摘要:

Russian Chemical Reviews 68 (3) 165 ± 170 (1999) #1999 Russian Academy of Sciences and Turpion Ltd UDC 620.185+578.086 Magnetic force microscopy I V Yaminsky,AMTishin Contents I. Introduction 165 II. The principle of operation of magnetic force microscope 166 III. Areas of application of magnetic force microscopy 167 IV. Magnetic-resonance force microscopy 169 V. Conclusion 170 current between the metal tip and the surface of a conductor in the case of the tunnelling microscope and the force of the interaction between the sharpened tip made of a hard material and the surface of the sample for an atomic force microscope. The atomic force microscope is in essence a sensitive profilometer, i.e., an instru- ment for measuring the roughness and topography of the surface, and in a sense it can be considered as a `distant relative' of a phonograph with a diamond tip.Abstract. Principles of the operation of the magnetic force micro scope are considered. The main areas of application of magnetic force microscopy are characterised. The prospects are shown of using this method for solving problems of materials science, including the most topical problem, viz., the creation of magnetic recording media with ultrahigh recording density. Unique poten- tials for investigation of nanostructures using a combination of magnetic force microscopy with electron spin resonance and nuclear magnetic resonance are pointed out. Primary attention is focused on the description of experimental techniques.The bibliography includes 27 references. I. Introduction Tunnelling and atomic force microscopes have a spatial resolution better than 1 A, i.e., these make it possible to observe individual atoms and molecules on the surface of various materi- als. The images of different surfaces obtained using scanning tunnelling and atomic force microscopes 4 are shown inFigs 1 and 2 as examples. Figure 1. The surface of pyrolytic graphite. The size of the area scanned is 262 nm2; a `Scan-8' scanning tunnelling microscope developed by the `Advanced Technologies Centre' (Moscow, Russian Federation) was used. The interest in magnetic force microscopy is due to its unique potential, which makes it possible to solve the problems of both basic and applied investigation, e.g., the development of modern nanotechnologies.In chemistry, magnetic force microscopy is indispensable in the studies of the morphology, structure and properties of nanocomposites with magnetic inclusions. Magnetic force microscopy is of particular significance in the studies of magnetic properties of nanostructures, in particular, in the search for size and quantum effects. Magnetic force microscopy com- bines a modern technique of magnetic measurements with the unique potentials of probe microscopy. The first probe microscopes, viz., scanning tunnelling microscope, made it possible to investigate conducting surfaces and to perform their targeted modification on an atomic and molecular level.1 This type of microscope has become an ancestor of a family of probe microscopes, among which the atomic force microscope 2 and its modifications 3 are most often used.In a scanning probe microscope there is a microprobe (a tip) with the help of which the precision mechanical system scans the surface. Simultaneously, the control unit of the microscope detects specified characteristics of the interaction between the probe and the surface under study. This can be the tunnelling IVYaminsky Department of Chemistry,MVLomonosov MoscowState University, Leninskie Gory, 119899 Moscow, Russian Federation. Fax (7-095) 939 01 74. Tel. (7-095) 939 10 09 AMTishin Department of Physics,MV Lomonosov Moscow State University, Leninskie Gory, 119899 Moscow, Russian Federation.Fax (7-095) 939 88 20. Tel. (7-095) 939 31 19 0.5 nm Figure 2. The surface of mica. An NanoScope atomic force microscope (Digital Instruments, USA) was used. Received 5 September 1998 Uspekhi Khimii 68 (3) 187 ± 193 (1999); translated byAMRaevsky166 Martin and Wickramasinghe 5 have improved the atomic force microscope in order to investigate magnetic properties of the surface with submicron spatial resolution. It was proposed to use a microneedle made of ferromagnetic material as a probing tip for measuring the magnetic force experienced by this micro- magnet in the vicinity of the surface of a magnetic specimen. This modification of the atomic force microscope is called the magnetic force microscope. Further stages in the development of magnetic force microscopy have been repeatedly documented (see, e.g., GruE tter et al.6).Let us consider specific features of the operation of the atomic force and magnetic force microscopes in detail. The highest (atomic or molecular) spatial resolution is achieved if the atomic force microscope operates in the contact mode where the tip contacts the