node and M. Inaba Chem. Pharm. Bull. (Japan) 1991 39 685. 166 M. S. Ali M. K. Baynham J. R. Hanson and P. B. Hitchcock J. Chem. SOC. Perkin Trans. I 1991 2679. 167 N. D. Ungur A. N. Barba and P. F. Vlad Khim. Prirod. Soedin. 1991 3. 168 T. Nakano M. A. Maillo A. Usubillaga A. T. McPhail and D. R. McPhail Tetrahedron Lett. 1991 32 7667. 169 J. D. McChesney A. M. Clark and E. R. Silveira Pharm. Re- search 1991 8 1243 (Chem. Abstr. 1991 116 102666). 170 J. D. McChesney A. M. Clark and E. R. Silveira J. Nut. Prod. 1991 54 1625. 171 M. Grande B. Mancheno and M. J. Sanchez Phytochemistry 1991 30 1977. 172 K. A. Abboud S. H. Simonsen E. F. Lee and T. J. Mabry Acta Crystallogr.Sect. C 1991 47 782. 173 R. C. Cambie A. R. Lal P. S. Rutledge and P. D. Woodgate Phytochemistry 1991 30 287. 174 Y. L. Ding and Z. J. Jia Phytochemistry 1991 30 2413. 175 Z. Jia and Y. Ding Planta Med. 1991 57 569. 176 Y. Ding Z. Jia Q. Wang J. Chen and Y. Liu Chin. J. Chem. 1991 9 131 (Chem. Abstr. 1991 115 131957). 177 C. J. Rizzo and A. B. Smith 111 J. Chem. SOC. Perkin Trans. 1 1991 969. 178 T. Hayashi K. Okamura M. Kawasaki and N. Morita Phyto-chemistry 1991 30 3617. 179 T. Hayashi S. Asano M. Mizutani N. Takeguchi T. Kajima S. Okamura and N. Morita J. Nut. Prod. 1991 54 802. 180 M. C. Chamy M. Pionvano J. A. Garbarino C. Miranda V. Gambaro M. L. Rodriguez C. Ruiz-Perez and I. Brito Phyto-chemistry 1991 30 589.181 M. C. Chamy M. Piovano J. A. Garbarino and V. Gambaro Phytochemistry 1991 30 3365. 182 M. C. Chamy M. Piovano J. A. Garbarino and V. Gambaro Phytochemistry 1991 30 1719. 183 F. A. Badria and C. D. Hufford Phytochemistry 1991 30 2265. 184 C. D. Hufford F. A. Badria M. Abou-Karam W. T. Shier and R. D. Rogers J. Nut. Prod. 1991 54 1543. 185 J. A. Klocke M. Y. Hu S. F. Chiu and I. Kubo Phytochemistry 1991 30 1797. 186 ‘Plant Growth Substances 1988’ ed. RP. Pharis and S. B. Rood Springer-Verlag Berlin 1990. 187 Gibberellin 1989 ed. N. Takahashi B. 0.Phinney and J. Mac- Millan Springer Verlag New York 1991. 188 L. N. Mander Science Progress 1991,7533 (Chem. Abstr. 1992 116 55497). 189 M. H. Beale and C. L. Willis Methods Plant Biochemistry 1991 7 289.190 G. Adam B. Voigt M. Lischewski A. Schierhorn A. Priess and L. Kutschabsky Studies Nut. Prod. Chem. 1991 8 115. 191 G. Adam B. Voight and M. Lischewski Chem. Plant Protection 1991 7 51. 192 K. V. Bhasker W. L. A. Chu P. A. Gaskin L. N. Mander N. Murofushi D. W. Pearce R. P. Pharis N. Takahashi and I. Yamaguchi Tetrahedron Lett. 1991 32 6203. 193 P. Picciarelli A. Piaggesi and A. Alpi Phytochemistry 1991 30 1789. 194 J. T. Lin A. E. Stafford and G. L. Steffens Agric. Biol. Chem. 1991 55 2183. 195 N. Murofushi I. Honda R. Hirasawa I. Yamaguchi N. Taka- hashi and B. 0.Phinney Agric. Biol. Chem. 1991 55 435. 196 S. M. Poling J. Agric. Food Chem. 1991 39 677. 197 M. Talon J. A. D. Zeevart and D. A.Gage Plant Physiol. 1991 97 1521. 198 M. H. Beale J. MacMillan I. K. Makinson and C. L. Willis J. Chem. SOC. Perkin Trans. 1 1991 1191. 199 A. Chen J. MacMillan and C. L. Willis J. Chem. SOC. Perkin Trans. 1 1991 3235. 200 M. H. Beale J. Chem. SOC. Perkin Trans. I 1991 2559. 201 D. Voight and G. Adam J. Prakt. Chem. 1991 333 237. 202 N. Marchettini Y. Yang and C. Rossi J. Phys. Chem. 1991,95 10811. 203 Y. X. Zhu P. J. Davies and A. Halinska Plant Physiol. 1991 97 26. 204 D. L. Griggs P. Hedden and C. M. Lazarus Phytochemistry 1991 30 2507. 205 D. L. Griggs P. Hedden K. E. Temple-Smith and W. Rade- macher Phytochemistry 1991 30 2513. 206 T. Saito S. S. Kwak Y. Komiya H. Yamane A. Sakurai N. Murofushi and N. Takahashi Plant Cell Physiol.1991 32 239. 207 M. S. Ali M. K. Baynham and J. R. Hanson Phytochemistry 1991 30 2227. 208 M. S. Ali C. A. Davis and J. R. Hanson Phytochemistry 1991 30 3967. 209 H. Yamane in ref. 187 p. 378. 210 M. Furber L. N. Mander and G. L. Patrick in ref. 187 p. 398. 21 1 T. Yamaguchi N. Oyama H. Yamane N. Murofushi N. Takahashi H. Schraudolf M. Furber L. N. Mander G. L. Patrick and B. Twitchin Phytochemistry 1991 30 3247. NATURAL PRODUCT REPORTS 1993 212 T. Kusumi Y. Fujita I. Ohtani and H. Kakisawa Tetrahedron Lett. 1991 32 2923. 213 M. 0.Ishitsuka T. Kusumi and H. Kakisawa Tetrahedron Lett. 1991 32 2917. 214 M. Kobayashi and T. Hirase Chem. Pharm. Bull. (Japan) 1991 39 3055. 215 M. Kobayashi J. Chem. Res. (3,1991 310.216 M. Peniston and A. D. Rodriguez J. Nut. Prod. 1991 54 1009. 217 L. A. Fontan and A. D. Rodriguez J. Nut. Prod. 1991 54 298. 218 K. Iguchi M. Kitade Y. Yamada A. Ichikawa I. Ohtani T. Kusumi and H. Kakisawa Chem. Lett. 1991 319. 219 J. E. Berg A. Lacksonen and I. Wahlberg Tetrahedron 1991,47 9915. 220 J. E. McMurry and R. G. Dushin Stud. Nut. Prod. Chem. 1991 8 15. 221 M. P. Astley and G. Pattenden SYNLETT. 1991 335. 222 T. Hirukawa A. Koarai and T. Kato J. Org. Chem. 1991 56 4520. 223 J. Shin and W. Fenical J. Org. Chem. 1991 56 1227. 224 F. W. Tinto L. John A. J. Lough W. F. Reynolds and S. McLean Tetrahedron Lett. 1991 32 4661. 225 T. W. Wu Y. M. Lin M. Haruna D. J. Pan T. Shingu Y. P. Chen H. Y. Hsu T. Nakano and K.H. Lee J. Nut. Prod. 1991 54 823. 226 D. J. Pan C. Q.Hu J. J. Chang T. T. Y. Lee Y. P. Chen H. Y. Chen H. Y. Hsu D. R. McPhail A. T. McPhail and K. H. Lee Phytochemistry 1991 30 1018. 227 R. Bagavathi B. Sorg and E. Hecker Z. Naturforsch. B 1991 46 1425. 228 D. G. I. Kingston Pharmacol. Ther. 1991 52 1. 229 F. Balza S. Tachibana H. Barrios and G. H. N. Towers Phyto-chemistry 1991 30 1613. 230 Z. Zhang and Z. Jia Phytochemistry 1991 30 2345. 231 W. Chen P. Chang B. Wu and Q. Zheng Chin. Chem. Lett. 1991 2 441 (Chem. Abstr. 1992 116 191082). 232 G. Samaranayake N. F. Magri C. Jitrangsri and D. G. I. Kingston J. Org. Chem. 1991 56 51 14. 233 F. Gueritte-Voegelein D. Guenard F. Lavelle M. T. Le Goff L. Mangatol and P. Potier J.Med. Chem. 1991 34 992. 234 C. S. Swindell,N. E. Krauss S. B. Honvitz and 1. Ringel J. Med. Chem. 1991 34 1176. 235 L. Ettouati A. Ahond C. Poupat and P. Potier Tetrahedron 1991 47 9823. 236 G.M. Koenig A. D. Wright and 0.Sticher Phytochemistry 1991 30 3679. 237 C. B. Rao G.Trimurtulu D. V. Rao S. C. Babzin D. M. Kush- lan and D. J. Faulkner Phytochemistry 1991 30 1971. 238 L. Li and Q.Deng Chin. Chem. Lett. 1991,2,621 (Chem. Abstr. 1992 116 191077). 239 V. U. Ahmed S. Parveen S. Bano W. Shaikh and M. Shameel Phytochemistry 1991 30 1015. 240 S. Shin and W. Fenical J. Org. Chem. 1991 56 3392. 241 Y. Kashman and S. Hirsch J. Nut. Prod. 1991 54 1430. 242 J. J. Morales D. Lorenzo and A. D. Rodriguez J. Nut. Prod. 1991 54 1368. 243 M.Ochi K. Yamada K. Futatsugi H. Kotsuki and K. Shibata Heterocycles 199 1 32 29. 244 Atta-ur-Rahman K. A. Alvi S. A. Abbas T. Sultana M. Shamezi M. I. Choudhary and J. C. Clardy J. Nut. Prod. 1991 54 886. 245 S. P. Gunasekera and F. Schmitz J. Org. Chem. 1991 56 1250. 246 J. S. Buckleton E. C. Cambie and G. R. Clark Acta Crystallogr. Sect. C 1991 47 1438. 247 S. C. Bobzin and D. J. Faulkner J. Nut. Prod. 1991 54 225. 248 E. D. de Silva S. A. Morris S. Miao E. Dumolei and R. J. Anderson J. Nut. Prod. 1991 54 993. 249 P. Arroyo M. Norte J. T. Vazquez and K. Nakanishi J. Org. Chem. 1991 56 2671. 250 V. Amico M. Piattelli P. Neri and M. Recupero Gazz. Chim. Ztal. 1991 121 335. 251 A. Ballio S. Castellano S. Cerrini A. Evidente G.Randazzo and A. L. Segre Phytochemistry 1991 30 137. 252 L. A. Loyola G. Morales B. Rodriguez J. Jimenz-Barbero S. Pedreros M. C. De La Torre and A. Perales J. Nut. Prod. 1991 54 1404. 253 I. Valterova M. Budesinsky and J. Vrkoc Collect. Czech. Chem. Commun. 1991 56 2969. 254 R. E. Corbett J. R. Guild D. E. Lauren and R. T. Weavers Aust. J. Chem. 1991 44 1139.

ISSN:0265-0568    

DOI:10.1039/NP9931000159

出版商:RSC    

年代:1993

数据来源: RSC

摘要:

Chemical and Biochemical Manipulations of Nucleic Acids M. J. McPherson and J. H. Parish Department of Biochemistry and Molecular Biology The University of Leeds Leeds LS2 9JJ An update to molecular biological technology 1 Introduction 2 Recombinant DNA Vectors 2.1 Background to Plasmids and Bacteriophage M 13 2.2 Phagemids 2.3 Lambda ZAP 2.4 Yeast Vectors as Examples of Eukaryotic Systems 3 Nucleic Acid Polymerases 3.1 Enzymology 3.2 Polymerases used in DNA Manipulation 4 Polymerase Chain Reaction (PCR) 4.1 Historical Development of the PCR 4.2 Principles and Practice of the PCR 4.2.1 Principles of the PCR 4.2.2 Fidelity of Taq polymerase 4.2.3 Contamination Problems of PCR 4.3 Practical Considerations for the PCR 4.3.1 Instrumentation 4.3.2 Reagents 4.3.3 Templates 4.3.4 Primers 4.3.5 Hot Start PCR 4.3.6 Analysis and Recovery of PCR Products 4.3.7 Manipulation of PCR Products 4.4 Applications of the PCR 4.4.1 Gene Cloning 4.4.2 Mutagenesis and Recombination 4.4.3 Genome Mapping 4.4.4 Evolutionary and Archaeological Studies 4.4.5 Forensic and Pathological Analysis 4.4.6 Medical Diagnosis 5 DNA Sequencing 5.1 Conventional Sequencing 5.2 Automated Sequencing 5.2.1 Detection and Collation 5.2.2 Sequencing Reactions and Gel Loading 5.2.3 Vision Assisted Robotics 5.3 Megabase Sequencing Developments 5.3.1 Mul tispect ral- mu1 tiplex Sequencing 5.3.2 Immobilized Oligonocleotide Sequencing 6 Computer Applications 6.1 Hardware and Software 6.2 Databases 6.3 Sequence Analysis 6.4 Prediction and Structure Analysis 7 Site-directed Mutagenesis 7.1 Phosphothioate Mutagenesis 7.2 Saturation Mutagenesis 7.2.1 Enzymatic Nucleotide Misincorporation 7.2.2 Spiked Oligonucleotides 8 Chemistry and Biochemistry of RNA 8.1 Structure of RNA 8.1.1 Primary Structure 8.1.2 Secondary Structure 8.2 Chemical Synthesis of RNA 8.3 Small Nuclear Ribonucleoprotein Particles and Ri bozymes 8.3.1 RNA Processing 8.3.2 Small Nuclear Ribonucleoprotein Particles 8.3.3 Ribozymes 8.3.4Hammerhead Ribozymes 8.4 Antisense Nucleic Acids 8.4.1 Antisense RNA 8.4.2 Other Antisense Nucleic Acids 8.5 Elucidation of RNA Structure 9 Non-isotopic Labelling of DNA 9.1 Biotin 9.1.1 Labelling DNA 9.1.2Detection of Biotin Labelled DNA 9.2 Digoxigenin 9.3 Enhanced ChemiLuminescence (ECL) 9.3.1 Modified ECL Systems 10 Magnetic Separation of Nucleic Acids 11 Conclusions 12 References 1 Introduction We follow the precedent of our earlier articles’ in reviewing those chemical and biochemical techniques that have current applications in applied molecular biology.It is not on the whole our intention to anticipate such applications.For example RNA synthesis appears in this review although it was omitted from the 1987 review:’ this does not imply that the methods for chemical synthesis of 3’,5’-oligoribonucleotides have been invented since 1987,but rather that within the last few years the technique has become important. The advent of recombinant DNA (‘ rDNA’) technology resulted in an enormous expansion in the applications of molecular biology during the 1980’s. The chemical and biological background has been reviewed previously. The present review coincides with the exploitation of an equally powerful and in certain respects complementary technique the polymerase chain reaction ‘PCR’ the importance of which is emphasized by the publication of several books3s4 and a journal5 devoted to the technology.PCR is a key tool for molecular biology and provides a rapid and powerful technique for the amplification of DNA sequences in vitro. The PCR is now routinely used for gene cloning analysis and manipulation in many molecular biology laboratories. It has also found wide application in medicine ;including diagnosis of genetic disease mutational analysis forensic pathology and is proving im- portant in such programmes as the mapping and sequencing of the human genome. With respect to the last traditional DNA sequencing approaches are not suitable for generating data at the rate required for completion of the project within a reasonable time frame. New approaches are therefore being developed which involve automation and corresponding devel- opments in computer hardware and software.We also provide a brief review of developments in the directed mutagenesis of DNA. Recent progress in the field of RNA chemistry is considered and among other topics we cover the use of antisense RNA. Some attention is given to related progress in the field of synthetic antisense DNA which (a) is amenable to chemical modification (b) is providing new approaches to nucleic acid chemistry (c) represents a key research tool for the study of gene expression at the cellular level and (d) offers scope for significant advance in certain clinical treatments. Finally we briefly deal with non-isotopic labelling and detection systems for DNA and the use of paramagnetic particles for the magnetic separation of DNA molecules.175 I76 NATURAL PRODUCT REPORTS 1993 F' factor Intragenic complementation illustrated by reference to alpha-peptide and P-galactosidase. The E. coli chromosome is not shown. Thick arrows represent gene expression. (a) expression of genes for pilus synthesis (b) expression of gene for defective /3-galactosidase (c) attachment site for MI3 phage (d) entry of MI3 and synthesis of replicative form (RF) (e) expression of alpha-peptide gene MCS (multiple cloning site). Scheme 1 2 Recombinant DNA Vectors Two commonly used vectors are based on plasmids and/or bacteriophage M 13.l Here we illustrate developments in the design of versatile vectors in current use.2.1 Background to Plasmids and Bacteriophage M13 Plasmids are relatively small double stranded circular molecules that usually carry one or more gene encoding resistance to an antibiotic allowing selection in E. coli. They can also exist in relatively high copy number (20-40 copies per cell) can be purified relatively easily and have unique sites for commonly used restriction enzymes. Bacteriophages such as M13 and fd have features which make them attractive vectors for some rDNA procedures. During their life cycle they exist as single stranded DNA molecules which are packaged into filamentous phage coats and appear in high titre (-10l2 phage per ml culture supernatant). The single stranded DNA provides an excellent template for DNA sequencing and many mutagenesis procedures.M13 has been modified to provide a useful and widely used colour selection system allowing distinction between wild type and recombinant clones and it is worth briefly describing this system. The selection scheme relies upon the detection in vivo of bacterial colonies or phage plaques in which gene(s) for P-galactosidase are expressed. The chromo- any recombinant will consequently contain an insert that inactivates the a-peptide gene and recombinant plaques will consequently appear as white.6 2.2 Phagemids Phagemids' represent DNA molecules within which the useful properties of both plasmids and M 13/fd bacteriophage have been combined. A classical example of a phagemid is pBluescript (pBS) this (2.95 kbp) is a smaller derivative of pBR322l (4.3 kbp) carrying only one drug resistance gene but incorporating a number of additional sequences designed for cloning and expression (Figure 1).A multiple cloning site (MCS) constructed from synthetic DNA and containing a range of unique restriction sites is present within the a-peptide coding region of the P-galactosidase gene. Cloning within this MCS allows the same colour selection for colonies containing recombinant or wild-type molecules as for M 13 plaques. Phagemids also carry the origin of replication of phage fd. When a cell carrying a phagemid is infected by an M 13 phage the replicative functions of the phage allow the replication of single stranded phagemid DNA which then becomes packaged in pseudophage particles.These particles are capable of infecting new bacterial cells where the phagemid can then replicate as a plasmid. The single stranded phagemid DNA can noside (commonly referred to as X-gal or BCIG) originally designed as a histochemical reagent is hydrolysed by P-galactosidase to products that generate an intense blue insoluble substituted indigo. The E. coli host strain contains a large plasmid (F' factor) that expresses genes for F-type pili which constitute the receptors for MI3 phage and also an incomplete P-galactosidase lacking the correct N-terminal sequence. The cells are infected or transfected' with an M13 vector that expresses the 'a-peptide' which is a gene for the defective N-terminal region of /3-galactosidase and the tech- nique relies upon the fact that the two portions of the enzyme molecule interact and as a result of intragenic complementation (Scheme l) the enzyme is expressed and on agar plates containing X-gal the plaques are consequently blue.The cloning site in the M13 vector is within the a-peptide gene and genic substrate 5-bromo-4-chlor-3-indolyl-/3-~-galacto-pyra-readily be extracted from the phage particles in the culture supernatant for use in a variety of experimental procedures. The orientation of the fd origin of replication (ori)also dictates which strand of the DNA will be 'rescued'. For pBS there are therefore four alternative vectors which differ according to the relative orientations of both the MCS and the ori sequences.Technically this allows selection of a suitable vector for the directional cloning and of a particular DNA fragment and the subsequent rescue of a particular DNA strand. The MCS is flanked by promoters for two different phage RNA polymer-ases T3 and T7 and therefore for any one recombinant the sense and antisense transcripts (Section 8.4) can be obtained. 2.3 Lambda ZAP Previously' we omitted any discussion of the bacteriophage A. NATURAL PRODUCT REPORTS 1993-M. J. McPHERSON AND J. H. PARISH ri PstI ColE1 ColE1 Figure 1Arrows represent genes/origins of replication and directions of transcription. Three cloning sites in pBR322 are shown. In pBS the multiple cloning site (MCS) is flanked by two promoters labelled P (T7) and P (T3); see text for explanation.pBS genes include the alpha peptide sequence with MCS. The sketch is that of the ‘+version’; the fd origin is in opposite orientation in the -version. (a) Cloning of insert DNA into the pBS MCS of h ZAP (b) superinfection with M13 leading to pBS replication (c) rescued pBS carrying insert DNA from selected lambda clone. Scheme 2 However following the discussion of the pBS phagemid it is worth briefly mentioning an extremely elegant cloning system involving a h phage. Phage A itself is an example of a temperate virus that following its infection of a cell can either propagate vegetatively or its DNA sequence can become integrated into the host genome in a form referred to as ‘prophage’. A cell whose chromosome contains prophage is referred to as a ‘lysogen’.The h genome is of some 50 kbp. Features of the system (that is understood in great detail’) include the facts that regulatory parts of the genome (involved in the establishment and maintenance of lysogeny and the induction of a lysogen) can be dispensed with for vegetative propagation and the assembly of h virus particles (which can readily be performed in vitro) has a loose requirement for a lambda (or recombinant) DNA molecule of around the size of 50 kbp. The major advantage of bacteriophage h is the ability to screen gene libraries efficiently. A disadvantage is that the relatively large size of the genome presents difficulties in recovering the cloned gene from the phage genome. A modified form of bacteriophage A called h ZAP has been generated by Stratagenes (Scheme 2) in which a non-essential part of the h genome has been replaced by a copy of pBS.DNA can therefore be cloned within the MCS of pBS while the cloning system offers the many advantages of lambda including efficient screening of gene librarie~.~ Once a clone carrying the required gene has been selected from the lambda ZAP library the cells carrying this clone can be superinfected with bacteriophage M 13. Replicative functions of M 13 then allow the copying of single stranded molecules from the pBS portion of the lambda ZAP including the insert within the pBS MCS. These single stranded pBS molecules are then packaged within M13 coats to generate pseudophage particles which are then used to infect fresh E.coli cells. Colonies can then be selected by resistance to ampicillin by virtue of the amp“ gene carried by pBS and the rescued plasmid clone. Thus the system essentially allows the sub-cloning in vivo of a bacteriophage lambda insert into a much smaller and more manageable phagemid pBS thereby circumventing time-consuming and tedious DNA purification restriction digestions DNA fragment recovery vector preparation and restriction ligation and transformation of cells. 2.4 Yeast Vectors as Examples of Eukaryotic Systems It is outside the scope of this review to discuss eukaryotic cloning vectors systematically but we choose yeast vectors as illustrative of the types of vector system that can be developed. Yeast spheroplasts can be transformed and recombinants recovered.lo Other reviews’l discuss applications of yeast vectors and eukaryotic vectors in general. Yeast vectors contain genetic markers selectable in yeasts (either fungicide resistance or the complementation of auxotrophic defects) and an origin of replication and selectable markers for selection and maintenance in E. coli. The minimal requirement is thus met because recombination frequencies are so high in fungi that such vectors can integrate into the chromosome the efficiency of this can be increased by linearizing the plasmid before transformation into yeast.12 Although such vectors cannot be NPR 10 NATURAL PRODUCT REPORTS 1993 I YAC2 /u RA3 BarnHI Ir TRPl ARSl CEN4 uRA3 -right arm insertDNA TRPl ARSl CEN4 I.uRA3 4 4 1 Markers for selection and maintenance in E. coli are not shown. (a) Restriction with Smal and BamHI (b) mix with restricted source DNA (c) ligation (d) transformation of strain defective in pyrimidine and tryptophan biosynthesis (e) selection for URA3 followed by testing for TRPl to ensure both arms are intact. Scheme 3 recovered as plasmids from yeasts the principle is easily transferred to other fungal species and for example plasmids of this type are powerful tools for genetic analysis and the introduction of mutant genes in yeast13 and Neurospora crassa14. More versatile plasmids contain a yeast origin or replication. There are two alternatives (i) the plasmid can contain all or part of the sequence from a natural yeast plasmid called the 2p plasmid.This molecule (6.318 kbp) occurs in most strains of Saccharomyces cerevisiae with 50-100 copies per cell and interconverts between two forms as a result of internal re~ombinati0n.l~ Plasmids of this type are referred to as ‘YEps’ (yeast episomal plasmids) and although care is required to maintain stability of YEp recombinants,16 they have the advantage of ease of recovery from yeast and have applications for example in the isolation of yeast promoters by cloning into a site upstream from an appropriate ‘reporter gene’.17 (ii) the yeast origin can be supplied by a yeast chromosomal autonomously replicating sequence (ARS). The most powerful of these vectors contain also a yeast centromere (CEN) and in some cases telomere sequences (usually derived from another lower eukaryote).Vectors of this last type are referred to as YACs (yeast artificial chromosomes). YACs are stably inherited genetic linkage groups following mitosis and meiosis.18 YAC vectors are currently important in several areas of applied genetics. The principle of using a YAC is illustrated with reference to YAC217 (Scheme 3). The advantage of YACs is their ability to maintain large inserts and their applications include the complete mapping of the genome of the nematode Caenorhabditis e2egans,l9 and the screening of genomic libraries in the Human Genome Mapping Project.20 Other developments include the YACs with mammalian cell selectable markers to facilitate shuttling between yeast and mammalian cells.21 The application of these vectors will be to study by com-plementation expression of genes in very large sequences of mammalian DNA.Although much of the work involves baker’s yeast (S. cerevisiae) for expression of foreign genes other yeast species are useful for certain purposes. We cite two examples as there are few natural protein-export systems in baker’s yeast Kluyveromyces has been used for the high-level expression and export of recombinant prochymosin. 22 A more specialized system is that of the methylotrophic yeast Pichia pastoris. When grown at the expense of methanol this organism synthesizes large amounts (up to 30% of total protein) of alcohol oxidase which is produced in microbodies (‘per-oxisomes’).The expression of the structural gene for alcohol oxidase AOX1 is repressed by glucose. Very high level expression and assembly of the hepatitis B surface antigen has been achieved by replacing AOXl with a hepatitis B surface antigen gene and growing the recombinant on glucose. The organism is then switched to methanol medium and the microbodies accumulate the foreign protein.23 3 Nucleic Acid Polymerases The period since our previous review1 has resulted in greatly increased knowledge of nucleic acid polymerases and is the subject of a new edition of an authoritative book.24 3.1 Enzymology In addition to the conventional enzyme kinetic parameters polymerases are described in terms of overall rates of chain extension and ‘processivity ’.This refers to the following theoretical possibilities prior to the chain extension reaction there is a three-component system -the enzyme the primer/ template DNA molecules and the Mg2+-dNTP substrate. The products are the ex tended-primer/ template and pyrop hosphate. Clearly there are two competing processes dissociation of enzyme from the DNA (which would correspond to the release of the second product in a conventional bi-bi enzyme reaction mechanism); or the binding of the next selected Mg2+-dNTP substrate to the two-component DNA-enzyme complex. The unweighted average number of residues incorporated before the former event occurs is referred to as ‘pro~essivity’.~~ The first DNA polymerase to be discovered was the PolI of E.coli and its activities are understood in structural The physiological role of PolI is in DNA repair. The enzyme has domains with 5’-exonuclease 3’-exonuclease and poly- NATURAL PRODUCT REPORTS 1993-M. J. McPHERSON AND J. H. PARISH Table 1 DNA polymerases used in DNA manipulations Reverse Enzyme PolI Klenow Taq T7 Sequenase transcriptase Source E. coli PolI T. aq. Ph T7 T7 pol AMV M x 10-3 103 68 94 80+ 12 80+ 12 63 +95 5‘-eXO Yes no Yes Yes no no 3’-exo Yes Yes no Yes no no Processivity weak weak weak high high weak Errors few few some few some few Analogues few few -dITP dITP few incorp. ddNTP’s inhib inhib -incorp incorp Uses labelling seq. PCR seq. seq . cDNA mutag. (Section 7.2.1) Abbreviations T. aq Thermus aquaticus Ph T7 Bacteriophage T7 AMV avian myeloblastosis virus seq.sequencing mutag. mutagenesis. merase activities and the last two of these are associated with a large C-terminal fragment of the enzyme (obtained initially by limited proteolysis and now from recombinant bacteria) and the fragment is commonly called ‘the Klenow enzyme’. There is a high-resolution structure of the Klenow fragment bound to DNA26 and a combination of site-directed mutagenesis studies2 and the use of chemically reactive substrates have led to a detailed knowledge of this -and by association related polymerase~.~’ Although we lack comparable detailed knowl- edge of replication polymerases such as the Pol I11 of E. coli there is a consensus structure of the multi-subunit holoenzyme complex.28 Progress is slowly advancing in an understanding of the structural molecular biology of transcriptional RNA polymerases a low-resolution structure of E.coli RNA polymerase suggests that the enzyme contains a DNA-binding cleft analogous to that in PO~I.~~ Among other polymerases recently reviewed,24 two are worth mention. E. coli infected with phage T7 contains a highly unusual DNA polymerase composed of two subunits one is the product of T7 gene gp5 and the other is thioredoxin (product of E. coli gene trxA). The enzyme is susceptible to oxidative damage during its isolation. The damage is inhibited by sequestering agents and requires Fe(”) molecular oxygen and a reducing agent. The chemically modified enzyme lacks the exonuclease activities of the native enzyme30 and is much used in experimental molecular biology (Section 3.2).The poly- merases (and other enzymes) of organisms that grow in extreme habitats are of great theoretical interest.31 For example the DNA polymerase of the extreme thermophilic archaebacterium Sulpholobus acidocaldarius will extend a primer in vitro at 100°C (40 “C above the denaturation temperature of the DNA).32 A thermophilic eubacterium Thermus aquaticus is the source of an enzyme ‘Taq polymerase ’ much used in the PCR reaction (Sections 3.2 and 4).This enzyme is thermostable and active at 70°C. Although the rate of chain extension catalysed by Tag polymerase at 70 “C is fast the difference between it and for example PolI can be accounted for by the Arrhenius relati~nship.~~ Taq lacks the 3’-exonuclease proof- reading activity presumably in vivo there is an associated activity to correct replication Certainly lack of proof- reading is not true of DNA polymerases from all extreme thermophiles and the enzyme from Thermococcus litorali~~~ is available under the name DEEP-VENTm (Section 4.2.2).Certain bacteria contain an unusual RNA-dependent DNA polymerase ‘reverse transcriptase’ (Section 8.1.1). 3.2 Polymerases used in DNA Manipulation Table 1 summarizes the polymerases used in DNA ma-nipulation. Taq is used in the PCR (Section 4) and is prepared from recombinant bacteria. Much DNA sequencing uses the preparation ‘SequenaseO’ this is a commercial name for the chemically modified form of the T7 enzyme (Section 4.1).The enzyme has a high processivity and this is contributed by its thioredoxin subunit (Section 3.1). Rather than relying on the vagaries of chemical isolation (Section 3. I) T7 polymerase has been modified both chemically and by site-directed muta- genesis30 to remove-the 5’-3‘ exonuclease activity which could otherwise lead to fraying of the ends of the molecules. Cloned versions lacking the exonuclease domain have also been produced. The particular advantage of T7 polymerase is that if Mg2+ ions are replaced by Mn2+ in the reaction buffer the dideoxy triphosphates (Section 3.1) are as efficiently incor- porated as the dNTPs and dITP is efficiently incorp~rated.~~ This latter property is useful in limiting ‘compression ’ on sequencing gels (Section 5.1).4 Polymerase Chain Reaction (PCR) 4.1 Historical Development of the PCR The idea of PCR derives from early methods for the amplification of synthetic DNA. Following the pioneering chemical synthesis of a tRNA gene by Ghobind Kho~ana,~~ he developed a method referred to as ‘repair replication’ of DNA with synthetic primers. However the necessary technical components to allow the reaction to be performed were not available at that time and the PCR in its present form was devised by Kary Mullis of Cetus in 1983. The early period of the technique was the subject of a major presentation in 1986.36 Since then the scientific literature has recorded an exponential increase in the number of papers describing new uses modifications (often somewhat subtle) and applications of the PCR.The technique is now used routinely in all good molecular biology laboratories to perform a range of experimental procedures from the simple routine testing of samples to the sophisticated isolation and manipulation of target DNA sequences from complex genomes. In particular however the PCR has opened up the field of molecular biology to many workers in areas such as medicine evolutionary biology environmental analysis and paeleontology for whom the traditional molecular techniques were too cumbersome or insensitive for their needs. A recent review of the breadth of such application of the PCR is provided by Erlich3’ and exemplified in Section 4.4.4.2 Principles and Practice of the PCR 4.2.1 Principles of the PCR The beauty of the PCR lies in its simplicity although as 13-2 NATURAL PRODUCT REPORTS 1993 Denature Anneal Iprimers I DNA synthesis Mg2+dNTPs TaqJ polymerase I I 5 I 10 Time (min) (4 04 (a) Principle of the PCR; (b) typical profile of temperature versus time in a PCR experiment. Scheme 4 discussed below (Section 4.2.3) this simplicity can also prove a trap for the unwary. The PCR uses the thermostable Tuq DNA polymerase (Section 3.2) to synthesize DNA from oligonucleo- tide primers and template DNA. The template DNA may be genomic or first strand cDNA' or cloned sequences. Primers which are in large stoichiometric excess are designed to anneal to complementary strands of the template in such a manner that DNA synthesis initiated at each primer leads to replication of the DNA between the primers (Scheme 4a).The PCR occurs in three distinct steps governed by temperature (Scheme 4b). First the template DNA is denatured. Secondly the temperature is reduced to allow the primers to hybridize to their complementary sequences. Tuq polymerase will then stabilize these base-paired structures by initiating DNA synthesis. Finally the reaction is heated to the optimum temperature (approx. 