surface of the specimen under study. The resolution achieved in different `tapping' modes is, as a rule, somewhat worse than in the preceding case. However, stable atomic resolution can also be achieved in the `tapping' mode, viz., in ultrahigh vacuum.7 In the `tapping' mode, a springy microconsole (a cantilever) on which the tip is mounted oscillates at a resonant frequency in the vicinity of the surface of the specimen.Acantilever is a mechanical resonator similar to a miniature tuning-fork. As the cantilever approaches the surface, the force action of the surface can cause additional damping of the oscillations of the cantilever.Under conventional laboratory conditions, the viscosity of air and the presence of adsorbed water film on the surface negatively affect the accuracy of measurements. Measurements in vacuo are free of these perturbing factors, which makes it possible to maintain the force of the interaction between the probe and the sample at a minimum level and thus to improve the spatial resolution up to the atomic level.8 In the contact-free mode, the forces acting on the tip of the atomic force microscope are due to the van der Waals interaction. In the magnetic force microscope, the tip experiences an additional action of magnetic forces.As the tip is raised above the surface to a height of 10 to 50 nm, the universal van der Waals attraction almost completely vanishes and the tip is mainly affected by magnetic forces. In this case, it is the magnetic interaction that causes the deviation of the tip from rectilinear motion (Fig. 3). Because of its small size, the tip of the magnetic force microscope can be approximated by a magnetic dipole. The force F acting on the tip is determined by the following relation- ship (1) F=m0gradH , where m0 is the magnetic moment of the tip and H is the magnetic field strength. A magnetic microinclusion in the specimen will produce a magnetic field, the strength of which at a distance R is (2) H(R)=3rOrmU ¢§ m , R3 F Figure 3.A diagram illustrating the action of a magnetic force on the microtip of the magnetic force microscope. The orientation of magnetic domains on the surface of the sample is shown by arrows in the bottom part. I V Yaminsky, A MTishin where r is the unit radius-vector along the specified direction and m is the magnetic moment of the microinclusion. Taking into account Eqns (1) and (2), the force of the 0 . (3) F=grad 3OrmU2 ¢§ mm R3 interaction between the microscope tip and the magnetic micro- inclusion is Relation (3) can be used for approximate calculations. Let us assume that both dipole moments have the same vertical orienta- tion along the direction of the z axis.Then the force of the interaction between them is Fz=¢§6m0m , z4 and the force field gradient is dF dzz a 24mz50m . For instance, for two iron microparticles with diameters 10 nm (m0=m^9610729 A m2) located at a distance of 10 nm, the magnetic force of the interaction is *4.9610711 N and the force gradient is *1.961072 N m71. It is this order of magnitude of the values that are detected by the magnetic force microscope. Comparative analysis of different methods used to study magnetic properties of the surface shows that magnetic force microscopy is highly sensitive to the magnetic flux (at a level of 1074 T) and makes it possible to achieve a unique spatial resolution as compared to that obtained by other methods of magnetic measurements.9 The sensitivity of the magnetic force microscope to the magnetic flux is only slightly lower than that of the SQUID-based scanning microscope.10 II.The principle of operation of magnetic force microscope A block diagram of the mechanical part of a magnetic force microscope is shown in Fig. 4 a. The specimen is mounted on a piezoscanner, which provides spatial movement of the specimen along the three coordinate axes. Usually, the piezoscanner is a thin-walled tube made of piezoceramics coated with a system of metal electrodes. The electric voltage applied to the electrodes changes the geometric size of the tube because of the inverse piezoelectric effect.The piezoscanner is characterised by a high c b a 1 3 3 2 2 1 4 Specimen 5 Magnetic domain x z y 6 Figure 4. A block diagram of the mechanical system of a magnetic force microscope (a), the cantilever tip coated with a ferromagnetic material (b) and the trajectory of the motion of the microtip (c); (a): (1) small displacement; (2) photodetector; (3) laser; (4) cantilever; (5) specimen; and (6) piezoscanner; (c): (1) trajectory in the course of record- ing the surface profile; (2) trajectory in the course of recording the magnetic profile; and (3) deviations from the selected trajectory caused by the interaction between the microtip and a magnetic domain in the specimen.Magnetic force microscopy mechanical rigidity and, hence, it is insensitive to