72 "C) for Tuq polymerase-directed DNA synthesis. In the first cycle each template strand gives rise to a newly synthesized complement; the number of copies of the target region is doubled (Scheme 4b).Since the polymerase is thermostable it is not inactivated during the process and therefore remains active. Further changes in temperature cycling through the denaturation annealing and extension steps will therefore again copy the target DNA. Simply by altering the temperature cyclically in this manner during subsequent cycles leads to a theoretical doubling of the DNA concentration corresponding to the target region. If the PCR were to proceed at 100% efficiency it would produce after 20 cycles an amplification of 220(approx. lo6) of the target DNA. 4.2.2 Fidelity of Taq Polymerase Commonly used commercial preparations of Taq polymerase do not possess a 3'-exonuclease 'proof-reading ' activity (Section 3.1) and are thus unable to remove bases wrongly incorporated into the nascent strand.However if the conditions for the reaction are carefully controlled (Section 4.3) the error rates for base pair changes and frameshifts are approximately I in 9000 and 1 in 41 000 bases synthesized re~pectively.~~ The consequences of such random mutations in the sequence depend on the use to which the amplified DNA is to be put. Such changes are tolerable if the DNA is to be used as a hybridization probe for a genomic or cDNA library,' but is a major risk if the DNA is to be sequenced (either with or without cloning). Mutations that arise in an early cycle are of course amplified in subsequent cycles and therefore the number of cycles of amplification should be kept as low as possible and products from independent PCR amplification experiments using the same primers should be sequenced.PCR experi- menters are directed to a critical review of the fidelity of the alternative enzyme preparation^.^' New forms of thermostable polymerase are now available which possess a proof-reading capacity and the problem of potential errors can therefore be reduced. Two such enzymes are DEEP-VENTTM polymerase from New England Biolabs (Section 3.1) and Pfu polymerase from Stra tagene. 4.2.3 Contamination Problems of PCR The ability of the PCR to amplify minute amounts of template has the disadvantage that small quantities of contaminating DNA may prove to be a problem for some application^.^^ The source of contaminating material is not always obvious and one of the most likely is aerosol from pipettors.Apart from extreme care it is important to have a designated 'clean' area for setting-up PCR reactions from which other DNA samples especially PCR products are excluded. The experiments are designed in such a way as to minimize the number of individual pipetting steps and thus the risk of contamination. All PCR experiments require control reactions in parallel with the test samples to indicate whether any contamination problems exist. At least two controls are required a reaction containing no DNA and one containing no primers. The risks of artefacts is sufficiently great that some advocate the UV-irradiation of reaction components to inactivate rogue DNA templates41 or the incorporation of deoxyuridine within PCR reactions to allow the destruction of contaminating templates by pre-treatment with uracil-N-glycosylase.42 This procedure is based on the mutagenesis scheme devised by Kunkel and described briefly in Section 6.4 of a previous review.' 4.3 Practical Considerations for the PCR Template DNA primers deoxynucleotides buffer containing magnesium and Tug polymerase are combined in a micro- centrifuge tube overlaid with mineral oil to prevent evap- oration during heating and the tube is placed in a thermal cycler programmed to repeat a set of short incubations at pre- determined temperatures.These are typically 95 "C to de- nature the DNA template annealing of primer to template at 37-60 "C,depending on GC-composition and finally a DNA polymerization reaction at 72 "C the optimal temperature for Taq polymerase.In some circumstances the annealing tern- NATURAL PRODUCT REPORTS 1993-M. J. McPHERSON AND J. H. PARISH perature can be as high as 72 "C allowing two-step PCRs. Alternative PCR protocols may be found in references 3 and 4 while good basic introductions to the requirements for performing efficient PCR experiments are also given.43. 44 4.3. I Instrumentation Suitable basic cyclers are now available from a range of suppliers and require only simple programming. Such instru- ments will cycle through a series of pre-set temperatures a pre- defined number of times and will often hold the samples at 4-6 "C on completion. More sophisticated instruments allow the rates of heating and cooling ('ramping') to be regulated and may also provide additional features such as pre-programmed pauses to allow sampling or addition of further reactants.43 4.3.2 Reagents Taq polymerases are now available from a range of suppliers.Generally the naturally produced enzyme has been superseded by cloned versions. Most suppliers of Taq polymerase provide reaction buffer with the enzyme. The buffers include a protein (e.g. gelatin) and non-ionic detergent^.^^ The GC-content of the template might affect the specificity of the PCR reaction a high GC-content may lead to the artefactual annealing of the primers which partially match non-target regions of the template; the specificity can be enhanced by adding chaotropic reagents such as formamide and trimethylammonium chlor- ide.45 Care is required in the preparation of nucleoside triphosphate stock Synthetic oligonucleotides' are required to act as primers and require careful storage for example in 0.88 M ammonia at -20 0C.44 The design of primers for the PCR is discussed in Section 4.3.4.4.3.3 Templates Genomic DNA suitable for PCR can be isolated from ba~teria,~' plant48 and animal cells.' cDNA is prepared from RNA' isolated from animals or plants and such RNA does not require purification of poly(A)-containing mRNA.49 For certain purposes plasmid or bacteriophage DNA' or bacterial colonies or bacteriophage plaques50 are used as a PCR template. 4.3.4 Primers Two principles underlie the design of PCR primers each primer must have complementarity with a sequence of template DNA but should not be self-complementary nor should the primer pairs have regions complementary to one another.This is because the PCR preferentially amplifies small sequences so poor primer design may lead to the major product consisting of amplified primer sequences. In general the primer may be considered to comprise two regions a 3' (priming)-region and a 5' (variable)-region. The most important in determining efficiency of annealing and subsequent DNA synthesis during the PCR is the 3'-region which should be perfectly comp- lementary to the template sequence. Where the DNA sequence is known the selection of a suitable primer sequence is straightforward. The priming region is normally 20-25 bases long (slightly longer than a sequencing primer1) although for plasmid screening DNA sequencing primer pairs usually function well.51 Once the 3' region of the primer has been selected the 5'-region may be designed to incorporate sequence features of use for subsequent manipulations of the amplified DNA. A simple example is to include a site for a restriction enzyme to simplify cloning of the PCR product and its subsequent excision from clones (Section 4.3.7) in this case the design must take into account the requirement for many restriction enzymes to have a DNA sequence of up to 10 bp flanking its Alternative examples of 5' extensions to PCR primers are 'tails' repre- senting promoter sequences,j3 specific priming sites e.g.an M13 universal priming site,' or regions complementary to a second gene to allow subsequent recombination in ~itro.~~ The length of additional 5' sequence is limited by the feasibility of synthesis and purification of oligonucleotides the current limit is around 100 nt. A restriction site can also sometimes be incorporated within a primer by selecting a sequence where one or two base changes would create new restriction sites without interfering with either priming ability or some inherent functional aspect of the DNA sequence.51 Since the primer is incorporated into every molecule synthesized the new restriction site will also be incorporated. 4.3.5 Hot Start PCR The period leading to denaturation in the first step of a PCR is critical for ensuring priming specificity.If all the reagents are mixed there exists the risk of spurious annealing during the heating and synthesis will inevitably start (as Taq polymerase is active at temperatures below 70 "C) and such molecules will be amplified during subsequent cycles. The technique to overcome this is called 'hot start PCR'54 and involves leaving out an essential component (usually the polymerase) until the tube contents are heated to a temperature (80°C) above that at which annealing can occur. The polymerase is then added and the temperature reduced to the annealing temperature. 4.3.6 Analysis and Recovery of PCR Products Routine analysis of PCR products is by agarose gel electro- phoresis using standard methods.' Most PCR products are relatively short < 2 kb and the gels usually contain quite high concentrations of agarose.If the PCR products are to be recovered for further study special low-melting-point agarose can be used to facilitate recovery. It is the usual practice to purify PCR products in this way as the products can be contaminated with primers amplified primers and non-specific diffuse artefactual molecules. 4.3.7 Manipulation of PCR Products Double stranded PCR-amplified DNA can be used directly for sequencing,43* 44 in certain circumstances in the presence of melted agaro~e.~~ The primers used for amplification of the product or internally nested primers or primers complemen- tary to 'tails' added to the 5'-end of a primer can be used as sequencing primers.Alternatively a number of methods also exist for the generation of single stranded PCR products suitable for sequencing53 including the use of biotinylated primers and magnetic bead separation (Section 9.1). Theoretically the cloning of PCR products should be as straightforward as cloning any other DNA molecule and is often facilitated by including restriction sites at the 5'-ends of PCR primers as discussed in Section 4.3.4. Special techniques are required to overcome problems that arise with intractable products ;in particular Taq polymerases frequently add a non- template directed dA to the 3'-end of the nascent strand and this can interfere with experiments where the intention is to directly clone the product by 'blunt-end' 1igation.l In such cases specially modified cloning vectors having a single dT residue added to each 3'-end can be ernpl~yed.~' 4.4 Applications of the PCR The PCR has applications throughout the biological and medical sciences due to its simplicity coupled with its ~ensitivity.~~ Here we exemplify some common applications.4.4.1 Gene Cloning Genes may be cloned from genomic DNA or from cDNA prepared from RNA isolated from cells or tissue known to H c c (3) (4) Dotted lines indicate H-bonds; C is the C-I’ of a nucleotide residue. Scheme 5 express the desired gene. The PCR is of particular importance in amplifying previously uncloned DNA sequences. If the corresponding protein sequence is known the primers can be designed by selecting appropriate peptide sequences and predicting the DNA coding sequence.As a consequence of the degeneracy of the Genetic Code the DNA sequence cannot be predicted with certainty but the chance of errors can be minimized by selecting sequences that contain trytophan or methionine (for which there is only one codon) or amino acids for which there are only two codons. The chances of errors can also be limited if genes from the organism have been sequenced so that the organism’s ‘codon bias’ is known. Nevertheless there is bound to be uncertainty concerning the correct gene sequence and therefore a mixture of primers is synthesized. This does not require separate syntheses of many different primers since automated oligonucleotide synthesis machines allow for the incorporation of alternative nucleotides at particular positions in the sequence thereby producing a mixture of the desired sequences.Alternatively the nucleoside deoxyinosine (‘1’) may be incorporated (Scheme 5) as this can form base-pairs I:C (l) which is similar to G:C (2) I:T (3; R’ = H R2 = Me) or I:A (4).It is however best to avoid this substitution in the 3’-terminal three nucleotides as DNA polymerase requires perfect base pairing in this region of the template-primer complex. 57 In other cases where sequence data from similar proteins from other species are available the sequence of the target protein is not needed. The principles of designing degenerate primers for this purpose have been reviewed.58 As an example Scheme 6 summarizes the successful PCR amplification of part of the glucoamylase gene from Neurosporu c~ussa.~~ The sequences of glucoamylases from other fungi were aligned and conserved regions were selected by using a computer database (Section 5.3) and the primers were designed.The technique is an important advance on the previous technique of probing a gene library with a heterologous probe it enables the isolation of an amplified DNA sequence of the organism’s own DNA. If a complex mixture of primers is used a range of amplified products may be generated including many non- target sequences. The complexity of such products can be reduced systematically in a second ‘nested PCR’ by using internal primers designed to hybridize to NATURAL PRODUCT REPORTS 1993 100 aa (300 bp) a b C d -c -c Y IQTET KFMUDF ~WEEV YYNGP L An example of PCR in the cloning of the glucoamylase gene from N.crassu. a,b,c,d are four PCR primers (with restriction sites -see text) designed to create PCR products ad a-b and c-d. They were based on codons for the peptide sequences shown below the horizonal line. The ‘a peptide’ was known from the N-terminal sequence of the N. crassa enzyme. The others are consensus sequences from alignments of other fungal glucoamylases. By using N. crussu genomic DNA as template the three PCR products were amplified. a-b and c-d were shown (by hybridization) to be complementary to a4 and were sequenced (to confirm they are part of the desired gene).a-d was labelled and used to probe an entire N. crassa library in a lambda vector. From this a clone containing the entire gene including its promoter regulatory regions and terminator was obtained and this gene is now sequenced. Scheme 6 -AAAAAA Anneal primer P 1 1 -AAAAAA m(N)P25 First strand cDNA synthesis -MAAAA -m( N)20-25 Homopolymer tail cDNA; Destroy RNA (OH) I GGGGG TTTTT(N)20-25 First cycle of PCR with primer P2 20 cccc-1 (N) L G T77TT(N)20-25 Subsequent PCR cycles using primers P3 and P4 complementary to unique tails on P1 and P2 respectively P4 -L 1 (N),CCCCC -1 GGGGG m(N)20-25 -P3 Examples of primers suitable for PCR amplification of a cDNA library. The restriction sites are marked.+Ed XI-Primer 1 GTGCTCCACCGCGGTGGCGGCCGC(T)17 -SacI-NotI--Ssm -Primer 2 CTGACCATGGCCTATGCGGC( C)ls -NcoI-Ben -Primer 3 GTGCTCCACCGCGGTGGCG Primer 4 CTGACCATGGCCTATGCGGC (b) Sequences of possible primers (14) with brackets round restriction sites. Scheme 7 NATURAL PRODUCT REPORTS 1993-M. J. MCPHERSON AND J. H. PARISH to primer b corresponds to sequences at the PCR end of PCR product from gene 2 4 consensus sequences58 present within the proportion of PCR products representing the target DNA but absent from those representing non-target products. The resulting amplified DNA is part of the target gene and can therefore be used as a homologous hybridization probe for Southern and Northern blots and for screening gene libraries under stringent conditions.The PCR is also of importance for cloning genes that represent members of a multigene family. One significant example of such an approach is the cloning of genes encoding antibody heavy and light chain gene~.~l*~O The PCR can also be used to amplify cDNA molecules for the generation of librarie~.~~,~~ In this case it is necessary to identify primers that are common to all the cDNA molecules irrespective of their coding sequence; one primer can be an oligo-dT sequence which will therefore anneal to the polyA-tail which is post-transcriptionally added to each mRNA molecule in all eukaryotic organisms. The principle of polyA-oligo-dT priming is in fact common to traditional methods for cDNA synthesis.Following such first strand cDNA production the cDNA can be modified by the addition of a homopolymer tail usually a poly-dG tail by the action of the enzyme terminal deoxynucleotidyl transferase (TdT). This enzyme will catalyse the addition of several nucleotides to the 3'-hydroxy end of a nucleic acid molecule in a non-template directed reaction; in the presence of a single nucleotide this results in the addition of a homopolynucleotide tail. Reaction conditions for the TdT reaction are established so that the average number of nucleoside residues added to each cDNA is about 17. This homopolyer tail can then serve as the second priming site. In its simplest form the amplification of a representative cDNA complement would use primers of oligo-dT and oligo-dC.To introduce further specificity into the reaction the 5'-ends of these primers are usually modified to incorporate unique sequences which following the first rounds of amplification then provide more specific priming sites for a second pair of primers complementary to these tails (Scheme 7). The rationale for this refinement is that within the cDNA sequences any string of A or G residues could act as a potential non-specific priming site for the oligo-dT or oligo-dC primers whereas the second primer pair would only be able to hybridize to the tails present on the 5'-ends of each cDNA. The construction of representative cDNA libraries from amounts of tissue as small as ten cells has been demonstrated and provides an opportunity to analyse biological processes previously intractable due to the limited amounts of tissue available.61 4.4.2 Mutagenesis and Recombination The mutagenesis of DNA sequences by the design of primers to incorporate one or several base changes is quite straightforward with the PCR.Each newly synthesized DNA molecule incorporates a synthetic primer leading to the rapid generation of a population of molecules carrying the desired change(s) incorporated within the PCR primer(s). Thus very high frequencies for the generation of specific mutations are possible. Similarly the specificity of primers and the ability to modify their 5'-ends by the incorporation of a defined sequence provides a mechanism for the PCR-directed deletion or insertion of sequence information or the joining of DNA sequences to form recombinant molecules a process that has been termed Splicing by Overlap Extension (SOEing).Traditionally the final form of a recombinant molecule such as a fusion product between parts of two cloned genes was limited to joining at or close to the sites of pre-existing restriction sites. Even the use of site-directed mutagenesis to introduce restriction sites a relatively time-consuming and expensive procedure does not guarantee that the ideal recombinant construct can be generated. The PCR has dramatically simplified the construction of such recombinant molecules by circumventing the need for both suitable restriction sites and ligation at the fusion junction.52 Indeed it is now possible to design on paper the exact nucleotide sequence required at the junction between two DNA molecules then to design suitable PCR primers to allow the fusion to be constructed by a simple two step PCR process (Scheme 8).4.4.3 Genome Mapping The PCR can provide a rapid method for generating probes to identify overlapping clones from large and complex gene libraries. It can also allow the analysis of genomic DNA by amplification of random target sequences from short oligo- nucleotide primers of arbitrary sequence a process termed Random Amplified Polymorphic DNA (RAPD) PCR.62 The concept behind this technique is that a nine or ten base random sequence will be complementary to many sequences within a genome however only occasionally will two such copies of a primer anneal sufficiently close and with their 3'-ends I84 NATURAL PRODUCT REPORTS 1993 * end-labelled refem-DNA test DNA 1 anneal reference 1 * andtestDNA *-C--G-,,-c-G-* \ -*=A&- C- - *-the labelled fragments marked are identified by electrophoresis *-C and autoradiography -A--T-G-• Scheme 9 pointing towards each other to facilitate the amplification of the intervening DNA sequence during the PCR.Thus within a complex genome such an amplification event may occur at some three to five locations giving rise to an equivalent numbers of DNA bands of defined size when visualized following gel fractionation. Since the process leads to ampli- fication of random DNAs it is highly unlikely that two different species will be sufficiently similar to generate identical patterns.Indeed the method can potentially be modified to allow the identification of sub-species or even perhaps individuals. An example of the increased complexity of patterns that can be generated by such a process is provided by DNA Amplification Fingerprinting (DAF)63 which uses shorter primers and which should be well suited to distinguishing closely related samples. 4.4.4 Evolutionary and Archaeological Studies The PCR has provided a route to the amplification of DNA molecules from fossilized materials including a mummified corpse an extinct quagga and even a 17 million year old leaf. In such cases the majority of DNA isolated from the sample is of modern origin comprising largely bacterial sequences.The small amounts of historic DNA can however be selectively amplified for analysis by judicious selection of primers for example based upon mitochondria1 DNA and therefore specific only for eukaryotic species. An interesting overview of this field is given in Ref. 64. A related application is to identifying genes in microbial ecological work.65 4.4.5 Forensic and Pathological A nalys is Scenes-of-crime samples including blood or semen spots or single hairs can provide sufficient DNA for genetic finger- printing which has recently been improved by Jeffreys and colleagues who applied the PCR.66 Retrospective pathology is also now possible using formalin- preserved and paraffin-embedded materials and even the sections of stained materials maintained as libraries of histology slides in pathology laboratories provide a rich source of nucleic acid for analysis.67 Removal of the coverslip and treatment of the tissue section with a solution containing the proteolytic enzyme proteinase K liberates sufficient nucleic acids for PCR analysis.Thus for example it is possible to identify viral agents within tissue samples collected at a time when the infectious agent was 4.4.6 Medical Diagnosis The PCR provides a powerful tool for the amplification of target sequences from within or closely linked to some genes associated with genetic disease. For example the genes responsible for cystic fibrosis and Duchennes muscular dys- trophy have been identified; analysis of these genes using the PCR can now detect many cases of genetic defects although such tests are often restricted to examination of regions known to be commonly defective.68 They do not always allow the detection of defects at less common sites.Approaches exist to detect such previously uncharacterized mutations within genes by a combination of the PCR and chemical probes to detect positions of base-mismatches within a heteroduplex (Scheme 9). The PCR is used to amplify corresponding regions of cDNA from a wild-type gene (one that has the normal sequence of nucleotides) and mutant gene. These two PCR products are denatured to separate the strands which are then mixed and allowed to anneal under conditions that favour the formation of heteroduplexes containing one wild-type and one mutant strand.One strand of the wild-type product is radiolabelled by the use of a radiolabelled primer in the PCR reaction ; this radiolabel allows the specific identification of products of this strand following the chemical treatment. The heteroduplexes are incubated either with hydroxylamine to modify specifically any mismatched C 71 or with OsO, to modify specifically similarly mismatched T resi-72 due~.’~. Subsequent treatment with piperidine leads to cleavage of the polynucleotide strand by p-elimination at the position of the modified base. The radiolabelled cleavage products can be detected by autoradiography following separation through a suitable gel matrix. Mutations can be identified within either strand of the DNA by labelling either strand of the wild-type molecule in separate PCR reactions followed by separate chemical mismatch cleavage reaction^.