seismic and acoustic interferences, simple to control and has a long lifetime.It is these advantages that have determined wide use of this design of the piezoscanner in actual microscopes. Errors of movements, which are due to, e.g., nonlinearity of the properties of the material of the piezoscanners are the drawbacks of this type of piezoscanner. However, the errors of the movement of the object under study can be reduced by software control, viz., by applying a controlling voltage to the electrodes of the piezoscanner in accordance with special correcting algorithms. In metrological systems, additional capacitive or optical transducers are used; they provide the linear movement of the specimen in the range from 1 to 250 mm in the plane of the specimen (along the x and y coordinates) and from 1 to 15 mmnormal to this plane (along the z coordinate) for different piezoscanners.In a magnetic force microscope, the cantilever is above the specimen. The magnetic force F acting on the tip causes a bending of the cantilever and a vertical movement of the tip (Fig. 4 b). According to Hooke's law, this movement is determined by the mechanical rigidity of the cantilever (by the spring constant) lying typically in the range from 0.1 to 10 N m71. Bending of the cantilever is detected using a small displace- ment transducer. Among different transducers (capacitive, induc- tive, tunnelling, etc.), optical sensors have found the widest practical use.They detect angular deflection of the light beam reflected from the surface of the cantilever.Alaser beam is focused on the reflecting surface of the free (unfastened) end of the cantilever and the changed position of the reflected beam, indicating a bending of the cantilever, is determined by a split photodiode. When scanning the specimens under actual experimental conditions (the relative displacement of the probe and the surface under study), the probe successively scans each surface area and the electronics detects the total force of the interaction in the probe ± sample system. The results of measurements, displayed after processing of the data, are three-dimensional (3D) images of the surface. If the bending of the cantilever is maintained constant during the scanning process, the images obtained correspond to the surfaces of constant force.This mode is called a`constant force' mode. In the `deflection mode' the cantilever moves in the horizontal plane above the specimen and the bending of the cantilever is detected, which is proportional to the force acting on the tip. When scanning a rough surface, the contribution from the topography should be separated from that of the magnetic forces. To this end, the tip scans the same surface area twice. For the first pass, it moves contacting the surface of the specimen and the trajectory of the movement of the tip, which corresponds to the profile of the surface under study, is stored in a computer. The magnetic properties of the specimen (neglecting the surface deformations, which are small, as a rule) have no effect on the observed trajectory.For the second pass, the microconsole moves along the known trajectory above the same surface area without contacting the specimen. In this case, the tip is affected by long- range forces rather than by contact forces, as in the first case. The deviation of the tip from the specified trajectory depends on the magnetic properties of the specimen (Fig. 4 c). In actual experi- ments, to achieve the maximum sensitivity, oscillations are induced of the cantilever at a natural resonant frequency and the tip also scans the specimen twice, viz., first in the `tapping' mode and then in the free oscillations mode at some distance from the surface. Recording the amplitude, phase or frequency of the oscillations provides more precise information on the magnetic inclusions (domains, clusters) in the specimen under study.III. Areas of application of magnetic force microscopy Magnetic force microscopy is used in the creation of materials for magnetic recording media [magnetic tapes, hard (`Winchester') 167 disks, magneto-optical disks,11, 12 etc.13], in the optimisation of the recording modes of magnetic heads,14 in the studies of the structure and properties of nanoparticles, alloys,15 nanocompo- sites and thin films,16 in the development of the methods for magnetic recording with ultrahigh density,17 in the studies of superconductors as well as in biological and geophysical studies. This makes it possible to observe single magnetic domains whose sizes vary from several nanometres to several tens of nanometres.For instance, the formation of Ni particles on a quartz glass (silicon dioxide) resulting from autocoalescence of an `island' Ni film upon annealing (at 800 8C) in an atmosphere of hydrogen was studied.18 Using magnetic force microscopy, it was