^' 5 DNA Sequencing 5.1 Conventional Sequencing The principle method used by most molecular biologists is some variant on the Sanger appr~ach’~ which is based on the termination of DNA synthesis following incorporation of a 2’,3’-dideoxynucleoside triphosphate (ddNTP) rather than a normal 2’-deoxynucleoside triphosphate (dNTP Scheme 10).The lack of a 3’-OH group on the nascent strand prevents further chain extension. Since four reactions are performed in NATURAL PRODUCT REPORTS 1993-M. J. McPHERSON AND J. H. PARISH (a) 3’-NNNNNNNNNNNNNNNNNNNACTTACAGGCATTACTAAGGCATTAATCAGACTC.. . (b) 5’-nnnnnnnnnnnnnnnnnnnTGA (+3) 5’-nnnnnnnnnnnnnnnnnnnTGAA (N +4) 5’-nnnnnnnnnnnnnnnnnnnTGAATGTCCGTA (N +8) Principle of DNA sequencing by using the chain termination method. (a) hypothetical template DNA sequence. (b) 3 of the products of a reaction with a primer (nnn . . .complementary to NNN ...) DNA polymerase Mg2+ the 4nucleotides dNTP (one of which is radiolabelled) plus ddATP. The products will all terminate in ddA and the three shortest are shown (number in brackets is the number of nucleotides where N is the number in the primer). Not shown are the remaining products which in this case will be of lengths N +9 N + 1 I N + 18 N+ 19. .. Four separate reactions are performed with ddATP ddTTP ddCTP ddGTP. The products are denatured and the single-strand products are separated in the basis of size in parallel tracks by electrophoresis and visualized by autoradiography.By reading the track (labelled T C A G) in which the products lie the sequence is determined. For example in this case the bands corresponding to products N + 1 N +2 N +3 and N +4 would lie in tracks T G A and A in that order. In a real example the dNTP concentration would be too low to obtain any readable sequence in the region close to the primer. Scheme 10 parallel each containing one of the four ddNTPs each reaction generates a set of synthesized DNA molecules extended from the common primer and terminated in a base specific manner according to Scheme 10. The range of products generated relies on careful selection of the ratio of concentrations of deoxy- to dideoxynucleotide in the reaction mix ;too high a concentration of ddNTP leads to products terminated close to the primer while too little ddNTP leads to products terminated too far from the primer to be separable on the polyacrylamide sequencing gel system used.Separation of the four base-specific reaction products in adjacent lanes of a thin (0.3 mm) polyacrylamide gel containing 7 M urea and run at high temperature -60 “C to ensure the DNA fragments remain in linear single stranded form provides a banding pattern which describes the nucleotide sequence of the DNA molecule in a simple linear fashion. Routinely such gels enable the reading of up to 300 nt of sequence from a single gel.If the fragments are able to form secondary structure (a problem that can be encountered with DNA of high GC-content) the sequence cannot be determined. From the appearance of the resulting bands the sequence is said to be ‘compressed’. Detection of the reaction products has traditionally been by autoradiography since a radiolabelled nucleotide is incorporated into the reaction products during DNA synthesis. As discussed in section 9.3 non-isotopic chemiluminescence methods for detection of DNA are now available and have been adapted for DNA sequencing reactions (e.g. the Plex DNA Sequencing kit from Millipore). A handbook dealing with many aspects of manual DNA sequencing procedures has been published. 74 A number of commercially available DNA sequencing reagent ‘kits’ are available and these provide all the necessary quality assured reagents together with suitable control template DNA and oligonucleotide sequencing primer.These kits usually contain a T7 DNA polymerase such as ‘SequenaseO ’ (Section 3.2) rather than the original Klenow fragment of DNA polymerase I of E. coli. An enzyme with poor processivity such as Klenow will dissociate from the template regularly leading to occasional non-specific termination products which may confuse the interpretation of sequence data. It may be desirable to read DNA sequence adjacent to the sequencing primer for example to confirm the identity of a DNA fragment by comparison with peptide sequence data from which a PCR primer was designed (Section 4.4.1).This can usually be achieved by using a greater than normal dilution of the labelling mix and/or inclusion of Mn2+ in the reaction buffer (Section 3.2). 5.2 Automated Sequencing A number of genome sequencing projects are already underway and are laying the foundations for the largest of all such projects sequencing of the human genome. A recent landmark is the first sequence of a eukaryotic chromosome (chromosome 111 from S.cerevisiae;3 15 kbp) by a consortium of 35 European laboratorie~.’~Such a task requires the development of sequencing systems that exceed by orders of magnitude the rate currently achieved as standard in most molecular biology laboratories where single genes are being studied. Since it is not the collection of the sequence data that is of interest per se but rather the interpretation of the data it is essential to develop automated systems for the rapid generation detection and collation of sequence information.5.2.1 Detection and Collation Automated gel scanners exemplified by the Gene Reader developed by Bio-Rad are based on the rapid detection of sequence data represented in the traditional form of an autoradiographic film of a DNA sequencing gel. The approach is based on a high speed optical linear charged-coupled-device array camera which produces a digital image of the film for analysis by pattern recognition software to allow assignment of sequence data. A single film can be scanned in a matter of seconds; this ‘gel reading’ step therefore overcomes the time- consuming and error-prone processes of manually reading gels and typing the data into a computer.Subsequent processing takes some 50 minutes per film. The instrument can process about 1000 bases per hour. Other similar instruments claim an ability to process even more data notably 12000 bases per hour for the Beckman AutoReader. The technique and a review of commercial apparatus is p~blished.’~ An alternative to automated scanning real-time data collection exemplified by the Applied Biosystems 373A instrument is based upon detection of fluorescently tagged DNA molecules during their migration through an acrylamide gel.’? The fluorophores are based on rhodamine and fluorescein dyes which had independently been developed for fluorescent tagging of antibody molecules for histochemical purposes.Four fluorophores are incorporated in base-specific chain termination reactions either as 5’-fluorophore labelled primers or as 3’-fluorophore labelled dideoxynucleotides. The outcomes of these alternative labelling procedures are four base specific termination reaction mixes each labelled with a different fluorescent tag. Such differential labelling allows all four reaction products to be mixed and loaded in a single well on the separation gel rather than having to be loaded in four separate wells for non-fluorescent systems. The immediate advantage is that for gels of similar size fluorescent tagging should increase the amount to sequence readable from the gel by four-fold.Each fluorophore has been selected to have well separated excitation and emission wavelengths. Detection is achieved in real time by using a scanning laser and photomultiplier system. The laser light is focused immediately before entering the gel to a size which affords maximum excitation while the position of the laser is such that optimal resolution of the separated DNA bands has been achieved. The emitted fluorescence is focused NATURAL PRODUCT REPORTS 1993 onto a high sensitivity photomultiplier tube and the data are recorded. The instrument collects data in real-time that is during the gel running and scans the 24 lanes of the gel by recording data at each of 194 points across the gel. It is argued that the detection of all four reaction products within a single gel lane reduces the problems sometimes associated with anomalous gel running when analysing samples across four separate lanes.This makes the analysis of the data for the single lane internally consistent. The raw data are processed to remove (a) the effects of mobility differences between fluoro- phores since some are considerably larger than others and (b) spectral overlap between the fluorophores. The smoothed data can be displayed and the instrument automatically assigns the base sequence although manual editing facilities are available. The instrument can record some 12000 bases of sequence per gel. 5.2.2 Sequencing Reactions and Gel Loading Robot systems designed for accurate dispensing of microlitre volumes of liquid have been developed.Such instruments can actually be used for a range of routine molecular biology processes which involve the repetitive and accurate dispensing of small volumes of reagents. The instruments use a computer to control the accurate position of a dispensing arm and to direct the arm to collect and dispense reagents from storage containers to reaction tubes or wells. The reaction wells are also located over a heating and cooling plate for example based on peltier devices which allows the regulated changes in tem- perature required for template denaturation primer annealing DNA synthesis and stable sample storage. Appropriate programming allows such instruments to be used to perform DNA sequencing reactions. Examples of such systems include the Beckman Biomek and an adapted Gilson instrument which also incorporates the important feature of allowing automated loading of the sequencing gel.78 5.2.3 Vision Assisted Robotics Since the objective is to develop an integrated instrumentation system capable of meeting a range of needs including automation of sequencing it is important to automate more basic procedures such as cloning clone selection and template preparation.Some progress in this direction has been made; the instruments described in 5.2.2 can be programmed to perform certain of the cloning steps including restriction digests and ligations. Vision assisted systems such as APSCIR (Automatic Plaque Selection and Culture Inoculation Robot) based on a camera system and pattern recognition software and capable of differentiating recombinant from non-recombinant plaques or colonies on the basis of differences in colour can be used to identify and pick the former from agar plates into suitable growth medium.79 Robots capable of the range of functions discussed above are not commonly found in most laboratories but are becoming more familiar.5.3 Megabase Sequencing Developments The developments discussed in 5.2 increase the rate of accumulation of sequence data by approximately an order of magnitude allowing an individual to determine perhaps I to 5 x lo4 bases per day. A realistic level for undertaking the human genome project is lo6 bases per day. Various schemes have been proposed to allow such megabase sequence de- termination; one is based largely on extension of existing sequencing procedures (Section 5.3.1) while the second (Section 5.3.2) is a significantly different conceptual approach to sequence determination.We point out that these systems remain to be fully demonstrated at an experimental level; however they have been included to provide an indication the directions in which the technologies for very large sequencing projects appear to be moving.7g 5.3.1 Multispectral-multiplex Sequencing The techniques of Section 5.2.1 provide a method for separating the products of all four sequencing reactions (Scheme 10) on a single track of a gel. The methods of nucleic acid hybridization suggest in principle a method for separating the products from sequencing several clones on one track.As the molecules that are separated are extended primers a single electrophoretic track could contain the products of many clones if the primers could be differentiated. This is the principle of multispectral- multiplex sequencing.80 To sequence N clones simultaneously we would require 4N primers (for the four tracks on a conventional sequencer) and 4N primer-specific probes. The bands are captured on a nitrocellulose (or nylon) conveyor belt passing the end of the gel and probed successively with sets of the four fluorophore-tagged probes. In the proposed imple- mentation of this scheme N = 50. The set of 4N primers could be used to sequence N clones per gel track. In principle for a 40 lane gel 4N probes would detect sequence from 2000 (40N) clones corresponding to approximately 1O6 bases.5.3.2 Immobilized Oligonucleotide Sequencing Among the possibilities being discussed about the implemen- tation of the human genome project,81 is that the specificity of hybridization may provide a key for large scale sequencing projects. Short oligonucleotides such as octonucleotldes (eight- mers) will anneal with complementary regions from a randomly fragmented large DNA molecule. A possible 48 or 65536 eight-mer sequences represents all the possible combinations of eight-base long nucleotide sequences that can occur in DNA. If each of these sequences was synthesized and immobilized on a suitable solid support at a known location within a matrix they could be used to determine the DNA sequence of very large DNA molecules following hybridization.In practise the target molecule would be fractionated to generate smaller fragments that could form stable hybrids with the immobilized oligo- nucleotides. Computer-directed detection and analysis of the eight-mer sequences to which the DNA molecule has hybridized should allow determination of the unique solution to the target DNA sequence. Clearly the system would be required to be sensitive to such features as relative intensity of the hybridi- zation signal to take account of repeated sequences. Increased sensitivity and a reduction in the level of ambiguities in sequence determination might be achieved by increasing the length of the oligonucleotide probes however an increase in nine-mers requires the synthesis of 262 144 separate molecular species.6 Computer Applications 6.1 Hardware and Software A nucleic acid or protein sequencing project will require some local computing facilities for data collection and analysis some of which may be hidden in the program that controls for example an oligonucleotide synthesis machine. The exper- imenter will also require a local database of his/her sequences to identify overlap. It is also important to check the sequence against that of sequencing vectors. These are examples of programs that rely on relatively trivial problems of string handling and can be coped with by a laboratory personal computer. However molecular biologists require access to larger databases and also to more sophisticated software.It is for example routine to examine any new sequence of DNA to predict protein sequences in each of the six theoretically possible reading frames and to search the entire database of all known protein and DNA sequences for possible identities or partial homologies. For these purposes it is usual to employ larger computers such as dedicated workstations or more typically clusters of multi-user computers for experimental purposes and the following parts of this section illustrate such applications. NATURAL PRODUCT REPORTS 1993-M. J. McPHERSON AND J. H. PARISH 6.2 Databases The major international databases (all of which are updated at regular intervals) are as follows.Nucleic acid sequences are maintained in two USA databases ‘GenBank’ and ‘NBRF- (Nucleic)’ and in the European data base ‘EMBL’. (NBRF and EMBL are respectively the National Biomedical Research Foundation Washington and the European Molecular Biology Laboratory Heidelberg.) ‘NBRF(Proteins) ’ and ‘Swissprot ’ are protein sequence databases. A major macromolecular crystallographic database is the ‘Brookhaven Database ’. There are several composite databases such as OWL which is held in the UK at the SERC SEQNET node at Daresbury. Access to such databases is not suitable for conventional citation of references,sz however the algorithms used for constructing non-redundant databases of sequence information are re-viewed.83 Other databases relate sequence information to physical (restriction) and genetic maps.In the case of E. coli the database with ancillary interrogatory softwares4 is based upon an ordered sets of clones (in phage A) of the entire chromo- some.85 The databases for higher organisms incorporate cross references to cytogenetic and conventional genetic data and restriction fragment length polymorphisms (RFLPs).” For relatively small genome eukaryotic organisms a paradigm for such a database is the acdeb system for the nematode Caenorhabditis elegans (acdeb stands for ‘A C. elegans database ’).86 The database approaches the ideas of object- oriented databases although computational purists would not regard it as a true object-oriented product. A much more ambitious computational project is the integration of current knowledge in the Human Genome Mapping Project.The project established its own database ‘HGML’ (Human Gene Mapping Library) which established links with GenBank and the current computational and organizational aspects of the vast project were established by 1990.*’ More recent develop- ments in the project have been the subject of recent editorials and reviews.s8 The following are some common suites of programs that are fairly widely accessible as examples of implementations of certain algorithms the ‘ISIS ’ package originates from the University of Leeds and Birkbeck College London ; the ‘PIR ’ software comes from the NBRF; ‘UWGCG ’ or ‘the Wisconsin package’ comes from the University of Wisconsin Genetics Computer Group and ‘the Staden programs’ from Dr R.Staden MRC Laboratory of Molecular Biology Cambridge. 6.3 Sequence Analysis From the point of view of a computer program a sequence of a nucleic acid or protein is a ‘string’ of characters. In general we may wish to compare such strings in three ways we might seek an exact match of parts of such strings (an example of this is the search for overlaps in experimentally determined DNA sequences); we might on the other hand wish to do a ‘fuzzy’ search -this means that we have a sequence motif (e.g. the functional parts of a promoter or structural features of proteins) but some of the characters can be ‘wild cards’ (or even the length of the gap(s) between parts of the sequence may be variable within limits.The third type of sequence comparison relies upon the idea that two sequences might be significantly ‘similar’ but not identical. This can be illustrated by protein sequences if a valine residue in one protein has a corresponding isoleucine residue in another the structural consequences are relatively trivial (the side chains are very similar in space-filling models) whereas (for example) a valine-serine replacement would be highly significant. Computationally the problem is trivial as the conservation of similar residues can be represented by a matrix. Any suite of programs for analysis of sequences will include the following facilities (the references are to key algorithms) similarity sequence alignment,so storage and manipulation of DNA sequencing data,91 identification of ORFs,” and establishment of phylogenetic relationships from ORFs (open reading frames) are putative genes.Apart from the special techniques of conformational prediction (Section 6.4) the programs will include methods for determining hydrophobicity and the probability of a protein being a trans- membrane The search for similarity and struc- tural features in proteins is obviously important in identifying ORFs and allocating a likely function to a cloned gene. The alignment of parts of sequences can also reveal important aspects of the relationships between structure and function. To take an example from this review the DNA-dependent DNA polymerases used for DNA manipulation in vitro (Table 1) belong to a family (that also includes the polymerase of phage T5) in which functional domains are conserved.95 In contrast the replication polymerase (PolIII) of E.coli is unrelated and the phage T4 polymerase belongs to a further unrelated family that includes many eukaryotic polymerases ; references are cited in an extensive review.24 6.4 Prediction and Structure Analysis We refer here only to applications of relevance to molecular biology such as the analysis of structures predicted in the course of a protein engineering experiment.2 We do not deal with crystallographic refinements nor molecular graphics. There are also important calculations of molecular interactions such as the ‘docking’ of molecules (e.g. of a drug to its receptor) that can be simulated computationally.The conformation of a protein can be regarded as a secondary structure on which additional folding is imposed to generate a tertiary structure. There are several algorithms based on the known predispo- sition of sequence motifs to form certain structures that predict with reliability the occurrence of such secondary structural featuresg6 and a good general method can be rec~mmended.~’ The problem of predicting the overall conformation can be described by asking how these secondary structural regions might be folded. Ab initio methods have so far failed to generate a generally applicable method.96 There is an alterna- tive empirical approach. We might scan all the known 3d protein structures and see whether our sequence might in some sense ‘fit’.In this case the ‘algorithm’ would seem to encompass the whole of human knowledge on this topic and would be subject to the stern scrutiny of the criteria of K~lm~gar~~.~~ The central problem has been resolved by using applied graph theoretic methods a recent paper describes an entirely objective algorithm for reducing the known protein structures in the Brookhaven database (Section 6.2) to just 107 families.s9 This work provides a practical and theoretical background for future developments in structure prediction it would seem that energy minimization methods could be used to thread sequences of unknown structure into these unique structures. The same authors have used a similar approach in the development of a simple docking algorithm for inter- molecular interaction.1oo Rather different methods have been adopted for the prediction of RNA secondary structure and these rely on thermodynamic parameters describing the free- energy gains/losses associated with structural features.lol 7 Site-directed Mutagenesis A variety of approaches to the directed alteration of a DNA sequence were presented previously1 as were some applications of such experiments in the field of protein engineering2 This section highlights some recent developments ; for technical details see Ref. 102. 7.1 Phosphorothioate Mutagenesis In experiments designed to direct the alteration of specified bases it has become common place to design an oligonucleotide containing the desired mutant sequence and which following annealling to the target sequence on the wild-type DNA will act as a primer for a DNA polymerase catalysed synthesis reaction.The mutation present within the primer is therefore incorporated into the newly synthesized DNA strand which can be circularized by the incorporation of DNA ligase within the reaction. Several modifications to this standard procedure now exist to facilitate the efficient recovery of mutants. These approaches incorporate some steps designed to destroy the wild-type form of the DNA whose function as a template is complete once the mutagenized strand has been synthesized. One such approach relies upon the incorporation of a thiophosphate analogue into a mutagenic primer within the nascent DNA strand.lo3 The principle of the method relies on the fact that many restriction enzymes will not attach thiophosphodiester links.In the version of the protocol illustrated (Scheme 11),lo3 a plasmid is gapped by using a restriction enzyme (Hind IIZ) in the presence of the intercalating drug ethidium bromide’ followed by treatment with an exonuclease. The mismatched mutagenic primer is annealed and double stranded DNA is made by using DNA polymerase and a reaction mix containing one Sp diastereoisomer of a deoxynucleoside 5’-[a-thioltriphosphate (ppsG in the legend to the Scheme). Treatment with the second restriction enzyme (Pstlin the Scheme) produces only a single cut at its restriction site and the subsequent treatment ensures only the mutated plasmids will be capable of transformation.7.2 Saturation Mutagenesis Two highly efficient approaches for the mutagenesis of defined segments of a cloned DNA molecule have been described. lo4,lo5 The rationale for such experiments is to generate a series of mutational variants that represent essentially every possible base change within the target mutagenesis window. Any given DNA molecule will contain on average one base change which may or may not affect the function of the DNA or the encoded product usually a protein. These mutagenesis methods there- fore provide mechanisms for scanning large libraries (> lo5)of unselected mutational variants to allow identification of those with interesting properties.Selection of interesting variants relies on a suitable functional system to identify for example variants able to more efficiently utilize an alternative substrate. 7.2.I Enzymatic Nucleotide Misincorporation The basic principle of the method may be found in the plus- minus approach originally developed by Sanger for DNA sequencing.73 Single stranded template DNA is annealed with a suitable oligonucleotide primer which lies at the 5’-end of the mutagenesis window. The sample is split into four base specific reactions and DNA synthesis catalysed by Klenow fragment is allowed to proceed under conditions in which one nucleotide triphosphate is present at limiting concentrations. This gen- erates a population of molecules terminated immediately before positions corresponding to the limiting base.In the A-reaction all nascent strands will be terminated at positions where the next base to be inserted is an A. Since the Klenow enzyme has a 3’ to 5’ exonuclease ‘proof-reading’ activity it will remove any mismatched base it inadvertently adds to the nascent chain. The DNA molecules are recovered and included in new base specific reactions where the correct base is absent. So in the A reaction only G C and T are available. The enzyme reverse transcriptase normally an RNA-dependent DNA polymerase but which also has DNA-dependent DNA polymerase capacity is added and the reaction allowed to proceed. Unlike Klenow reverse transcriptase has no proof-reading activity so in-advertent incorporation of a mismatched base will lead to a potential base-pair mutation.Following a period to allow misincorporation DNA synthesis is completed by providing all four nucleotides at normal concentrations. Following trans- formation and a suitable selection strategy which may include some mechanism to preferentially recover mutant-strand-derived clones (for example the uracil incorporation’ or NATURAL PRODUCT REPORTS 1993 7PstI Hind111 M‘a PstZ and HindIII are restriction sites m is the desired mutation target. (a) HindlIZ plus ethidium bromide (b) anneal mutagenic primer (broken line) (c) exonuclease 111 (d) DNA polymerase dATP dCTP dTTP and ppsG (e) DNA ligase (0Pstl (g) T7 exonuclease (h) DNA polymerase (i) DNA ligase sequence containing thio- phosphate is shown as a thick line.Not shown in the scheme are linearized products formed after (b) and (0 as these will not form yield transformants. Scheme 11 phosphorothioate derivatives Section 7.1 Scheme 12 (9,Y = S-)) a library of mutational variants is available for characterization and selection of individual species with altered functional properties. 