shown that particles with sizes from 40 to 100 nm are single domain particles (Fig. 5), which agrees well with theoretical estimates. b a 200 nm Figure 5. A microtopographical (a) and the corresponding magnetic (b) image of Ni particles. Magnetic force microscopy has found an important applica- tion in the development of novel methods for magnetic recording with ultrahigh density: the leading manufacturers of magnetic recording media make wide use of commercial magnetic force microscopes in the steps of design and quality control of finished products.In Fig. 6, a topographical profile of a fragment of a surface of a magneto-optical disk (the dark lines seen are rectilinear micro- recesses, Fig. 6 a) and a magnetic image of the microstructure of magnetised domains on the surface are shown. Elongated islands of dimensions 261 mm2 corresponding to recording of one data bit (Fig. 6 b) are fairly clearly seen. The domain structure of the magnetic film in the area of recesses (light longitudinal strips) is also visible. Magnetic force microscopy makes it possible to distinguish single grains of size 50 nm.The magnetic structure of the surface is intensively studied in research laboratories of the leading manufacturers of recording media in order to minimise the surface area corresponding to one data bit and to solve the problems of noise immunity, noise reduction during the recording and reproduction of the data. The results of these investigations are used in the development of novel principles and devices for magnetic and magneto-optical recording. We note that it is the use a b Figure 6. The surface of a disk of size 565 mm2 consisting of microtracks separated by longitudinal recesses (a) and the magnetic structure of the same surface (b).168 of modern methods of investigation such as magnetic force microscopy that made it possible to provide a virtually exponen- tial increase in the magnetic recording density on magnetic and magneto-optical disks in recent years.Currently, the storage capacity of hard disks can be as high as 20 Gbytes and even more. In Fig. 7, a magnetic `image' is shown of lithographically patterned Co metal particles.19 The procedure of patterning of metal `islands' is used in the technology of production of magnetic media with digital type of data recording. Using a magnetic force microscope, it is possible to `see' the domain structure of individ- ual clusters (Fig. 7 a). Smaller magnetic clusters (Fig. 7 b) look like single magnetic dipoles. a b Figure 7. Image of metallic Co `islets' obtained using a magnetic force microscope.The `islet' area: (a) 2006400 nm2; (b) 1.761.7 mm2. The magnetic force microscope can be used not only for the observation (mapping) of the magnetic field, but also for magnetic recording with ultrahigh density. In Fig. 8, the projections corre- spond to the magnetic domains formed on the surface of a TbFeCo film using the microscope tip. These domains are formed at an instant when a certain threshold value of the strength of the magnetic field produced by an external magnet and the tip is achieved. The threshold magnetic field strength is determined by the coercivity of the magnetic film. The magnetised domains decrease in size and gradually disappear as the net magnetic field decreases successively. In this case the recording density is 10 Gbit cm72, which is substantially higher than that achieved for hard (`Winchester') disks and magneto-optical disks used in modern computers.In Figs 9 a and 9 b, a magnetic image of a hard disk and the result of averaging of the magnetic image in the central surface area of the disk (between the dashed lines in Fig. 9 a) over a large number of cross-sections are shown, respectively. Figure 9 c represents a signal in the reading magnetic head that had scanned the same surface area of the disk. The curves shown in Figs 9 b and Figure 8. Single magnetic domains (a bit array) formed on the surface of TbFeCo carrier with the aid of the tip of a magnetic force microscope in the presence of external magnetic field.The same tip was used to obtain the magnetic image. The surface area scanned is 12612 mm2. abc Figure 9. Image of a track of a magnetic disk obtained using a magnetic force microscope (a), averaged cross-section of the magnetic profile in the area between the dashed lines (b) and the signal in the reading magnetic head detected in the same area of the track (c). 9 c are identical even in minor details, which indicates that the signals detected by the magnetic force microscope and conven- tional magnetic head coincide. The magnetic force microscope provides a much higher spatial resolution, which makes it possible to use this instrument in the detailed analysis and optimisation of read ± write modes of standard magnetic heads. The use of magnetic force microscopy in the studies of magnetic properties of biological objects is also promising.Micro- magnets play a significant role not only in artificial systems, but also in nature. For instance, bacteria Aquaspirillum magneto- tacticum can move along the magnetic field lines. These bacteria contain specific organelles, viz, magnetosomes. The magneto- somes are chains of 10 to 25 permanent magnets, viz., iron oxide crystals of size *50 nm. Single crystals are clearly seen in nonstained cells using transmission electron microscopy. Magnets inside the cells determine the specified direction of motion of the bacteria in sea-water: to the north in the Northern hemisphere and to the south in the South hemisphere. It has been possible to measure the magnetic moment of a single bacterium Aquaspirillum magnetotacticum using a magnetic force microscope.20 The length of the bacterium was 2 mm and the measured magnetic moment was negligibly small, viz., 10716 A m2.Currently, `Digital Instruments' and `Park Scientific Instru- ments' companies (both from USA) produce magnetic force microscopes for use both in industry and scientific research. In the `Centre of advanced technologies' (Moscow, Russian Feder- ation), a promising model of scanning probe microscope, `Femto- Scan' has been developed, which permits measurements of magnetic properties of the surface. Cantilevers for both magnetic force microscopy and atomic force microscopy are fabricated by microlithography using a silicon technology, which means that one or several cantilevers at a time are formed at the edges of a silicon plate.Then the surface of the tip is coated with a thin layer of a ferromagnetic material. A scheme of the components for the probe of a magnetic force microscope made by Park Scientific Instruments (USA) is shown in Fig. 10. A problem of calibrating the magnetic force microscope appears in relation to metrological measurements of magnetic forces. This problem has successfully been solved by Kong and I V Yaminsky, A MTishinMagnetic force microscopy b c a 18 8 358 100 mm 1.6 mm d Figure 10. Scheme of manufacture of a cantilever with a tip (a ± c) and the image of the tip mounted on a microconsole obtained using an electron microscope (d ); (a) silicon plate holder with two cantilevers (b); (c) tip.Chou,21,22 who have used metal microrings. The calibrating rings with diameters of 1 and 5 mm (Fig. 11) were made using electron- beam lithography (metal strips on a silicon surface). The magnetic tip moved at variable distances above the rings and its magnetic moment was evaluated from the electric current induced in the rings. The axial magnetisation of the silicon tip coated with a 65-nm thick cobalt film measured using this procedure was 3.8610722 A m2. Considerable attention is given to the proce- dure for fabrication of the tips, since it is the tips that largely determine the quality of the magnetic image of the surface.23 Figure 11. Microrings used for calibration of a magnetic force micro- scope.In the year 1991, it was suggested that a magnetic force micro- scope can be used to obtain three-dimensional images of individ- ual biomolecules.24 To this end, it was proposed to combine the existing methods of nuclear magnetic resonance and magnetic force microscopy. The novel method has been called magnetic- resonance force microscopy.25, 26 Its major advantages are safety for the object under study (i.e., it is a nondestructive method), a subnanometre spatial resolution and the possibility of studying individual biomolecules. At present, magnetic-resonance force microscopic experi- ments are carried out as follows. A specimen under study of negligible mass (*10711 kg) is mounted on a springy cantilever analogous to that used in atomic force microscopy (Fig.12). A constant magnetic field in the specimen is produced by a magnet placed near the cantilever. The magnetic force from the side on which the tip is mounted, acting on the surface atoms of the specimen, is proportional to the spin of the unpaired electrons or to the magnetic moment of the nuclei. In an alternating magnetic 3.6 mm 0.2 mm b a 1 mm 1 mm IV. Magnetic-resonance force microscopy 3 mm 169 1 ~ 4 S N 23 5 6 Figure 12. A block diagram of a magnetic-resonance force microscope; (1) magnetic coil; (2) fiber optic interferometer sensor; (3) detection electronics; (4 ) magnet; (5) specimen; (6) cantilever. field, a quantum transition occurs between the energy sublevels of the electron or nucleus under the conditions of resonance, which causes a change in the orientation of the magnetic moment of the system.By periodically changing the frequency of the alternating magnetic field produced by an additional coil, one can modulate the magnetisation of the sample. The modulation frequency is chosen to be equal to the resonant frequency of the cantilever. The amplitude