7.2.2 Spiked Oligonucleotides Normal oligonucleotide-directed mutagenesis procedures rely upon the synthesis of a single molecular species of oligo- nucleotide that includes a defined base difference at the site to be mutagenesized. However it is also possible to perform a similar mutagenesis experiment using a mixture of mutagenic oligonucleotides each able to introduce a single point mutation.Usually only a defined number of alternative oligonucleotides are used in such experiments. The various mutational variants are resolved at some stage after the generation of individual clones usually by sequencing a number of random clones. However the ultimate extension of this approach is suitable for the generation of all possible base substitutions at each nucleotide position within a target sequence window. The outcome of such an experiment is to produce a library of mutational variants each on average carrying one point mutation. Resolving the interesting variants in this case must rely upon a direct functional selection due to the very large numbers of variants that would be produced. The key feature of this scheme is the synthesis of oligo- nucleotides in which each precursor phosphoramidite (Section 8.2; Scheme 12) is deliberately contaminated or ‘spiked’ with a NATURAL PRODUCT REPORTS 1993-M.J. McPHERSON AND J. H. PARISH 0 OH 3 Figure 2 The * represents a 2'-5' link (5). low level of each of the other three amidite precursors. Hence during the synthesis of a long oligonucleotide (approx. 75 bases) there is a defined probability of incorporating one of the three wrong bases at each position throughout the oligo- nucleotide. The probability of incorporating a defined number of 'errors' into each oligonucleotide can be altered by adjusting the level of contaminating precursors in each phosphoramidite and this level can be calculated thus allowing the level of errors -in the mutational variants to be pre-selected.For most purposes One usually requires Only One mutation per molecule. The following formula can be used to calculate the probability P of finding n errors in an m base long oligonucleotide that is synthesized with a fraction a of the three wrong nucleotides (Equation 1) P(n,m,a) = [m !/(m -n)!n!] [a].[ 1 -a1m-n. (1) The number of mutagenic oligonucleotides containing one error is maximized for a = l/m. As an example contamination of the phosphoramidites at a level of 0.83% with each of the other three giving a total contaminating level of 2.5 YO,for the synthesis of a 75 base sequence would allow the recovery of > 99 YOof all single base changes and approximately 75 YOof all the two-base changes within the 75 base mutagenic window.Once synthesized the 'spiked' oligonucleotides are used as primers for the synthesis of DNA during a suitable high- efficiency procedure for the recovery of mutants. Specifically the procedure described here and reported in references105 used the phosphorothioate procedure (Section 7.1). 8 Chemistry and Biochemistry of RNA 8.1 Structure of RNA 8.1.1 Primary Structure A novel structural feature of bacterial RNA arose from studies of multicopy single stranded DNA (msDNA). lo6msDNA was discovered in myxobacteria but has since been found in other bacteria including certain strains of E. coli. Analysis of the structures revealed that msDNA consists of DNA and RNA molecules linked by a 2-5' phosphodiester link (5) and illustrated by a small msDNA sequence (Figure 2).lo7 Other msDNA sequences have a stem-and-loop structure (Section A AG C-G T-A A-T A-T GT T-A~ C-G TG TAGC-G A A~~~-~ C-G ACACCTG-CGATTCCTCCTGCC 3' n 111111I C 3,AGGACGG G U LA ccuu UG CGC TTCCT GA~ UG ,A GU UG Gb U-A 5' CACGCAUGUAG G-C G-C U-A U-A G-C U-G G-C AAU 8.1.2) in the DNA as much as 4-times the size of that in Figure 2 and two rather than one stem-to-loop in the RNA sequence.These extraordinary molecules are transcribed from genes (msr and msd) and the msd transcript is converted to DNA by a bacterial reverse transcriptase. The msd-msr genes are adjacent and referred to as a 'retron'.'06 8.1.2 Secondary Structure The elementary principles of RNA secondary structure forma- tion are that :A and :G base pairs form to generate double helical regions.Within such a region a U:G base pair (3; R1 = NH2 R2 = is regarded as neutral (i.e. it neither stabilizes nor destabilizes the helix). The two differences between this elementary view of RNA structure and the DNA double helix are (i) the helix geometry is different and (ii) in most RNA molecules the base pairing is intramolecular so that there are a number of unpaired regions referred to as loops and bulges (Figure 3a). Double stranded RNA molecules occur in certain viruses and constitute an exception to (ii). Most RNA structures are based on such secondary structure maps and are calculated by using appropriate computer algorithms (Section 6.4) that compare the stabilities of alternative pairings.However double helical regions can be formed by pairing between such loops or bulges and unconstrained regions or other loops or bulges. The structures are referred to as pseudoknots.'os Although this type of interaction might seem like a tertiary structure imposed upon the secondary structure map they do in fact represent a different secondary structure because of the extension of the base stacking between the two helical regions involved (Figure 3b-d). The example chosen is the extreme 3'-terminal sequence of tobacco mosaic virus (TMV) RNA. Pseudoknots were first implicated to account for the finding that the 3'-terminal sequence of turnip yellow mosaic virus RNA acquires a structure similar to tRNAVa' even though the secondary map of the viral sequence shows four loops (rather than the three of tRNA) and no apparent tRNA Since that time pseudoknots have been discovered or postulated in a number of other viral RNA molecules11o (the 3'-terminal sequence of TMV RNA contains several structures ahead of the pseudoknot of Figure 3d that form a 'stalk' at the end of the structure) NATURAL PRODUCT REPORTS 1993 5 (4 AMAgU, .C-C-C-C-C-C-G-U-U-A-C-C-C-C-C-G-G-U-A-G-G-G-G-C-C-C-A~~--G-G-G-G-....5’ Cxu-; (b) Figure 3 (a) Definition of secondary structure features in RNA; (b) formation of stem-and-loop in the 3’-terminal sequence of tobacco mosaic virus (TMV) RNA; (c) formation of a second stem and loop.Arrowed residues base-pair form the pseudoknot (d). both bacterial and eukaryotic mRNA sequences,111 rRNA (Section 8.5) and ribozymes (Section 8.3.3). It is possible that pseudoknot structures in certain bacterial mRNA sequences play a regulatory role particularly in the case of the regulation of certain bacterial proteins. In these cases regulation is achieved by the binding of regulatory ribosomal proteins to a domain in mRNA for a ribosomal protein operon that mimics the binding site for the ribosomal protein in rRNA during ribosome biogenesis. 112 8.2 Chemical Synthesis of RNA The principles of RNA synthesis are similar to those of DNA synthesis1 but the process is more difficult for three reasons (i) the two hydroxyl groups on the sugar moiety lead to an extra protection/deprotection reaction ; (ii) the protecting reagents used for this slow the coupling reaction for stereochemical reasons; (iii) RNA is more subject to alkaline hydrolysis than DNA because of anchimeric involvement of the 2’-hydroxyl group in the formation of a 2’,3’-cyclic phosphate intermediate of hydrolysis.Developments in both ribo- and deoxyribo-oligonucleotide synthesis using the two main approaches of phosphoramidite and phosphotriesterl have been reviewed. 113 To these methods have been added the H-phosphanate approach and this and the phosphoramidite approach are used in developments in solid- phase synthesis of oligonucleotides driven by the requirement for antisense molecules (Section 8.4)l14 115 (Scheme 12).The phosphoramidate chemistry has been adapted for RNA synthesis with an Applied Biosystems DNA Synthesizer. 116 In this system the attachment to the support is via a 2’-Iinkage (10) which is coupled with (7,X2= trialkylsilyl) to form (I 1) and oxidation (Scheme 12c) is with I,. Final deprotection and removal from the support yields (9,X’ = X2 = OH,Y = 0-). 8.3 Small Nuclear Ribonucleoprotein Particles and Ribozymes 8.3.1 RNA Processing Although the majority of enzymes are proteins certain RNA processing enzymes are RNA molecules ; these enzymes are referred to as ‘ribozymes’. Although the natural ribozymes are domains in self-cleaving RNA molecules (see below) the cleavage site does not need to be in the RNA chain and synthetic or semi-synthetic ribozymes are true nucleases.There are also intermediate cases of ribonucleoprotein particles in which RNA molecules are integral to the activity. In this section we use ‘RNA processing ’ to refer to alterations to the sequence of phosphodiester-linked nucleotides in newly tran- scribed RNA the other type of post-transcriptional modifi- cation of RNA molecules i.e. changes in the base or sugar residues and the addition of residues in a template-independent reaction we refer to as ‘RNA modification’. There are two fundamentally different types of processing in one type of reaction ‘cleavage’ an RNA precursor is cleaved into fragments including mature-length RNA molecules by endo- nuclease(s); in the other type of reaction ‘splicing’ internal pieces of RNA are removed via a lariat intermediate.A particle involved in this process is referred to as a ‘spliceosome’. An RNA sequence spliced out in this way and also the cor-responding DNA sequence is referred to as an ‘intron’ and the remaining sequences (that survive the splicing reaction) are referred to as ‘exons’. In lower eukaryotes certain types of introns (‘groups I ’) are self-splicing. RNA processing occurs in all types of organism but there are fundamental differences between bacteria and eukaryotes. ‘Stable RNA ’ i.e. tRNA and rRNA are cleaved from precursors in all organisms. In bacteria mRNA is a direct product of transcription; in eukaryotes this is never the case.The precursors of eukaryotic mRNA are frequently referred to generically as heterogeneous 191 NATURAL PRODUCT REPORTS 1993-M. J. McPHERSON AND J. H. PARISH DMTov DMTov X3Si0 0 -0 x2 0 x2 ! R’O-P‘ R’O-P’ HO / v 0 x’ ! 0 X’ X3Si0 I i i \;I (11) * DMTov 0. /0 x* ‘P “‘V 0I x’ (13) B’ B2 are bases boxes indicate protection. DMT dimethoxytrityl; X sterically hindered alkyl e.g. t-Bu; R R1 alkyl groups that vary from protocol to protocol; binding of the 3’-terminal residue to the solid support is indicated by the black circle. Other substituents are referred to in the text. (a) Coupling in the phosphoramidite approach with mild acid (e.g. 1-H-tetrazole);(b) coupling in the H-phosphanate approach with sterically hindered acid chloride (e.g.adamantane carbonyl chloride). (c) and (d) are the oxidation and deprotection steps. Scheme 12 nuclear RNA ‘hnRNA’. The processing of the majority of hnRNAs involves splicing and two types of modification the formation of the 5’-terminal ‘cap’ and the addition of a 3’- terminal poly(A) tail.’ In the following we also refer to viroids and virusoids. Viroids are infectious agents of plants that consist of small RNA molecules lacking any protein capsid; virusoids are similar self-replicating RNAs but are packaged within the capsid of RNA plant viruses. 8.3.2 Small Nuclear Ribonucleoprotein Particles Small nuclear ribonucleoprotein particles (snRNPs) contain small nuclear RNAs (snRNAs) and proteins.The nomenclature is confusing and is derived from the fact that many snRNAs are uridine-rich. The corresponding RNPs are thus called U RNPs and referred to as U1 U2 etc. The processing of pre-rRNA involves U3; U1 U2 U4/U6 and U5 are components of spliceosomes; U7 is involved in the processing of histone mRNA. SnRNAs share a binding site for characteristic proteins (the ‘Sm proteins’) and have an unusual version of the 5’-cap; the ‘m,G cap’. There are recent reviews snRNPs and snRNAs.”’ 8.3.3 Ribozymes Ribozymes are enzymes composed of RNA rather than protein. Operationally there are probably three categories of ribozyme. First there is a category represented by RNAseP which is involved in the processing of pre-tRNA molecules. This enzyme is composed of a polypeptide and an RNA molecule :the RNA component is an independent ribozyme in certain but not all RNAsePs.’18 More generally the snRNA components of U particles (Section 8.3.2) have catalytic functions suggestive of a ribozyme ancestor.ll’ The second example is that of the self- splicing mechanism of so-called group I introns (Section 8.3.l) first discovered in Tetrahymena.’l9 Ribozymes of this type (‘hairpin ribozymes ’) require a divalent metal ion (usually Mn2+and a guanine nucleoside/nucleotide (Guo GMP GDP or GTP).They achieve the splicing reaction by a double transesterification (Scheme 13).120 Although the introns them- selves have complex secondary structures the hairpin reaction itself seems to have limited structural requirements a very simple 47 nt molecule has been shown to self-cleave in a reaction in which the guanine nucleotide requirement is satisfied by the sequence itselPZ1 and the substrate for the reaction can be a DNA oligomer although the K is in excess of lo4 greater than for the equivalent RNA oligomer.120 Current interest in hairpin ribozymes is addressed to determining the kinetics and mechanistic requirements by using ribozymes of differing sequence and synthetic substrates containing ribo- and deoxy- ribo-nucleotides. lZ2 NATURAL PRODUCT REPORTS 1993 ?' 2' .. 5'-c-u-c-u-c-u& G-G-G-A-G-G-A-G t (b)J 5'-c-u-c-u-c-u-u-3* Go is a guanosine (or guanine 5'-nucleotide) bound to the active site of a ribozyme.(a) Transesterification leading to a cut; (b) second transesterification leading to excision of the intron. Scheme 13 8.3.4 Hammerhead Ribozymes Hammerhead ribozymes constitute the third class of ribozyme (Section 8.3.2) and they represent a potentially important structural and chemotherapeutic class of enzyme. They are found in viruses and virusoids particularly from ~1ants.l~~ The potential importance of hammerhead ribozymes was recognized when synthetic ribozymes of this type were A general self cutting-ribozyme sequence of this type (Figure 4) does not require a guanine nucleotide co-factor but ham-merhead ribozymes do require a divalent metal ion (usually Mg2+)but the 'enzyme' and substrate can be independent RNA molecules (Figure 4b).125The mechanism of action of these ribozymes has been studied by NMR12'j and the use of chemically modified substrates,127including chiral phospho-thioates,lZ5-128 but in applied molecular biology the interest in them is that they represent a method of altering RNA processing in vivo.Methods have been developed for the production of novel ribozyme-releasing DNA sequences that will generate ribozymes from transcript~'~~ and the use of ribozyme technology is actively pursued with a view to controlling viral infections in particular HIV,ll53130 and the expression of oncogenes. 131 8.4 Antisense Nucleic Acids 8.4.1 Antisense RNA A remarkably simple technique for interfering with normal gene expression is to produce within a cell an antisense version of a particular mRNA.The mechanism occurs naturally and its several examples include MicF RNA which regulates expression of outer membrane protein genes in E. coli by translational arrest.' In eukaryotic cells antisense RNA has a slightly different role a simple strategy is to clone a cDNA corresponding to a target gene next to a suitable promoter for gene expression but with the cDNA inverted relative to the orientation of the normal gene. Introducing this antisense clone into suitable cells of a transgenic organism will result in the transcription of an antisense RNA which will interfere with y'A-A -A id^,^ /deavage site site * G 'A-G-U-C-C-C 'G-C-G-C-C z:tz- r+zf-U,u,c-G-C-G-G ~J-C-A-G-G-C~~~ \ A Figure 4 (a) a natural hammerhead ribozyme (b) a synthetic ribozyme with its substrate molecule.transport of the mRNA from the nucleus and with translation by ribosomes. The net effect is to prevent the accumulation of normal levels of the protein synthesized by the target gene. In the area of plant genetic manipulation antisense RNA technology is likely to make a significant impact on the analysis and manipulation of a wide variety of plant features. This is due to the relative simplicity and speed with which plant material can be transformed and regenerated into plants. Es-sentially the expression of an antisense RNA allows the function of a cloned gene to be determined in a highly specific manner. The procedure represents a form of mutagenesis but a highly efficient and selective one in which expression of a target gene can be reduced dramatically allowing assessment of the functional significance of loss of expression of this gene.Tomatoes ripen due to the expression of a number of genes whose expression is induced by ethylene. Two of the genes so induced are pectinmethylesterase which catalyses the methyl-ation of pectin which acts as a 'molecular glue' holding the plant cell walls together and contributing to the rigidity of unripe fruit. Methylation of pectin allows the enzyme poly-galacturonase to begin the endohydrolysis of the polygalact-uronic acid polymers present in the middle lamella with the consequent softening of the fruit due to disruption of the rigid structures between plant the cells.A major problem for growers is the transportation of ripening fruit since the degradation of pectin can lead to significant damage to fruits due to physical agitation for example during road transport to the point of sale. Grierson and colleagues have generated an antisense version of the polygalacturonase gene which they have introduced into tomato plants. When present at greater than one copy per cell this antisense gene can lead to a 99% reduction in the level of polygalacturonase produced in the fruit. There is no effect on other ripening processes such as colouration however the fruits soften at a significantly slower rate leading to greater NATURAL PRODUCT REPORTS 1993-M. J. McPHERSON AND J. H. PARISH stability. Potentially this form of technology could be of significant future benefit to developing world producers allowing the export of certain 8.4.2 Other Antisense Nucleic Acids Interesting synthetic antisense DNA oligonucleotides can also be used to interfere with normal patterns of gene expression.In this case the sequence of the antisense molecule (some 20 bases long) is able to pair with only a fraction of the target gene or its RNA product but is still able to mediate a biologically significant effect. In its simplest form this approach allows the transient disruption of expression of a gene within cultured animal cells thereby allowing the function of a gene to be defined. One drawback to this simple procedure is that high concentrations of the synthetic oligo must be used in order to ensure uptake of sufficient levels of the antisense DNA and once in the cell the oligos are degraded rather rapidly.Modified oligonucleotides have been prepared both to allow easier entry through the cell membrane and to be more resistant to cellular nucleases. Two categories of oligonucleotide analogues have been studied (a) those containing non-phosphate bonds such as carbonates carbamates diakyl or diarly silyl and formacetal linkages and (b) those containing modified phosphate linkages. For example phosphothioate derivatives (9,Y = S-) are much more resistant to nuclease attack and therefore remain at effective concentrations within the cell for longer periods. Likewise methylphosphonate oligonucleotides (9,X1 = X2 = OH,Y = Me) have the advantage of being more stable but also the non-ionic internucleotide bonds allow more efficient uptake.For general purposes the two desirable qualities are duplex stability and nuclease resistance in for example (9 X1 = X2 = OMe Y = S-).133However in the case of antiviral activity the most effective linkage appears to be (9,X1 = X2 = H Y = S-) apparently through activation of RNaseH.115*134 Further derivatives of oligonucleotide methylphosphonates have been produced which are useful for subsequent ma-nipulation or provide an ability to specifically hydrolyse the target RNA molecule. Such derivative^'^^ include photoreactive crosslinking groups such as 4’-N-(aminoethyl)amino-methyl-4,5’8-trimethylpsoralen ;alkylating groups such as the 4-(N-2- chloroethyl-N-methy1amino)benzylgroup ;and with the EDTA chelating agent which in the presence of Fez+ and a reducing agent generates hydroxyl radicals.’ 8.5 Elucidation of RNA Structure The structure of tRNA has been determined by X-ray crystallographic methods and structures are familiar in any good molecular biology textbook.However more complicated RNA and ribonucleoprotein structures have been determined by a combination of biophysical and chemical methods. The major research effort has been to determine the structure and function of ribosomes. The most detailed information to date concerns the ribosomes of E. coli. H. G. Wittmann (1927-1990) devoted much of his scientific career to this vast project and consecutive memorial papers136 provide a fitting tribute and a convenient detailed summary of the present state of knowledge.Many of the methods rely upon partial nuclease treatment of derivatised ribosomes. The reagents most commonly are UV irradiation ‘nitrogen mustard’ (1 3) 1-iminothiolane (14),and methyl 4-azidophenylacetamidate (15).138The purpose of the experiments is to isolate cross-linked fragments of RNA or RNA-protein molecules. The underlying chemistry of (1 3) is that of a symmetrical electrophilic reagent that can link a base (N7 in guanine) to either another guanine or protein. The cross- linking of RNA to itself or a protein by UV is presumably due to the excitation of the conjugated system involving the 5,6-double bond of uracil and this explains the greater reactivity of 4-thiouracil residues in the cross-linking reactions ;139 (14) and (15) are asymmetric bifunctional reagents that react primarily with primary amines (side chains of lysine residues in proteins) to form guanidine intermediates.They are subsequently photolysed so that an unselective homolytic reaction forms the second bond ;in the case of (1 5) via a nitrene.13’ The analysis of the products of cross-linking with chemical probes relies upon limited digestion with double-strand and single-strand ribo- n~c1eases.l~~ Although these latter include enzymes with base specificity there is no convenient RNA equivalent of sequence- specific restriction endonucleases. The problem is overcome in the case of rRNA molecules (of known sequence) by using sets of oligodeoxyribonucleotide probes complementary to parts of the RNA sequence.Site-specific cleavages can be made by treating the annealed molecules with RNAseH an enzyme specific for RNA-DNA hybrids.14* The stages in the solution of the structure of the ribosome have consisted of (i) determining the secondary structure map of the large rRNA molecules (ii) determining the folding of these into a tertiary structure and (iii) locating the ribosomal proteins’ binding sites ; (i) was achieved partly by cross-linking and other chemical studies and partly by phylogenetic comparisons the secondary structure domains of rRNA are well conserved; (ii) and (iii) were achieved by cross-linking and other studies. The latest achievements in the field have resulted in a model of how the two ribosomal subunits fit together.141 References to other components of the structure are cited in recent papers and review^.'^^.'^^ The model of the ribosome so derived requires refinement especially with respect to the conformation of the proteins but is sufficiently detailed to examine the mechanism of protein synthesis.We refer briefly to three examples. First the binding of the aminoacyl and polypeptidyl tRNAs and the process of translocation has been modelled by using stereo- chemical calculation^;^^^ secondly the location of the mRNA and its interactions with the small subunit rRNA have been determined by ingenious extensions of cross-linking technology by using semi-synthetic mRNA analogues that contain photo- labile thio uracil residues.142 Finally 16s rRNA provides a good example of a functional pseudoknot (section 8.1 .2)143 proved in this case by identifying a conserved region that binds ribosomal protein S12 (involved in the maintenance of the fidelity of protein synthesis) and examining the sequences of compensatory mutations.9 Non-isotopic Labelling of Nucleic Acids For reasons of safety and convenience there is interest in the labelling and detection of nucleic acids by methods that are not based on the use of radioisotopes. The methods summarized here have the additional benefit that the prepared probes are stable for longer periods than are their radio-labelled counter- parts. 9.1 Biotin The specificity of the protein streptavidin for its ligand biotin has been exploited in a number of systems and both NPR 10 NATURAL PRODUCT REPORTS 1993 0 0 (17) (a) peroxidase and H,O,.Scheme 14 immunological and chemiluminescent approaches to signal detection have been reported. Biotin may be added to DNA in a number of reactions. 9.1.1 Labelling DNA A DNA synthesis labelling reaction catalysed by a DNA polymerase may be used to incorporate dUTP-biotin in place of the normal nucleotide dTTP into the growing DNA strand;6 such a reaction is analogous to the normal nick translation or random hexaprime labelling reactions with radiolabelled nucleotides. Photosensitive biotin compounds are also available and lead to derivitization of DNA during reaction mix exposure to short wavelength UV irradiation.Alternatively biotin may be added to the 5'-termini of synthetic oligonucleotides in a simple additional condensation reaction following synthesis of the desired nucleotide sequence. 9.1.2 Detection of Biotin Labelled DNA Detection of biotinylated DNA usually following hybridization to complementary sequences such as in Southern blots or colony screens relies upon the specificity of streptavidin binding to biotin. This protein is usually detected after interaction with biotin by an enzyme-linked antibody. Inter- action of the antibody with streptavidin effectively immo- bilizes the enzyme at the position corresponding to the DNA hybridization complex. A suitable chromogenic substrate for the enzyme can then be added to allow the development of a colour reaction providing direct visualization of the complex.A frequently used enzyme in such detection schemes is alkaline phosphatase which catalyses the release of a terminal phosphate from a range of substrates including 'X-phosphate ' the phosphate analogue of X-gal (Section 2.1). 9.2 Digoxigenin Boehringer-Mannheim have developed a system based on the incorporation of the plant steroid digoxigenin (16,R = H). Nucleic acids can be labelled either by biosynthesis in vitro with dTTP (UTP for RNA) replaced in part by a nucleoside triphosphate in which R (in 16) is a linker attached to the appropriate uracil nucleotide or alternatively by chemical derivatization with a photoreactive compound in which (1 6) is attached at R via a linker to an aromatic azido compound.The label is detected by alkaline phosphatase-linked anti-digoxi- genin antibody and the method has many applications in blot hybridization and in situ hybridization of histological samples.144 9.3 Enhanced ChemiLuminescence (ECL) Amersham plc have developed a DNA hybridization and detection system based upon the generation and detection of photons. It relies on the reaction catalysed by horseradish peroxidase (HRP) in which luminol (17) is oxidized to 3-aminophthalate (18) (Scheme 14).145 The light emitted can be enhanced with certain phenols. In the ECL system HRP is cross-linked to denatured DNA via glutaraldehyde.146 Such DNA is used as a hybridization probe before treatment with H,O and enhancers photons are detected by exposure of X-ray film.The image equivalent to that of an autoradiogram is produced but much more rapidly (1-60 min.) than for a radiolabelled system (2-48 hours). Applications may be limited by the need to perform the DNA hybridization reactions under conditions where the HRP bound to the DNA probe will not be denatured. 9.3.1 Mod@ed ECL Systems Recently modified ECL systems have been introduced for synthesizing oligonucleotides with a 5-thio group which can then be linked to HRP itself modified by chemical incor- poration of a thiol-reactive group. HRP can thus be attached specifically to a synthetic oligonucleotide and this can be used as an ECL hybridization probe.14' 10 Magnetic Separation of Nucleic Acids Biotinylation of DNA or oligonucleotides (Section 9.1) allows non-covalent and reversible attachment to streptavidin coated paramagnetic particles.The specific affinity of streptavidin for its ligand biotin allows the selective separation of biotin- containing DNA from other contaminating molecules which may be other nucleic acids proteins carbohydrates or reaction buffers. Paramagnetic particles standardized polystyrene beads attached via a chemical linker to streptavidin are added to a solution containing biotinylated DNA and following a brief period to allow the binding of the target DNA the tube is placed in a simple magnetic separator. Within 1-2 minutes the paramagnetic beads with the bound DNA have separated from reactants.The biotin-streptavidin complex is stable to pro- cedures designed to wash contaminants from the beads but since the complex is formed by non-covalent interactions the DNA can simply be eluted from the beads by altering the incubation buffer. The potential applications of this simple separation technology in molecular biology are numerous. 148 One example of the integration of methods descried in this article is the use of biotinylated oligonucleotides for the synthesis of DNA via the PCR followed by the rapid purification of the PCR product from the reaction components by magnetic separation methods followed by the sequential elution of the two single strands of the captured DNA as templates for DNA sequencing.It is possible to envisage the automation of such template preparation and purification procedures within the context of large DNA sequencing projects. I1 Conclusions Of several conclusions that might derive from the review we select just two. First there is a sense in which biology has caught up with chemistry in the history of science. Both subjects went through a protracted descriptive phase which led eventually to a set of coherent and testable theories. Following this both subjects entered analytical phases in which systematic NATURAL PRODUCT REPORTS. 1993-M. J. McPHERSON AND J. H. PARISH observations and measurements were used to test and modify theories and to diagnose explanations for behaviour of real systems.An important development in the history of chemistry was the synthetic phase of the subject that was a major triumph for nineteenth century science it led directly to the more effective exploitation of chemistry in manufacturing and more fundamentally to the design of molecules to test specifically theories of reaction mechanisms chemical thermodynamics and other predictive hypotheses. The advent of the analysis and reconstruction of genetic material in vitro has generated the synthetic phase of biological research with parallel conse-quences. The change has coincided with a coming together of chemistry and molecular biology in many respects much molecular biology is now reduced to underlying chemical principles and both subjects share common important technical advances in instrumentation and methods for data acquisition and analysis.Secondly we comment briefly upon the social and political consequences of topics reviewed here. It is reasonable to take as an axiom that scientists are not necessarily directly responsible for unacceptable or sadly atrocious applications of their work geneticists were no more responsible for the idea of a master race and the holocaust than were chemists working on electrophilic reagents responsible for the development of war gases. However it is a part of the responsibility of scientists to provide a background understanding for wider discussion. Most people probably have a commonsense feeling that a statement about a foetus that it has a predisposition to a fatal or disabling condition in later life as a result of its DNA sequence that we can now examine is in some sense different in kind from a statement that it is likely to die of starvation because its mother is living in Somalia or Ethiopia.The opinion is confused and difficult probabalistic analysis of the prospects for the poor children of East Africa is assuredly more certain than that for all but a handful of examples of genetic disease. Our view is not that one idea is right or wrong but that in order to avoid legislative and social difficulties in the future the matter should be one of current debate. We close with a second example of a separate issue that requires such debate the potential for gene transplantation or ‘transgenic humans ’.Many people certainly accept that transplantation of certain organs is an acceptable medical practice. If surgical techniques developed to the point that allowed transplantation of the central nervous system the consensus view might well change but for our purpose the issue to raise is whether gene transplantation is fundamentally different from organ trans- plantation. 12 References 1 J. H. Parish and M. J. McPherson Nut. Prod. Rep. 1987 4 140. 2 M. J. McPherson and J. H. Parish Nat. Prod. Rep. 1987 4 205. 3 ‘PCR Technology Principles and Applications for DNA Ampli- fication’ H. A. Erlich Stockton Press NY 1989; 1989 ‘PCR Protocols A Guide to Methods and Application’ ed. M. A. Innis D. H. Gelfand J. J. Sninsky and T. J. White Academic Press NY.4 ‘PCR A Practical Approach’ ed. M. J. McPherson P. Quirke and G. R. Taylor 1991 IRL Press at Oxford University Press Oxford. 5 PCR a new journal published by IRL Press at Oxford University Press. 6 J. Sambrook E. F. Fritsch and T. Maniatis ‘Molecular cloning a laboratory manual’ 2nd edn. 1989 Cold Spring Harbor Laboratory Press Cold Spring Harbor NY. 7 B. Lewin ‘Genes IV’ 1990 Oxford University Press Oxford. 8 J. M. Short J. M. Fernandez J. A. Sorge and W. D. Huse Nucleic Acids Res. 1988 6 7538. 9 F. S. Hagen C. L. Gray and J. L. Kaijper BioTechniques 1988 6 340. 10 C. A. Plouzek and D. W. Morris ‘Biotechnology -Current Progress vol. l’ ed. P. N. Cheremisinoff and L. M. Ferranta 1991 Technomic Publishing Co. Inc.Lancaster PA p203. 11 P. H. Pouwels B. E. Enger-Valk and W. J. Brammer ‘Cloning Vectors :A Laboratory Manual ’ 1985 Elsevier Science Publishers N.Y.; R. W. West Jr. ‘Vectors A Survey of Molecular Cloning Vectors and their Uses’ ed. R. L. Rodriguez and D. T. Denhardt 1985 Butterworths Press Boston 387. 12 T. Orr-Weaver J. Szotak and R. Rothstein Proc. Natl. Acad. Sci. USA 1981 77 4559. 13 A. Hinnen J. B. Hicks and G. R. Fink Proc. Natl. Acad. Sci. USA 1978 75 1929. 14 E. U. Selker Annu. Rev. Genet. 1990 24 579. 15 J. L. Hartley and J. E. Donelson Nature (London) 1980,286,860. 16 M. J. Dobson A. B. Futcher and B. X. Cox Curr. Genet. 1980 2 860; J. R. Broach Methods Enzymol. 1986 101 307. 17 D. T. Burke G. F. Carle and M. V. Olsen Science 1987 236 806.18 D. Stinchcomb C. Mann and R. W. Davis J. Mol. Biol. 1980 236 806. 19 A. Coulson R. Waterston J. Kiff J. Shulston and Y. Kohara Nature (London) 1988 335 184. 20 R. D. Little G. Porter G. F. Carle D. Schlessinger and M. D’Urso Proc. Natl. Acad. Sci. USA 1990 86 1598. 21 C. N. Traver S. Klapholz R. W. Hyusen and R. W. Davis Proc. Natl. Acad. Sci. USA 1990 86 5898. 22 J. A. van den Berg K. J. Van der Laken A. J. J. van Ooyen T. C. H. M. Rennien K. Rietveld A. Schaap A. J. Brake R. J. Bishop K. Schultz D. Moyer M. Richman and J. P. Schuster BiolTechnology 1990 8 135. 23 J. M. Cregg J. F. Tschopp C. Stillman R. Siegel M. Akong W. S. Craig R. G. Buckholz K. R. Madden P. A. Kellaris G. R. Davis B. L. Smiley J. Cruze R.Tonegrossa G. Velicelebi and G. P. Thill BiolTechnology 1987 5 135. 24 A. Kornberg and T. A. Baker ‘DNA Replication 2nd edn’ 1992 W. H. Freeman NY. 25 P. N. S. Yadav J. S. Yadav and M. J. Modak Biochemistry 1992 31 2879. 26 C. M. Joyce and T. A. Steitz Trends Biochem. Sci. 1987 12,228. 27 M. M. Aboud W. J. Sim L. A. Loeb and A. S. Mildvan EMBO J. 1991 10 25; C. E. Catalan0 and S. J. Benkovic Biochemistry 1989 28 4374. 28 H. Maki S. Maki and A. Kornberg J. Biol. Chem. 1988 263 6570. 29 S. A. Darst E. W. Kubalek and R. D. Kornberg Nature (London) 1985,340,762; L. A. Allison M. Moyle M. Shales and C. J. Ingles Cell 1985 42 599. 30 S. Tabor and C. C. Richardson J. Biol. Chem. 1987,262 15330; Proc. Natl. Acad. Sci. USA 1987 84 4767.31 S. Salhi C. Elie P. Forterre A.-M. De Recondo and J. M. Rossignol J. Mol. Biol. 1989 209 635. 32 F. C. Lawer S. Stoffel R. K. Saiki K. Myambo R. Drummond and D. H. Gelfand J. Biol. Chem. 1989 264 6427. 33 S. Tabor and C. C. Richardson Proc. Natl. Acad. Sci. USA 1989 86 4076. 34 P. Mattila J. Korpella T. Tenkanen and K. Pitkanen Nucleic Acids Res. 1991 19 4697. 35 K. L. Argawal H. Buchi M. H. Caruthers N. Gupta H. G. Khorana K. Kleppe A. Kumar E. Ohtsuka U. L. RajBhandary J. H. van de Sande V. Sgaramella H. Weber and T. Yamada Nature (London) 1970 227 27; E. Kleppe E. Ohtsuka R. Kleppe I. Molineux and H. G. Khorana J. Mol. Biol. 1971 56 341-361. 36 K. Mullis F. Faloona S. Scharf R. Saiki G. Horn and H. Erlich Cold Spring Harbor Symp.Quant. Biol. 1986 51 263. 37 H. A. Erlich D. Gelfand and J. J. Snitsky Science 1991 252 1643. 38 K. R. Tindall and T. A. Kunkel Biochemistry 1988 27 6008. 39 K. A. Eckert and T. A. Kunkel reference 3 p. 227. 40 S. Kwok and R. Higuchi Nature (London) 1989 339 237. 41 G. Sarkar and S. S. Sommers Nature (London) 1990 343 27. 42 T. A. Kunkel Proc. Natl. Acad. Sci. USA 1985 82 488. 43 G. R. Taylor PCR 1991 1 1. 44 M. J. McPherson R. P. Oliver and S. J. Gurr ‘Molecular Plant Pathology I a Practical Approach’ ed. S. J. Gurr M. J. McPherson and D. J. Bowles 1992 IRL Press at Oxford University Press Oxford p. 123. 45 G. Sarkar S. Kapelner and S. S. Sommer Nucleic Acids Res. 1990 18 7465; T. Hung K. Mak and K. Fong Nucleic Acids Res.1990 18 4953. 46 J. Marmur J. Mol. Biol. 1961 3 208; M. J. McPherson A. J. Baron K. M. Jones G. J. Price and J. C. Wootton Protein Engineering 1988 2 147. 47 M. D. Azevedo M. S. Felipe S. Astolfi Fho and A. Radford J. Gen. Microbiol. 1990 136 1335. 48 K. D. Jofuku and R. B. Goldberg ‘Plant Molecular Biology a Practical Approach’ ed. C. S. Shaw 1989 IRL Press Oxford p. 37. 49 S. J. Gurr and M. J. McPherson reference 44,p. 147. 50 D. Giissow and T. P. Clackson Nucleic Acids Res. 1989,17,4000. 51 T. P. Clackson D. Giissow and P. T. Jones reference 4 p. 187. 52 R. M. Horton H. D. Hunt S. N. Ho J. K. Pullen and L. R. Pease Gene 1989 77 61; R. M. Horton and L. R. Pease reference 4 p. 217. 53 U. B. Gyllensten and H. A. Erlich Proc.Natl. Acad. Sci. USA. 1988 85 7652; R. G. Higuchi and H. Ochman Nucleic Acids Res. 1989 17 5865; E. S. Stoflet D. D. Koeberl G. Sarkar and S. S. Sommers Science 1988 239 491. 54 R. T. D’Aqulia L. J. Bechtel J. A. Videler J. J. Eron P. Gorczeyka and J. C. Kaplan Nucleic Acids Res. 1991 19 3749. 55 K. A. Kretz G. S. Carson and J. S. O’Brien Nucleic Acids Res. 1989 17 5864. 56 D. Marchuk M. Drumm A. Saulino and F. S. Collins Nucleic Acids Res. 1991 19 1154; T. A. Holton and M. W. Graham Nucleic Acids Res. 1991 19 1156. 57 K. Knoth S. Roberts C. Poteet and H. Tamkum M. Nucleic Acids Res. 1988 16 10932; R. Sommer and D. Tautz Nucleic Acids Res. 1989 17 6749. 58 M. J. McPherson K. M. Jones and S. J. Gurr in reference 4 p. 171. 59 P. J. Stone and J.H. Parish unpublished data. 60 R. Orlandi D. Giissow P. T. Jones and G. Winter Proc. Natl. Acad. Sci. USA 1989 86 3833; E. S. Ward D. Giissow A. D. Griffiths P. T. Jones and G. Winter Nature (London) 1989,341 544. 61 A. Belyavsky T. Vinogradova and K. Rajewsky Nucleic Acids Res. 1989 17 2919; A. W. Tam M. M. Smith K. E. Fry and J. W. Larrich Nucleic Acids Research 1989 17 1269. 62 J. G. K. Williams A. R. Kubelik K. J. Livak A. Rafalski and S. V. Tingey Nucleic Acids Res. 1990 18 653. 63 G. Caetano-Annelles B. J. Bassam and P. M. Groshoff Biol Technology 1991 9 553. 64 J. Johnson New Scientist 1991 130 44. 65 R. J. Steffan and A. L. Sonenshein Annu. Rev. Microbiol. 1991 45 137. 66 A. J. Jeffreys V. Wilson R. Neumann and J. Keyte Nucleic Acids Res.1988 16 10953; A. J. Jeffreys R. Neumann and V. Wilson Cell 1990 60 473; A. J. Jeffreys A. MacLeod K. Tamaki D. L. Neil and D. G. Monckton Nature (London) 191 354 204. 67 D. P. Jackson F. A. Lewis G. R. Taylor A. W. Boylston and P. Quirke J. Clin Pathol. 1990 43 499; A. Warford J. H. Pringle J. Hay S. D. Henderson and I. Lauder J. Pathol. 1988,154,133; D. P. Jackson J. D. Hayden and P. Quirke reference 4 p. 29. 68 A. J. Ivinson and G. R. Taylor reference 4 p. 15. 69 R. G. Roberts A. J. Montandon P. M. Green and D. R. Bentley reference 4 p. 51; B. J. F. Rossiter M. Grompe and C. T. Caskey reference 4 p. 67. 70 R. G. H. Cotton N. R. Rodrigues and R. D. Campbell Proc. Natl. Acad. Sci. USA 1988 85 4397. 71 B. H. Johnston and A.Rich Cell 1985,42,713; C. M. Rubin and C. W. Schmid Nucleic Acids Res. 1980 8 4613. 72 T. Friedmann and D. M. Brown Nucleic Acids Res. 1978 5 615. 73 F. Sanger and A. R. Coulson J. Mol. Biol. 1975 94 441. 74 ‘Nucleic acid sequencing a Practical Approach’ ed. C. J. Howe and E. S. Ward 1989 IRL Press at Oxford University Press Oxford. 75 S. G. Oliver and 147 co-authors Nature (London) 1992 357 38. 76 M. J. Eby Bioltechnology 1990 8 243 1046. 77 L. M. Smith J. Z. Sanders R. J. Kaiser P. Hughes C. Dodd C. R. Connell C. Heiner S. B. H. Kent and L. E. Hood Nature (London) 1986 321 674; C. Connell S. Fung C. Heiner J. Bridgham V. Chakerian E. Heron B. Jones S. Menchen W. Mordan M. Raff M. Recknor L. Smith J. Springer S. Woo and M. Hunkapiller BioTechniques 1987,5,342;Applied Biosystems 371A DNA sequencer literature available from Applied Bio- systems Ltd.Kelvin Close Birchwood Science Park North Warrington WA3 7PB U.K. 78 R. Frank A. Bosserhoff C. Boulin A. Epstein H. Gausepohl and K. Ashman Bioltechnology 1988 6 121 1. 79 W. J. Martin and R. M. Walmsley Bioltechnology 1990 8 1258. 80 G. M. Church and S. Kieffer-Higgins Science 1988 240 185; M. M. Yang and D. C. Youvan Bioltechnology 1989 7 576. 81 W. Bains and G. C. Smith J. Theor. Biol. 1988 135 303; I. Labat I. Brukner and R. Crkvenjakov Genomics 1989,4 114. NATURAL PRODUCT REPORTS 1993 82 Academic users in the UK can obtain advice via the E-Mail address uig@uk.ac.daresbury.segnet ; alternatively howard@uk.ac.leeds.biovax would be happy to redirect E-mail enquiries.83 A. J. Bleasby and J. C. Wootton Protein Eng. 1990 3 153. 84 K. E. Rudd W. Miller C. Werner J. Oastell C. Tolstoshev and S. G. Satterfield Nucleic Acids Res. 1991 19 637. 85 Y. Kohara K. Akiyama and K. Isono Cell 1987 50 495; Y. Kohara ‘The Bacterial Chromosome’ ed. K. Drlica and M. Riley American SOC. Microbiology Washington D.C. 1990 p. 29; A. Noda J. B. Courtright P. F. Denor G. Webb and Y. Kohara BioTechniques 1991 10 474. 86 J. Sulston Z. Du K. Thomas R. Wilson L. Hillier R. Staden N. Halloran P. Green J. Thierry-Mieg L. Qiu S. Dear A. Coulson M. Craxton R. Durbin M. Berly M. Metzstein T. Hawkins R. Aiscough and R. Waterston Nature (London) 1992 356 37. 87 J. Watson Science 1990 248,44; C. Cantor Science 1990 248 49.88 T. D. Yager D. R. Nickerson and L. E. Hood Trends Biochem. Sci. 1991 16 454; J. E. Celis H. Leffers H. H. Rasmussen P. Madsen B. Honore B. Gesser K. Dejgaard E. Olsen G. P. Ratz J. B. Lauridsden B. Basse A. H. Andersen E. Walbum B. Brtandstrup A. Celis M. Puype J. Vandamme and J. Vandekerckhove Electrophoresis 199 1,12,765 ;L. E. Rosenberg Bull. N. Y.Acad. Med. 1992,60 1 13; P. S. Harper J. Med. Genet. 1992 29 1. 89 D. J. Lipman and W. R. Pearson Science 1985,237 1435; W. R. Pearson and D. J. Lipman Proc. Natl. Acad. Sci. USA 1988 85 2444; W. R. Pearson Methods Enzymol. 1990 183 63; P. L. Miller P. M. Nadkani and N. M. Carriero CABZOS 1991,7,71. 90 M. Murata Methods Enzymol. 1990 183 365. 91 R. Staden Nucleic Acids Res.1980 8 3673; Methods Enzymol. 1990 183 163 193. 92 J. W. Fickett Nucleic Acids Res. 1982 10 5303. 93 D. F. Feng and R. F. Doolittle J. Mol. Biol. 1987 25 351; J. Czelusniak M. Goodman N. D. Moncrieff and S. M. Kehoe Methods Enzymol. 1990 183 601. 94 J. Kyte and R. F. Doolittle J. Mol. Biol. 1982 157 105; D. Eisenberg R. M. Sweet and T. C. Tenvilliger Proc. Natl. Acad. Sci. USA 1984 81 140; D. M. Engelman T. A. Steitz and A. Goldman Annu. Rev. Biophysics Biophys. Chem. 1986 15 321. 95 S. W. Wong A. F. Wahl P.-M. Yuan N. Arai B. E. Pearson K. Arai D. Korn M. Hunkapiller and T. S. F. Wang EMBO J. 1988 7 37. 96 ‘Prediction of Proteins Structure and the Principles of Protein Conformation’ ed. G. D. Fasman 1989 Plenum NY. 97 0.Gascuel and J.L. Golmard CABIOS 1988 4 257. 98 A. N. Kolmogorov IEE Trans. Inform. Theory IT-14 1968 5 662. 99 N. Subbarao and I. Haneef Protein Eng. 1992 5 69; this is the most recent paper by the late Dr Ilyas Haneef who sadly died on 13th July 1992 and who was a close and respected colleague of one of us (JHP). 100 N. Kasinos G. A. Lilley N. Subbarao and I. Haneef Protein Eng. 1991 4 877. 101 M. Zucker and P. Stiegler Nucleic Acids Res. 1981,9 133; S. M. Frier R. Kierzak J. A. Jaeger M. Sugimoto M. H. Caruthers T. Neilson and D. H. Turner Proc. Natl. Acad. Sci. USA 1988,83 9373; M. Zucker Methods Enzymol. 1989 180 262. 102 ‘Directed Mutagenesis -a Practical Approach’ ed. M. J. McPherson 1991 IRL Press at Oxford University Press Oxford. 103 D.B. Olsen and F. Eckstein Proc. Natl. Acad. Sci. USA 1990,87 1451. 104 P. Lehtovaara A. Koivula J. Bamford and J. K. C. Knowles Protein Engineering 1988 2 63; L. Holm A. Koivula P. Lehtovaara A. Hemminki and J. K. C. Knowles Protein En- gineering 1990 3 181; P. Lehtovaara and J. K. C. Knowles (1991) in reference 102 p. 163. 105 J. D. Hermes S. M. Prarekh S. C. Blacklow H. Koster and J. R. Knowles Gene 1989 84 143; S. C. Blacklow and J. R. Knowles (1991) in reference 102 p. 176. 106 M. Inouye and S. Inouye Annu. Rev. Microbiol. 1991 45 163. 107 B. C. Lampson J. Sun M. Y. Hsu J. Vallejo-Ramirez and S. Inouye Science 1989 243 1033. 108 C. W. A. Pleij Trends Biochem. Sci. 1990 15 143. 109 C. Florentz J. P. Briand P. Romby L. Hirth J.-P. Ebel and R.Giege EMBO J. 1982 1 269. 110 K. Rietveld K. Linschotten C. W. A. Pleij and L. Bosch EM30 J. 1984 3 2613; R. L. Joshi S. Joshi F. Chapeville and A. L. NATURAL PRODUCT REPORTS 1993-M. J. McPHERSON AND J. H. PARISH Haenni EMBO J.,1983,2,1123; A. Van Belkum J. P. Abrahams C. W. A. Pleij and L. Bosch Nucleic Acids Res. 1985 13 7673. I1 1 T. Jacks H. D. Madhani F. R. Masiarz and H. E. Varmus Cell 1988,55,447; I. Brierly P. Digard and S. C. Inglis Cell 1989,57 447; D. S. McPheeters G. D. Stormo and L. Gold J. Mol. Biol. 1988 201 517; R. M. W. Mans M. H. Van Steeg P. W. G. Verlaan C.W. A. Pleij and L. Bosch J. Mol. Biol. 223 221. 112 P. Schimmel Cell 1989 58 9. 113 S. L. Beaucage and R. P. Iyer Tetrahedron 1992 48 2223. 114 ‘Oligonucleotides and Analogues -A Practical Approach’ ed.F. Eckstein 1991 Oxford University Press Oxford. 115 S. Agrawal Trends Biotechn. 1992 10 152. 116 K. K. Ogilvie N. Usman M.-Y. Jiang and R. J. Cedergren Proc. Natl. Acad. Sci. USA 1988 85 5764. 117 A. I. Lamond Trenh Biochem. Sci. 1990 15 451; J. Andersen and G. W. Zieve Bioessays 1991 13 57; M. Rosebash and B. Seraphin Trends Biochem. Sci. 1991 16 188. 118 S. C. Darr K. Zito D. Smith and N. R. Pace Biochemistry 1992 31 328; S. C. Durr J. W. Brown and N. R. Pace Trends Biochem. Sci. 1992 17 179. 119 A. J. Zaug P. J. Grabowski and T. R. Cech Nature (London) 1983 301 578. 120 D. Herschlag and T. R. Cech Nature (London) 1990 344 405. 121 V. Dange R. B. Van Atta and S. M. Hecht Science 1990 248 585.122 Z. Xing and J. L. Whitton J. Virol. 1992,66 1361 ;D. Herschlag Biochemistry 31 1386; J. Saunders and P. Towner J. Mol. Biol. 1992 223 351 ; A. T. Perrotta and M. D. Been Biochemistry 1992. 31 16. 123 R. H. Symonds CRC Crit. Revs Plant Sci. 1991 10 189. 124 0.C. Uhlenbeck Nature (London) 1987 328 596. 125 G. Slim and M. J. Gait Nucleic Acids Res. 1991 19 1183. 126 H. A. Heus and A. Pardi J. Mol. Biol. 1991 217 11 3. 127 D. M. Williams W. A. Pieken and F. Eckstein Proc. Natl. Acad. Sci. USA 1992 89 918; J. P. Perrault D. Labuda N. Usman J. H. Yang and R. Cedergren Biochemistry 1991 30,4020. 128 M. Koizumi and E. Ohtsuka Biochemistry 20 5145. 129 K. Tiara M. Oda H. Shinshi H. Maeda and K. Furukada Protein Engineering 1990 3 733.130 N. Sarver E. M. Cantin P. S. Chang J. A. Zaia P. A. Ladne D. A. Stephens and J. J. Rossi Science 1990 247 1222; 0. Heidnereich and F. Eckstein J. Biol. Chem. 1992 267 1904. 131 K. J. Scanlon L. Jiao T. Funato W. Wang T. Tone I. J. Rossi and M. Kashanisabet Proc. Natl. Acad. Sci. USA 1991 88 10591. 132 M. Kramer R. E. Sheehy and W. R. Hiatt Trends in Bio- technology 1989 7 191; A. J. Hamilton G. W. Lycett and D. Grierson Nature (London) 1990 346,2847; A. J. Hamilton M. Bouzayen and D. Grierson Proc. Natl. Acad. Sci. USA 1991,88 7434; M. Kock A. J. Hamilton and D. Grierson Plant Mol. Biol. 1991 17 141. 133 S. Shibahara S. Mukai H. Morisawa H. Nakashina S. Kobayashi and N. Yamamoto Nucleic Acids Res. 1991 17 239. 134 S. Agrawal S. M. Mayrand P.C. Zamecnik and T. Pederson Proc. Natl. Acad. Sci. USA 1990 87 1401. 135 E. Ulmann and A. Peyman Chem. Rev. 1990 90 544; A. Klausner Bioltechnology 1990,8 303; P. S. Miller ibid. 1991 9 358. 136 K. H. Nierhaus Biochimie 1991 73 629; the memorial papers extend to p. 1163. 137 R. Brimacombe W. Stiege A. Kyriatsoulis and P. Maly Methods Enzymol. 1988 164 287. 138 G. Fink H. Fasold W. Rommel and R. Brimacombe Anal. Biochem. 1980 108 394. 139 H. Bailey and J. R. Knowles Methods Enzymol. 1977 46,69. 140 K. Stade J. Rinke-Appel and R. Brimacombe Nucleic Acids Res. 1989 17 9889. 141 P. Mitchell M. Osswald and R. Brimacombe Biochemistry 1992 31 3004. 142 J. Rinke-Appel N. Junke K. Atade and R. Brimacombe EMBO J. 1992 10 2202; 0. Dontsova A. Koplylov and R. Brimacombe EMBO J. 1992 10 2613. 143 T. Powers and H. F. Noller EMBO J. 1992 10 2203. 144 R. Martin C. Hoover S. Grimme C. Grogan J. Holtke and C. Kessler BioTechniques 1990 9 762; A. L. Morey K. A. Flemming R. del Buono and J. A. Chandler J. Pathol. 1991 163(2) 159A. 145 G. H. G. Thorpe L. J. Kricka S. B. Moseley and T. P. Whiteley Clin. Chem. 1985 31 1335. 146 M. Renz and C. Kurz Nucleic Acids Res. 1984 12 3435. 147 B. A. Connely and B. Rider Nucleic Acids Res. 1985 13 4485. 148 A. C.Simmons T. Durrant M. R. Evans M. Cunningham and S. J. Fowler Clin. Chem. 1991 37 1527.

ISSN:0265-0568    

DOI:10.1039/NP9931000175

出版商:RSC    

年代:1993

数据来源: RSC

摘要:

Tropane Alkaloids G. Fodor and R. Dharanipragada" Department of Chemistry West Virginia University Morganto wn WV 26506-6045 USA Reviewing the literature published between January and December 1991 (Continuing the coverage of literature in Natural Product Reports 1991 8 p. 603) 1 Occurrence and Structure of New Alkaloids 2 Synthesis and Transformations of Natural Tropanes including Spectroscopic Studies 3 Synthesis and Properties of Tropane and Homotropane Derivatives 4 Pharmacology of the Main Tropane Bases and of their New Derivatives 4.1 Atropine 4.1.1 Protection against Organophosphorus Compounds 4.1.2 Action against Nocturnal Asthma 4.1.3 Activity against Hyperglycemia and Parkinsonism 4.1.4 Miscellaneous 4.2 Cocaine 4.2.1 General Papers 4.2.2 Study of Binding Sites 4.2.3 Harmful Effects of Cocaine Paranoia Cytotoxicity and Hepatotoxicity 4.2.4 Effects on Sperm and the Fetus 4.2.5 Interactions with other Drugs 4.2.6 Self-stimulation and Self-administration 4.2.7 Discriminative Stimulus Effects 4.2.8 Withdrawal Symptoms and Problems 4.2.9 Miscellaneous 4.3 Scopolamine 4.3.1 Scopolamine as Amnesia Model and Related Studies on Memory 4.3.2 Hyperactivity ; Effect on Slowing 4.3.3 Protection against Organophosphate Exposure 4.3.4 Mydriatic Effect 4.3.5 Intoxications by Scopolamine 4.3.6 Use against Nausea Drooling and Alzheimer Disease 5 Analytical 6 References 1 Occurrence and Structure of New Alkaloids A new tropane alkaloid has been isolated from Pellacalyx axillaris.Spectral analysis degradation and synthesis proved it to be 8-aza-bicyclo[3.2.l]oct-endo-3-yl (E)-3-phenylprop-2-enoate (l) that is 0-cinnamyl-nortropine. Cinnamyltropine has been known2 since 1909. N-formylnorcocaine (2) was isolated recently from illicit c~caine,~ alongside norcocaine and N-benzoylnorecgonine methyl ester ; however none of these can be regarded a natural product they are formed from cocaine through the bleaching process with permanganate. 2 Synthesis and Transformations of Natural Tropa nes including Spectroscopic Studies The ingenious new entry5 into tropanes starting with vinyl- carbenoids and N-substituted pyrroles catalyzed by rhodium- (11) acetate has now been applied to the synthesis of more complex compounds.6 By altering the catalyst to rhodium(I1) hexanoate and using N-(2-trimethylsilyl)ethoxycarbonylpyrrole (3) and methyl 2-diazo-3-butenoate (4) as reaction partners in a non-polar solvent 2-methoxycarbonyl-8-(2-trimethylsilyl-ethoxycarbonyl)-2,6-nortropadiene(5) was obtained in a good yield.Selective hydrogenation of the isolated double bond followed by cleavage of the nitrogen substituent with tetra- butylammonium fluoride gave anhydronorecgonine methyl ester (6) which upon reductive methylation with formaldehyde HNR C,@ * Present address BOC Group Technical Center 100 Mountain Avenue New Jersey 07974 USA 199 NATURAL PRODUCT REPORTS 1993 COOCH2CH2TMS I + 'DcoMe (3) NZ<'OMe Rhd0(33)4* i (PPh3)3RhCIM2 ii NBu4F iii.CH20/Na(CN)BH3 (9) HNTs HNTs (10)R = CHZCHZTMS R=H R=Me R OBn En~(17) R=Ts Me1 (18)R= Me K&O3 MeOH t --0Bn --0Bn b --0Bn -I #I HO HO Ci Ci (14) (15) (16) HN,Ts HN,Ts I .. a m-CPBA HN,Ts R a (21)R=TBDMS Bu~NFE (21)R= H MsCl (21)R= MS Bn = Benzyl Ts = pToluenesulfonyl TBDMS = t-Butyldimethylsilyl Ms = Methanesulfonyl and sodium cyanoborohydride led to (f)anhydroecgonine methylester (7). Similarly by using 3-diazo-4-pentene-2-one (8) and the pyrrole (3) the lower homologue of anatoxin namely ferruginine (10 R = Me) was obtained following the analogous sequence of reactions for the cleavage and reductive alkylation of the tropadiene (9).Stereo-controlled epoxidations of cycloheptene derivatives lead to a second' total synthesis of scopine and of pseudo-scopine.* The route is analogous to the one that was reviewed in this periodical based on a paper by the same senior authorg and his associates in 1987 i.e leading to tropine and pseudotropine. The starting material was 3,5-cycloheptadienol benzyl ether (11) in both syntheses which was chloro-acetoxylated to (12) and this in turn deacetylated by DIBAL to the cis- 1,4-chloroalcohol (1 3). Exchange of chlorine by the NHTosyl group catalyzed with PdO gave rise to the cis-tosylaminoalcohol (14). Exchange of the hydroxyl by chlorine via the mesylate occurred as expected with inversion to give (15).Epoxidation of (15) with rn-chloroperbenzoic acid gave rise to the epoxide (16) with cis- relationship to the nitrogen substituent. The bicyclic system was generated by potassium carbonate in methanol and the NATURAL PRODUCT REPORTS 1993-G. FODOR AND R. DHARANIPRAGADA 20 I (26) R = ethyl n-butyl i-propyl phenyl 4-phenylbutyl benzyl 2-phenylethy1 3-phenylallyl,4-nitrophenylethyl 4-chlorophen yleth yl MeN Cocaine cis-elimination COOCH retro-Diels-Alder reaction dJ CHD-COOCH imino-ene Paza-Co pe CD~-N=CH-CH2-CH2-CH=CH-CH=CH-COOCH~ reaction -rearrangement L (33) (34) ay=CH-CHD-CWCH3 i several H-shifts ii aromatiration * 1 D (35) resulting tosylnorscopine benzylether (17) was cleaved by sodium to norscopine benzylether and this was quenched with methyl iodide to scopine-benzylether (1 8).Catalytic debenzyl- ation with palladium on charcoal gave rise to scopine (19). It is quite surprising that the epoxide group survived these reactions since scopolamine is easily hydrogenolized to 6-hydroxytropine tropoylate under comparable conditions over Raney nickel as a catalyst.'O Pseudoscopine was obtained from the chloro- acetate (12) by (a) exchanging the chlorine with tosylamide with inversion to give (20) (b) protecting the hydroxyl with TBDMS to yield (20) (c) epoxidizing the double bond in (20) with m-CPBA to give (21,R = TBDMS) (d) deprotecting the hydroxyl and converting it into the mesyl ester (21 R = Ms) (e) carrying out the intramolecular S,2 reaction of the tosylamido group into the mesylate to give tosylnorpseudo- scopine benzylether (22) (f) exchanging the tosyl group in the same way as in the case of scopine by methyl and finally (g) debenzylating catalytically to give pseudoscopine (23).The series of reactions is stereoselective particularly the epoxidation which occurs cis to the tosylamido group both in (1 5) and (20). A variety of new benzoylecgonine esters mostly alkyl and arylalkyl derivatives (26) have been synthesized'l starting from benzoylecgonine (24),via the imidazolide (25),and were tested for inhibition of and binding on the cocaine receptor. One of the most potent new compounds was the 3-(4-aminophenyl)- propionyl ester.3-Carbamoylecgonine methyl ester (27) has been described.l* A mixed powder of cocaine and sodium hydrogen carbonate have been measured by an X-ray diffracto- meter and the cocaine content was determined.13 The enantio- metric purity of scopolamine (obviously hyoscine since scopolamine is racemic) was determined by using achiral/chiral coupled column chromatography. l4 The three dimensional structure of scopolamine particularly the configuration of the N-methyl group has been re-examined by a two-dimensional NMR techniquel5 and found to be equatorial (28). A highly interesting study has been published16 concerning the pyrolysis of cocaine. Smoking of cocaine puts special emphasis on the knowledge of the thermal behaviour of cocaine.Last year we reviewed a paper" on the flash vacuum thermolysis of cocaine which leads by a retro-ene reaction to N-methylpyrrole and vinylacetic acid. It was reported earlier1* that cocaine is converted thermally into methyl 4-(3-pyridyl)butanoate (29). The recent paper reports on a mechanistic study of this transformation. N-trideuteromethylnorcocaine (30) was used as the starting material. The deuteriated compound (31) was isolated as the product. The way in which this was rationalized is illustrated. cis-Elimination of benzoic acid from trideutero- cocaine gives rise to the P,y-olefinic ester (32) which undergoes a retro Diels-Alder reaction to the deuteromethylimide of the diene-aldehyde-ester (33). Imino-ene reaction leads to the dideuteromethylene imide of the amino-cyclohexenyl-acetic ester (34) which by an unusual 2-aza-Cope rearrangement gives (2-dideutero-2,3,4,5-tetrahydropyridyl)-2'-deutero-vinyl-acetic ester (35).Stabilization occurs via several hydride shifts NATURAL PRODUCT REPORTS 1993 ,l3CH, N aEE aAA (39) and aromatization to the 2,2’-dideutero derivative (31). A second labelling study with [methyl-13C]cocaine (36) appro- priately produced (37 0 = I3C). The authors16 propose the iminoene reaction be named 2-aza-ene reaction. Several enzymes have been isolated from plant tissue that are responsible for the interconversion of tropane alkaloids in vivo. Leete19 and his associates and Porsteffen20 isolated the enzyme from Datura innoxia that catalyzes the reduction of tropinone to tropine and pseudotropine.Japanese authors have isolated21 hyoscyamine-6~-hydroxylase,that is catalyzing the first step of the conversion of hyoscyamine into hyoscine via 6-hydroxy- hyoscyamine from the pericycle of the root. The mammalian metabolism of scopolamine leads to p-hydroxy- m-hydroxy- and p-hydroxy-m-methoxyscopolamine. 22 Tropane biosynthe- sis is perturbed23 by Horak and Z~man’s~~ thiatropinone (38) which itself is reduced at the carbonyl group by tropinone reduc tase. 3 Synthesis and Properties of Tropane and Homotropane Derivatives Highly interesting non-natural tropanes have been synthesized by Nelsen and his school by indirect oxidation of nortropane. 8,8’-Bi(8-azabicyclo[3.2. lloctane) (39) exists in the crystal structure as the anti-AA conformer.25 In solution however 13C NMR that the most stable conformer is the anti-EE conformer.Successful MNDO calculations were carried out. Interesting data have been revealed for nitrogen inversion in dimeric tropanes.26 Zatosteron a dimethyldihydrobenzofuroyl amide of 3a-aminotropane (40) was synthesized2’ and proved to be a long acting 5-hydroxytryptophane agonist. A new homotropane named mazaticol 7,7’-dimethyl-3-bis(2’,2’-dithi-enylglycollyl)oxy-8-aza-8-methylbicyclo[3.3.1lv4] octane (41) has been synthesized. It is a potent antiparkinsonism agent.28 4 Pharmacology of the Main Tropane Bases and of their New Derivatives 4.1 Atropine Atropine pharmacokinetics have been compared with pharma- codynamics of the central nervous system and of the peripheral nervous Dose-response effects30 of chronic admin- istration of atropine3’.32 have been studied. Intoxication by atropine from Jimson Weed has been Occupational atropine poisoning34 and the toxicity from nebulized atropine have been reported. Oral atropine enhances the risk for acid aspiration in children.36 Lomotil (diphenoxylate with atropine a known anti-diarrhea drug) causes keratocon-jun~tivitis~~ and overdose problems.38 Atropine has been used in keratoplasty for keratoc~nus.~~ Atropine causes vascular HCI Me resistance in the hea~t.~O.~l Atropine in cardiology has been reviewed.42 Atropine has been used as premedication of the newborn infant before nastracheal int~bation.‘~ 4.1.I.Protection against Organophosphorus Compounds Atropine alone and with cholinesterase reactivat~r~~? 45 has been applied to counteract lethality by organophosphate (soman) intoxication ; ~lonidine~~ and diazepam47 were also effective in combination with atropine sulfate. 4.1.2 Action against Nocturnal Asthma Atropine methylnitrate4* atropine and atropine in combination with metaproteren~l~~ and albuterol respectively are efficient against nocturnal asthma Inhaled atropine has an influence upon lung mucociliary function of humans. 51 4.1.3 Activity against Hyperglycemiu and Purkinsonism Hyperglycemia induced by neostigmine is suppressed by The vagal tone of diabetic patients is influenced by atropine.53 Clonidine and atropine affect rest tremor in parkinsonism of a monkey Oral clonidine blunts the heart response to intravenous atropine in 4.1.4 Miscellaneous There are interactions between atropine and 4-amin0pyridine,~~ atropine and low-dose pyrid~stigmine,~’ atropine and diaze- parn.j8 Atropine and glycopyrrolate affect heart rate vari- ability.59 Benzilonium or atropine has an effect on pelvic pouch and anal sphincter functions.60 Centrally administered atropine and pirenzepine influences radial arm maze performance of the rat.61 4.2.Cocaine Cocaine still gives rise to the highest number of studies covered in these annual reviews. 203 NATURAL PRODUCT REPORTS 1993-G. FODOR AND R. DHARANIPRAGADA 4.2.1 General Papers Cocaine has been discussed as a biological and medical prob- lem ;6z the psychosocial psychopathology differences in hospital- ized male and female cocaine abusers;63 the connection between cocaine AIDS and intravenous drug abuse ;64 relationships to alcohol and marijuana use and affective 4.2.2 Study of Binding Sites Cocaine binding sites and recognition sites have been stud- ied66-69 and identified.4.2.3 Harmful Effects of Cocaine :Paranoia Cytotoxicity and Hepato toxicity Harmful effects of cocaine on different organs Paranoia and psychosis proneness cocaine induces cytotoxicity in hepato- cyte cultures ;71 cocaine affects tracheal epithelial function ;?' midline nasal destr~ction'~ is caused by cocaine abuse; vasoconstriction by acetaldehyde is potentiated in arteries by cocaine ;74 cocaine affects epicardial coronary artery reactivity in miniature swine ;75 dynamic properties of respiratory timing following cocaine administration is altered;76 a case of connection between chronic cocaine abuse and kindling induced epilepsy has been described;77 cocaine and footshock stress is related ;78 inhalation efficiency of free-base cocaine by pyrolysis of crack has been Hepatotoxicity of cocaine has been re-investigated.80,81 Cocaine contributes to myoglobinuric renal failure.82* 83 Locomotor activity by cocaine is decreased by NMDA antagonist ;84 dopamine also responded.85 Cocaine actions brain levels and receptors has been studied in mice.86 Psychomotor behaviour is affected by cocaine.87 4.2.4.Effects on Sperm and the Fetus Specific binding to human spermatozoa has been demon- strated.88 Cocaine affects sperm motility.8s Prenatal cocaine exposure results in a higher rate of postnatal mortality.s0 Foetal substantia nigra transplants affect the turning behavior of rats.s1 Prenatal exposure to cocaine influences passive avoid- ance active avoidance and spatial navigation tests in animals.s3 De novo synthesis of cocaine in embryos has been Prenatal exposures2 to cocaine affects acoustic startle and activity in ratss5; it affects umbilical cord length.s6 Prenatal and postnatal cocaine exposure has an effect on somatostatin content of rat pups.s7 Intravenous cocaine affects the rep- roductive function in the male rabbit.s8 The psychiatric effects of cocaine abuse during pregnancy have been studied.s9 4.2.5 Interactions with other Drugs Cannabinoids and cocaine interact on glucose metabolism1O0 and on the mitogen-induced transformations of lymphocytes.lol Estradiol enhances behavioural sensitization to cocaine-stimu- lated [3H]dopamine release. lo2Gamma interferon production is modulated by cocaine and morphine. lo3Buprenorphine antago- nized acute cocaine toxicity. lo4 Cocaine differentially affects benzodiazepine receptors in the brain. lo5 Cocaine-induced inhibition of As-dopaminergic neurons is attenuated by flunarizine.lo6 Cocaine and dopamine antagonist influences body temperature in the rat.la7 The effect of cocaine on milk- consumption is attenuated by dopamine antagonists.lo8 4.2.6 Self-stimulation and Self-administration Cocaine has an effect on intracraniallaS self-stimu1ation.ll0 2p- carbomethoxy-3~-4-fluorophenyltropane has been studied in self-administration.lll Cocaine self-administration was ob-served in rats112 and pigeons.l13 Both D1 and D2 receptors maintain cocaine self-administrati~n.~~~ 4.2.7 Discriminative Stimulus Effects Discriminative stimulus effects of cocaine on squirrel monkeys have been studied.l15* 116In vivo voltammetric studies on release mechanisms for cocaine with y-butyrolactone have been carried 4.2.8 Withdrawal Symptoms and Problems After withdrawal from cocaine and cocaine-alcohol abuse a cardiovascular evaluation of the patients has been made.l18 Chronic cocaine administration followed by withdrawal modify neurotensin binding in rat brain;'lg it also decreases auto- radiographic 3H-mazindol labelling of the dopamine trans- porter.lZ0 Cocaine abstinence causes changes that need clinical phenomological and neurobiological studies.121+ lZ2Basal extra- cellular dopamine is decreased in the rat during abstinence from chronic cocaine.123 The significant scope and behavioural interventions of the methodane treatment of cocaine users has been ~utlined.~~~.~~~ 4.2.9 Miscellaneous Long-term neurological complications of chronic habitual cocaine abuse were studied.126 Chronic cocaine administration affects locomotor activity differently in male and in female patients.127A pharmacogenic evaluation of the role of local anaesthetic actions in the cocaine kindling process has been made.128 4.3 Scopolamine 4.3.1.Scopolamine as Amnesia Model and Related Studies on Memory Scopolamine-induced amnesia is reversed by administrati~n~~~ with 5-HT3 antagonist ICS 205-930 or by benzodiazepine receptor inverse agonist~l~~ RU 34331 and FG 7142. A new cognition enhancer a-glycerylphosphorylcholine on scopo-lamine-induced amnesia has been reported. 131. 132 Scopolamine induces cognitive impairment in rhesus monkeys. 133 Scopo-lamine-induced impairments of spontaneous alteration per- formance is reversed by glucose and cholinergic and adrenergic antagonists. 134 The effects of scopolamine and lorazepam on memory were 136 Enalapril pre-treatment reverses scopolamine-induced cognitive deficits in healthy volunteers.137 The scopolamine model has been used to study the nortropic effects of aniracetam and pira~etam.'~~ Tetrahydroamino-acridine reverses scopolamine induced memory and perfor- mance deficits in rats.139 Four non-cholinergic cognitive enhancers have been compared with tacrine and galanthamine on scopolamine induced amnesia in rats.140 Scopolamine and non-cholinergic agents have induced cognitive impairment in rhesus monkeys. 141 Scopolamine-induced amnesia in rats is influenced by naftidrofuryl oxalate.142 Attentional and amnestic effects in information processing caused by scopolamine and nicotine have been distinguished. 143 Scopolamine affects mid- latency autidory-evoked re~p0nse.l~~ A comparison has been made on how clonidine and scopolamine change human information p~ocessing.'~~ The effects of scopolamine on the memory of pigeons has been The effect of scopo- lamine diazepam pentobarbital and scopolamine upon the timing of saline injection on learned immobility in rats has been studied.14? Serotonergic receptor antagonists and their com- bination with scopolamine on memory have been described.148 Effects of scopolamine on a test of visual recognition memory have been estab1i~hed.l~~ The effects of scopolamine on retrieval from semanthic memory have been evaluated.150 A comparison of scopolamine and diazeparnl5l and scopolamine and pro- pranolol and phenyl isopropyladenosine on working mernory1j2 has been made.Attempts to reverse scopolamine-induced cognitive deficit failed. 153 Scopolamine enhances expression of an amphetamine-conditioned place preference. 154 Decrease in 204 catecholamines in the brain prevents the antagonism of oxiracetam to scopolamine effect on memory.155 The cholingeric deficit hypothesis has been investigated in the rat brain with physostigmine and scopolamine. 156 Scopolamine has an effect on visual evoked potentials in ageing and dementia.157 Pharmacodynamic antagonism of Ru 41 656 on scopolamine and triazolam impairment has been studied.158 Predatory behaviour pattern in cats is altered by 4.3.2. Hyperactivity ;Efect on Slowing Cholinergic and dopaminergic agents contribute to scopola- mine-induced hyperactivity in mice.160 P-Glucuronide and sulfate show conjugation of scopolamine and glycopyrrolate.161 The effects of THA on scopolamine-induced EEG slowing have been described. 16*.163 Oxotremorine physostigmine and scop- olamine affect brain acetylcholine 4.3.3 Protection against Organophosphate Exposure Cholinolytics scopolamine physostigmine and pyridostigmine have comparable protective "C-scopolamine was used for in vivo muscarinic cholinergic receptor imaging along with positron emission tomography.166 4.3.4 Mydritic Eflect Unilateral mydriasis was caused by transdermal scopolamine. 167 A simple test was elaborated for scopolamine mydriasis. 168 4.3.5 Intoxications by Scopolamine Scopolamine can cause acute paranoid-hallucinatory psycho- Acute scopolamine was observed after sniffing adul- terated cocaine.170 Recurrent classic migraine attacks followed transdermal scopolamine intoxi~ation.'~~ Scopolamine poison- ing was caused by homemade 'moon flower' wine.172 4.3.6 Use against Nausea Drooling and Alzheimer Disease Scopolamine is used against nausea and drooling in Alzheimer and Parkinson diseases. Undersea biomedical research uses scopolamine.173 Transdermal scopolamine was applied against postoperative nausea and vomiting of morphine. 174-176 Trans-dermal scopolamine was used as nausea prophylaxis.177 Scopolamine (transdermal) controls dro01ing.~~~-~~~ 3H-N-methylscopolamine is differently bound in Alzheimer's dis- ease.161 Scopolamine responds to aporphine-induced anti-parkonsian symptoms.162 Scopolamine has an impact on environmentally induced pain reactivity. lS3 Scopolamine has an affect on sleep and mood of depressed patients with a history of There is a dose dependent effect of scop-olamine on noctural growth hormone secretion in normal adult men.lS5 D1 and D2 antagonists have interactive effects with scopolamine on radial-arm maze performance. lS6 5 Analytical Tropane alkaloids have been analyzed by mixed-column high performance liquid chromatography in plants. 187 Biosynthetic tropane precursors tropic benzoic and cinnamic acids have been determined by gas chromatography. lB6Tropane alkaloids have been identified in hairy root cultures of Hyoscyamus a1b~s.l~~ Combination of ion-pair and column switching in high performance liquid chromatography has been applied in complex preparations of dr~gs,~~~~ lS1and with the thermospray high performance liquid chromatography-mass spectro-metry.Ig2 Tropane alkaloids have been analyzed particularly scopolamine as the hydrobromide when adsorbed onto micro- crystalline cellulose and sodium carboxymethyl-cellulose in tablets.lS3 Special emphasis has been put on analysis of biological specimens for cocaine and also atropine.lS4Cocaine NATURAL PRODUCT REPORTS 1993 was determined in hairlg5*lS6 by GC-MS. A rapid determination of cocaine in brain tissue has been e1ab0rated.l~~ Cocaine and its product of alcoholysis cocaethylene have been determined in blood and in tissues by GC-NPD and GC-ion trap mass spectrometry.lS8GC-MS was also used for determining cocaine in decomposed human remains.lS9 6 References 1 D. Arbain. R. D. Wiryani and M. V. Sargent Aust. J. Chem. 1991 44 1013. 2 H. A. D. Jowett and F. L. Pyman J. Chem. SOC. 1990 95 1020. 3 J. G. Ensing and J. C. Humelen J. Forensic Sci. 1991 36 1666. 4 M. J. LeBelle B. Dawson G. Lauriault and C. Celine Analyst 1991 116 1063. 5 M. M. L. Davies W. B. Young and H. D. Smith Tetrahedron Lett. 1989 30 593; Reviewed in Nat. Prod. Rep. 1991 8 604. 6 H. L. L. Davies E. Saikali and W. B. Young J. Org. Chem. 1991 56 5696. 7 Scopine was prepared by total synthesis first in 1956 (G. Fodor et al. Chem. Ind. 1956 764; cJ F. Bergel ibid. 1957 745-750). Scopine was converted into pseudoscopine (via scopinone) in 1959 by A.Heusner and K. Zeile Chem. Ber. 1959 91 2399. 8 H. E. Petterson and J. E. Backvall J. Org. Chem. 1991 56,2769. 9 J. E. Backvall Z. D. Renko and S. E. Bystrom Tetrahedron Lett. 1987,.28 4199; reviewed in Nat. Prod. Rep. 1990 7 539. 10 G. Fodor 0. Kovdcs and L. M6szaros. Research. 1952. 5. 524 G. Fodor I. Koczor and G. Janzso Arch. Pharmaz. 1962 295 91. 11 A. H. Lewin Y. Gao P. Abraham J. W. Boja M. J. Kuhar and F. Ivy Carroll J. Med. Chem. 1992 35 135. 12 R. H. Kline Diss. Abstr. Int. B. 1991 52 1454. 13 T. Mitsui S. Okuyama and Y. Fujimura Anal. Sci. 1991 7 941. 14 A. K. Stalcup J. R. Faulkner Jr. Y. Tang D. Armstrong L. W. Levy and E. Regaldo Biomed. Chromatogr. 1991 5 3. 15 C.Sarazin G. Goethals J. P. Seguin and J. N. Barbotin Magn. Res. Chem. 1991 29 291. 16 M. Novak J. Novak and C. Salemink Tetrahedron Lett. 1991 32 4405. 17 N. J. Sisti F. W. Fowler and J. S. Fowler Tetrahedron Lett. 1989 30 3977; reviewed in Nat. Prod Rep. 1991 8 603. 18 M. Novak and C. A. Salemink Tetrahedron 1989 45 4287. 19 M. M. Couladis Friesen M. E. Landgrebe and E. M. Leete Phytochemistry 199 1 30 80 I. 20 A. PortsteTen B. Frager and A. Nahrstedt Planta Med. 1991 Suppl. 2 57 A107. 21 T. Hashimoto A. Hayashi T. Amano J. Kohno H. Iwanari S. Usuda and Y.Yamada J. Biol. Chem. 1991 266,4648. 22 S. Wada T. Yoshimisu N. Koga K. Oguri and H. Yoshimura Xenobiotica 1991 21 1289. 23 A. J. Adrian N. J. Walton S. Bensalen P. H. McCabe and W.Rootledge Phytochemistry 1991 30 2607. 24 V. Horak and P. Zuman Coll. Czech. Chem. Commun. 1963 28 1614. 25 S. F. Nelsen S. C. Blackstock D. J. Steffek G. T. Clunke and M. L. Kurtzwell J. Am. Chem. SOC. 1988 110 6149. 26 S. F. Nelsen G. T. Cunkle D. H. Evans K. J. Haller M. Kaf- tory B. Kriste H. Kurreck and T. Clark J. Amer. Chem. SOC. 1985 107 3829. 27 D. W. Robertson W. B. Lacefield W. Bloomquist W. Pfeifer R. L. Simon and M. L. Cohen J. Med. Chem. 1992 35 310. 28 I. Fukuchi K. Kawashima and R. Ishida Oyo Yakuri 1991 42 105 (Chem. Abstr. 1991 116 513772). 29 E. H. Ellinwood Jr. A. M. Mikaido S. K. Gupta D. G. Heath- erly and J. K. Nishita J. Pharmacol. Exp. Ther. 1990,255 1133. 30 J. Boudet W. Quing A. Boyer-Chammard G. Del Granco J.L. Bergougnan R. Rosen and P. Meyer Fundam. Clin. Pharmacol. 1991 5 635. 31 B. Chevalier P. Mansier E. Teiger F. Callens-El Amrani and B. Sywnghedauw Mech. Aging Dev. 1991 60,215. 32 M. McKinney and M. Robbins Mol. Brain Res. 1992 12 39. 33 S. R. Guharoy and M. Barajas Vet. Hum. Toxicol. 1991,33,588. 34 G. L. Larkin Lancet 1991 337 917. 35 Z. J. Herschman J. Silverman G. Blumberg and A. Lehrfield J. Toxicol. Clin. Toxicol. 1991 29 273. 36 T. Randell L. Saarnivaara M. Oikkonen and L. Likdgren Acta Anaesthesiol. Scand. 199 1 35 65 1. 37 T. H. Mader and R. D. Stulting Am. J. Ophthalmol. 1991 111 377. NATURAL PRODUCT REPORTS 1993-G. FODOR AND R. DHARANIPRAGADA 38 M. M. McCarron K. R. Challoner and G. A. Thompson Pedi-atrics 1991 87 694.39 0.Geyer L. Rothkoff and M. Lazer Cornea 1991 10 372. 40 J. A. Reitan H. D. Kien R. W. Martucci S. J. Thorup and P. J. Dennis J. Pharmacol. Methods 1991 26 223. 41 D. F. Matesic and G. R. Luthin FEBS Lett. 1991 284 184. 42 A. Hollman Br. Heart J. 1991 66 367. 43 N. N. Finer Crit. Care Med. 1990 18 1307. 44 J. A. Romano Jr. M. R. Terry M. L. Murrow and M. Z. Mays Drug Chem. Toxicol. 1991 14 21. 45 D. A. Ligtenstein and F. W. H. Moes Toxicol. Appl. Pharmacol. 1991 107 47. 46 W. F. Liu Toxicol. Lett. 1991 56 19. 47 T. M. Shih Brain Res. Bull. 1991 26 565. 48 S. Sur A. A. Mohiuddin P. Vichyanond and H. S. Nelson Ann. Allergy 1990 65 384. 49 M. W. Owens and R. B. George Chest 1991 99 1084. 50 G. P. Young and P.Freitas Ann Emerg. Med. 1991 20 513. 51 M. L. Groth and L. Maritza Am. Rev. Respir. Dis. 1991 144 1042. 52 A. Iguchi K. Uemura Y. Kunohn H. Miura 1. Ishiguro K. Nonogaki T. Tamagawa M. Gotoh and N. Sakamoto Neuro-pharmacology I99 1 30 1129. 53 P. 0. 0. Julu J. Adler and R. G. Hondo J. Physiol. 1991 435 33P. 54 B. Gomez-Mancilla R. Boucher and P. J. Bedard Clin. Neuro- pharmacol. 1991 14 359. 55 R. Nishikawa and S. Dohi Anesthesiology 1991 75 217. 56 V. Dolezal and L. Wecker J. Pharmacol. Exp. Ther. 1991 258 762. 57 S. Izraeli M. Alcalay Y. Benjamini R. Wallack-Kapon and Z. Tockner Pharmacol. Biochem. Behav. 1991 39 613. 58 D. H. Moore R. C. Smallridge J. D. Von Bredow and B. J. Lukey Biopharm. Drug Dispos. 1991 12 525.59 R. Ali-Melkkila R. Kaila K. Antila L. Halkola and E. Iisalo Acta Anaesthesiol. Scand. 1991 35 436. 60 T. Hallgren S. Fasth D. Delbro S. Nordgren T. Oresland and L. Hulten Scand. J. Gastroenterol 1991 26 563. 61 M. Sala D. Braida P. Calcaterra M. P. Leone F. A. Comotti S. Gianola and E. Gori Eur. J. Pharmacol. 1991 194 45. 62 M. E. Firth J. R. SOC. Med. 1991 85 753. 63 C. A. Denier A. K. Thevos P. K. Latham and C. L. Randall Addict. Behav. 1991 16 489. 64 S. R. Friedman and D. S. Lipton J. Addict. Dis. 1991 10 1. 65 L. Spalt Ann. Clin. Psychiatry 1991 3 291. 66 M. E. Reith and G. Selmeci Pharmacol. Biochem. Behav. 1992 41 227. 67 M. J. Kaufman R. D. Spealman and B. K. Madras Synapse 1991 9 177. 68 M. J. Kaufman and B. K. Madras Synapse 1991 9 43.69 T. A. Kosten D. W. Marby and E. J. Nestler Life Sci. 1991,49 PL20 1. 70 S. L. Satel and W. S. Edell Am. J. Psychiatry 1991 148 1708. 71 C. R. Goelding and U. A. Boelsterli Toxicology 1991 69 79. 72 J. M. Farley J. G. Adderholt and T. M. Dwyer J. Pharmacol. Exp. Ther. 1991 259 241. 73 J. A. Servatz B. Strasnick A. Newman and L. G. Dodd Oto-laryngol. Head Neck Surg. 1991 105 694. 74 S. Chiba and M. Tsukada Tohoku J. Exp. Med. 1991 165 63. 75 K. Egashira F. S. Pipers and J. P. Morgan J. Clin. Invest. 1991 88 1307. 76 C. A. Richard H. Ni R. K. Harper and R. M. Harper Pharma-col. Biochem. Behav. 1991 39 941. 77 A. Dhuna A. Pascual-Leone and F. Langendorf Epilepsia 1991 32 890. 78 B. A. Sorg and P. W. Kalivas Brain Res.1991 559 29. 79 Y. Nakahara and A. Ishigami J. Anal. Toxicol. 1991 15 105. 80 C. S. Boyer and D. R. Petersen Heptatology 1991 14 1209. 81 G. J. Wang P. Som Z. H. Oster and N. D. Volkow Nuc-Compact 1991 22 72. 82 A. Lucatello A. Strurani R. Cocchi and M. Fusaroli Nephron 1992 60,242. 83 M. L. Kauker P. J. Gisi and E. T. Zawada Nephrotoxicity 1991 Proceedings of a Symposium 85-89 Peter H. Bach Ed. Dekker New York NY. 84 L. Pulvirenti N. R. Swerdlow and G. F. Koob Pharmacol. Biochem Behav. 1991 40 841. 85 M. S. Hooks G. H. Jones A. D. Smith D. B. Neill and J. B. Justice Jr. Synapse 1991 9 121. 86 B. C. Jones A. D. Campbell R. A. Radcliffe and V. G. Erwin Pharmacol. Biochem. Behav. 1991 40 941. 87 P. A. Broderick Pharmacol.Biochem. Behav. 1991 40,959. 88 R. A. Yazigi R. R. Odem and K. L. Polakoski J. Am. Med. ASSOC.,1991 266 1956. 89 W. W. Hurd M. S. Kelly D. A. Ohl J. M. Gauvin A. J. Smith and C. A. Cummins Fertil. Steril. 1992 57 178. 90 M. W. Church P. A. Holmes G. W. Overbeck J. P. Tilak and C. S. Zajac Neurotoxicol. Teratol. 1991 13 567. 91 V. Meloni and K. Gale Eur. J. Pharmacol. 1991 209 1 13. 92 W. S. Webster P. D. C. Brown-Woodman A. H. Lipson and H. E. Ritchie Neurotoxicol. Teratol. 1991 13 621. 93 E. P. Riley and J. A. Foss Neurotoxicol. Teratol. 1991 13 559. 94 E. L. Johnson and M. A. Elsohly Ann. Bot. 1991 68,481. 95 J. A. Foss and E. P. Riley Neurotoxicol. Tetratol. 1991 13 547. 96 S. Barron J. A. Foss and E. P. Riley Neurotoxicol.Tetratol. 1991 13 503. 97 M. Rodriguez-Sanchez I. Alvaro and E. Arilla Pepfides 1991 12 951. 98 S. J. Atlas and E. E. Wallach Am. J. Obstet. Gynocol. 1991 165 1785. 99 M. E. James and C. D. Coles Gen. Hosp. Psychiatry 1991 13 399. 100 S. Husain and J. Anwer Pharmacol. Biochem Behav. 1991 40 625. 101 Y. D. Luo M. K. Patel and D. W. Ou Int. J. Immunopharm. 1992 14 49. 102 J. Peris N. Decanbrel M. L. Coleman-Hardee and J. W. Simp- kins Brain Res. 1991 566 255. 103 G. J. Chen and R. R. Watson J. Leukocyte Biol. 1991 50 349. 104 V. K. Shukla L. R. Goldfrank H. Turndorf and N. Bansinath Life Sci. 1991 49 1887. 105 N. E. Goeders J. Pharmacol. Exp. Ther. 1991 259 574. 106 M. Diana L. Pani Z. Rossetti N. Passino and F. L.Gessa Pharmacol. Res. 1991 24 197. 107 P. Lomax and K. A. Daniel Proc. West. Pharmacol. SOC. 1991 34 5. 108 D. Rapoze and W. L. Woolverton Pharmacol. Biochem. Behav. 1991 40 133. 109 H. P. Williams P. Z. Manderscheid M. Schwartz and R. A. Frank Pharmacol. Biochem. Behav. 1991 40 273. 110 D. Corbett Neuroreport 1991 2 805. 111 R. D. Spealman J. Bergman and B. K. Madras Pharmacol. Biochem. Behav. 1991 39 1011. 112 N. F. Ramsey and J. M. Van Ree Pharmacol. Biochem. Behav. 1991 40 807. 113 P. J. Winsauer and D. M. Thompson Pharmacol. Biochem. Behav. 1991 40 41. 114 D. R. Britton P. Curzon R. G. Mackenzie J. W. Kebabian J. E. G. Williams and D. Kerkman Pharmacol. Biochem. Behav. 1991 39 911. 115 J. L. Katz L. G. Sharpe J. H. Jaffe E.I. Shores and J. M. Witkin Psychopharmacology 1991 105 3 17 116 R. S. Spealman J. Bergman D. K. Madra and K. F. Melia J. Pharmacol. Exp. Ther. 1991 258 945. 117 P. A. Broderick Pharmacol. Biochem. Behav. 1991 40,969. 118 R. M. Moskowitz and A. J. Errichetti J. Addict. Dis. 1991 10 47. 119 N. S. Pilotte W. M. Mitchell L. G. Sharpe E. B. De Soueze and E. M. Dax Synapse 1991 9 11 1. 120 L. G. Sharpe N. S. Pilotte W. M. Mitchell and E. B. De Souze Eur. J. Pharmacol. 1991 203 141. 121 W. W. Weddington N. D. Wolvow R. Hitzemann J. S. Fowler and A. P. Wolf Am. J. Psychiatry 1991 148 1759. 122 S. L. Satel L. H. Price J. M. Palumbo C. J. McDougle J. H. Krystal F. Gawing D. S. Charney G. R. Heninger and H. D. Kleeber Am. J. Psychiatry 1991 148 1712.123 L. H. Parsons A. D. Smith and J. B. Justice Jr. Synapse 1991 9 60. 124 W. S. Condelli J. A. Fairbank M. L. Dennis and J. V. Rachal J. Subst. Abuse Treat 1991 8 203. 125 S. Magura Q. Siddiqi R. C. Freeman and D. S. Lipton J. Addict. Dis. 1991 10 31. 126 A. Pascual-Leone A. Dhuna and D. C. Anderson Neurotoxi-cology 1991 12 393. 127 F. Van Haaren and M. E. Meyer Pharmacol. Biochem. Behav. 1991 39 923. 128 R. J. Marley J. M. Witkin and S. R. Goldberg Brain. Res. 1991 562 251. 129 T. Chugh N. Saha A. Sankaranarayana and H. Datta Pharma-col. Toxicol. 1991 69 105. 130 G. Galliani A. Nencioni A. Maggioni and P. Millier Med. Sci. Red. 1991 19 441. 131 C. M. Lopez S. Boboni F. Battaini S. Bergamaschi A.Longoni C. Giaroni and M. Trabucchi Pharmacol. Biochem Behav. 1991 39 835. 132 N. Canal M. Franceschi M. Alveroni C. Castiglioni P. De Moliner and A. Longoni Int. J. Clin. Pharmacol. Ther. Toxicol. 1991 29 103. 133 N. M. J. Rupniak N. A. Samson M. J. Steventon and S. D. Ivrsen Life Sci. 1991 48 893. 134 W. S. Stone B. Walser S. D. Gold and P. E. Gold Behav. Neuro- sci 1991 105 264. 135 H. V. Curran F. Schifano and M. Lader Psychopharmacology 1991 103 83. 136 S. E. File P. S. Mabbutt and E. Toth Pharmacol. Biochem. Behav. 1990 37 587. 137 C. R. Lines G. C. Presont C. E. Dawson C. Brazell and M. Traub J. Psychopharmacol. 1991 5 228. 138 K. Wesnes R. Anand P. Simpson and L. Christman J. Psycho-pharmacol. 1990 4 219. 139 T. K. Murray and A.J. Cross Psychopharmacology 1991 105 134. 140 P. Chopin and M. Briley Psychopharmacology 1992 106 26. 141 N. M. J. Rupniak N. A. Samson M. J. Steventon and S. D. Iversen Life Sci. 1991 48 893. 142 S. I. Ogawa T. Kameyama and T. Baeshima Pharmacol. Bio- chem. Behav. 1991 39 997. 143 J. Rusted and P. Eaton-Williams Psychopharmacology 1991,104 363. 144 L. W. Dickerson and J. S. Buchwald Exp. Neurol. 1991 112 229. 145 E. Callaway R. Halliday H. Naylor and B. Brandeis Prog. Neuro- Psychopharmacol. Biol. Psychiatry 1991 15 497. 146 A. Santi and S. Bridson Pharmacol. Biochem. Behav. 1991 39 935. 147 J. M. De Pablo J. Ortiz-Caro F. Sanchez-Santed and A. Guil- lamon Physiol Behav. 1991 50 895. 148 V. Petkov V. Markovska and V.Petkov Acta Physiol Pharma- col. Bulg. 1991 17 149 T. G. Aigner D. L. Walker and M. Mishkin Behav. Neural Biol. 1991 55 61. 150 C. R. Lines G. C. Preston P. Brooks and C. E. Dawson J. Psychopharmacol. 1991 5 234. 151 J. M. Rusted P. Eaton-Williams and D. M. Warburton Psycho-pharmacology 1991 105 442. 152 M. J. Pontevorvo D. B. Clissold M. F. White and J. W. Ferkany Behav. Neurosci. 1991 105 521. 153 A. Patat M. J. Klein A. Surjus M. Mucher and J. Granier Eur. J. Clin. Pharmacol. 1991 41 225. 154 M. R. Lynch Neuroreport 1991 2 715. 155 M. G. Giovannini G. Spignoli V. Carla and G. Pepeu Pharma-col. Res. 1991 24 395. 156 W. Meier-Ruge M. Kolbe and J. Sattler Arch. Gerontol. Geriatr. 1991 12 239. 157 P. G. Ray K. J. Meador D.W. Loring A. M. Murro J. J. Buccafusco X. H. Yang E. Y. Zamrini W. 0.Thompson and E. E. Tompson Electroencephalogr. Clin. Neurophysiol. Evoked Potentials 1991 80 347. 158 A. Patat M. J. Klein A. Surjust and M. Hucher Hum. Psycho-pharmacol. 1990 5 323. 159 J. Zagrodzka and P. Kubiak Acta Neurobiol. Exp. 1991 51 29. 160 H. E. Shannon and S. C. Peters J. Pharmacol. Exp. Ther. 1990 255 549. 161 E. Kentala T. Kaila T. Ali-Melkkila and J. Kanto Int. J. Clin. Pharmacol. Ther. Toxicol. 1990 28 487. 162 R. Riekkinen Jr. P. Jakala J. Sirvio E. Koivisto R. Meittinen and P. Riekkinen Brain Res. Bull. 1991 26 633. 163 A. Valjakka K. Lukkarinen E. Koivistol R. Riekkinen Jr. R. Miettinen M. M. Airaksinen R. Lammintausta and R. Riek- kinen Brain Res.Bull. 1991 26 739. 164 N. Bertrand and A. Beley Neurochem. Res. 1990 15 1097. NATURAL PRODUCT REPORTS 1993 165 R. P. Solana C. Gennings W. H. Carter D. Anderson W. J. Lennox R. A. Carchman and L. W. Harris J.Am. CON.Toxicol. 1991 10 215. 166 K. A. Frey R. A. Keoppe G. K. Mulholland D. Jewett R. Hichwa R. L. E. Ehrenkaufer J. E. Carey D. M. Wieland D. E. Kuhl and B. W. Agranoff J. Cereb. Blood Flow Metab. 1992 12 147. 167 M. M. Rubin R. S. Sadoff and G. M. Cozzi Oral Surg. Oral Med. Oral Pathol. 1990 70 569. 168 M. D. Larson and S. Kiyama Anesth. Analg. 1991 73 824. 169 B. Ziegler and W. Tonjes Psychiatry. Prax. 1991 18 21. 170 S. Nogue P. Sanz P. Munne and R. Dela Torre Drug Alcohol Depend. 1991 27 115. I71 C. R. Gordon D.Mankuta A. Shupal 0.Spitzer and I. Doweck Headache 1991 31 172. 172 E. A. Smith C. E. Meloan J. A. Pickell and F. W. Oehme J. Anal. Toxicol. 1991 15 216. 173 N. Bitterman E. Eilender and Y. Melamed Undersea Biomed. Res. 1991 18 167. 174 0.Kanbak S. Tuzuner and F. Y. Gogus Turk Anestezioyoloji Reanimasyon 1991 19 18. 175 Y. Horimoto H. Tomie K. Hanzawa and Y. Nishida Anaesth. 1991 38 441. 176 F. D. Ferris I. G. Kerr M. Sone and M. Marcuzzi J. Pain Symptom Manage. 1991 6 389. 177 S. N. Harris F. B. Servarin R. S. Sinatra L. Preble T. Z. O’Conner and D. G. Silverman Obstet. Gynocol. 1991 78 673. 178 L. K. Siege1 and M. A. Klingbeil Dev. Med. Child Neurol. 1991 33 1013. 179 P. Dreyfuss D. Vogel and N. Walsh Am. J. Phys. Med. Rehabil.1991 70 220. 180 F. Xiaoling L. Hanyun P. Qineng S. Zilong and L. Mingsheng J. China Pharm. Univ. 1990 21 267. 181 P. Ferrero P. Rocca C. Eva P. Benna N. Revaudengo L. Ravizze E. Genazzani and B. Bergamasco Brain 1991 114 1759. 182 R. J. Carey Psychopharmacology 1991 104 463. 183 J. W. Grau P. A. Illich P. S. Chen and M. W. Meagher Behav. Neurosci. 1991 105 62. 184 J. C. Gillin L. Sutton C. Ruiz D. Darko S. Golshan S. C. Risch and D. Janowsky Biol. Psychiatry 1990 30 157. 185 J. E. McCracken R. E. Poland R. T. Rubin and L. Tondo J. Clin. Endocrinol. Metab. 1991 72 90. 186 E. D. Levin and J. E. Rose Pharmacol. Biochem Behav. 1991 38 243. 187 S. Mandal A. A. Naqvi and R. S. Thakur J. Chromatorgr. 1991 547 468. 188 A.Martinsen and A. Huhtikangas J. Chromatograph. 1991,539 232. 189 K. Doerk L. Witte and A. W. Alfermann Naturforsch Teil C 1991 46 519. 190 T. Oshima K. Safara F. Hirayama T. Mizutani L.-Y. He Y.-Y. Tong Y.-H. Chen and H. Itokawa J. Chromatogr. 1991 547 175. 191 S. Mandal A. A. Naqvi and R. S. Thakur Indian J. Pharm. Sci. (India) 1990 52 242. 192 S. Auriola A. Martinsen and K. M. Oksman-Caldentey J. Chromatorgr. 1991 562 737. 193 Y. Pramar and V. Das Gupta Drug. Dev. Ind. Pharm. 1991 17 2401 (Chem. Abstr. 1992 115 263575s). 194 T. Okuda M. Nishida I. Sameshima K. Kyoyama K. Hiramatsu Y. Takehara and K. Kohriyama J. Chromatogr. Biomed. Appl. 1991 567 141. 195 E. J. Cone D. Yousefnejad W. D. Darwin and T. Maguire J. Anal. Toxicol.1991 15 250. 196 M. R.Harkey G. L. Henderson and Z. Chihong J. Anal. Toxicol. 1991 15 260. 197 G. W. Hirne W. L. Hearn S. Rose and J. Cofino J. Anal. Toxicol. 1991 15 241. 198 S. P. Browne C. M. Moore J. Scheurer I. R. Tebbett and B. K. Logan J. Forensic Sci. 1991 36 1662. 199 D. T. Manjoff I. Hood, F. Caputo J. Perry S. Rosen and H. G. Mirandani J. Forensic Sci. 1991 36 1732.

ISSN:0265-0568    

DOI:10.1039/NP9931000199

出版商:RSC    

年代:1993

数据来源: RSC