of the forced oscillations of the cantilever is measured with a small displacement transducer (e.g., a fiber interferometer). For a chosen geometry of experiment, the conditions of nuclear and electron spin resonances in the system are held in the region of a specimen of subnanometre size. The method of magnetic-resonance force microscopy has nontrivial possibilities for the structure determination of proteins and viruses.The results of the first successful experiments on the observation of electron paramagnetic resonance are docu- mented.27 Spin resonance in a sample of diphenylpicrylhydrazyl of mass 30 ng was detected. The force acting on the cantilever was 10714 N. According to an assessment made, the observation of resonance from a single molecule requires the enhancement of sensitivity to force at least by 4 orders of magnitude. Recently, the construction of a microcantilever of length 230 mm and thickness of only 60 nm with a micromagnet mounted atop was reported.{ The magnetic field of the micromagnet interacts with the magnetic moments of the atoms of a specimen.The magnetisation of the specimen is varied periodically (as in the preceding case) to achieve the conditions of electron (paramagnetic) or nuclear magnetic resonance. The force measured was 6610718 N. A description of early successful experiments on the observa- tion of electron spin resonance using the magnetic force micro- scope is given in Ref. 27. The strength of the constant magnetic field is modulated, which changes the magnetisation of the speci- men under conditions of spin resonance (Fig. 13). During the modulation period, the system will be at resonance twice and, in the case of sufficient strength of the alternating magnetic field, the absorption of energy reaches its maximum. This leads to the levelling of the populations of magnetic energy sublevels corre- sponding to the quantum numbers lying in the range from7m to +m and to the decrease in the magnetisation down to zero.To eliminate interference, the signal is detected at a frequency of the second-harmonic component of the modulation signal. The calculated and experimental spectra (Fig. 14) virtually coincide. In early experiments on the observation of 3D images, a 2-mm particle of diphenylpicrylhydrazyl was mounted on a cantilever in a constant nonuniform magnetic field produced by a conical tip made of NdFeB. The magnetic field gradients were 4.3 and 0.94 G mm71 normal to the specimen and in the longitudinal direction, respectively. The transverse and longitudinal spatial resolutions were 1.2 and 5.3 mm, respectively.A 3D image of the sample with a resolution of *3 mm was obtained in the observa- { The report was posted in January, 1997 at the URL http://www.aip.org/ physnews170 Magnetic field modulation710 75 Figure 13. Dependences of the magnetisation of a specimen (a) and the amplitude of the magnetisation signal measured at the frequency of the second-harmonic component (b) as functions of the constant magnetic field strength. In the presence (1) and in the absence (2) of high-frequency field. Vibration amplitude /A710 720 Figure 14. Experimental (1) and calculated (2) electron spin resonance spectra obtained using a magnetic-resonance force microscope. tion of NMR in ammonium nitrate at a field gradient of 22 G mm71.Production of a constant magnetic field with the highest uniformity in the bulk of the entire specimen is the principal condition that should be met in the classical ESR and NMR methods. On the contrary, in the case of magnetic-resonance force microscopy the higher the nonuniformity of the constant magnetic field, the smaller the spatial region in which the resonance condition hold and, hence, the higher the spatial resolution obtained when constructing 3D images. V. Conclusion The material presented in this review shows that the investigations in the field of magnetic force microscopy are being intensively developed in the last decade. This method is used in both fundamental science and industry. Of particular interest and fruitfulness are the results of application of the magnetic force microscopy in the creation of magnetic media that make it possible to perform magnetic recording with ultrahigh density.The latest studies have shown that combination of magnetic force microscopy and traditional methods of electron paramag- netic resonance and nuclear magnetic resonance opens unique potentials for the investigation of nanostructures including bio- molecules. a MZ /rel. units 12 1.5 0.5 70.5 71.5 b M2 /rel. units 0.5 0 5 10 Bz /mT 70.5 M2 /rel. units 1 2.8A 32 2 1 10 0 Bz /mT I V Yaminsky, A MTishin This review has been written with the financial support by the Russian Foundation for Basic Research (Project No.97-03- 32778a) and the `Universities of Russia' (Project No. 5060). References 1. G Binnig, H Rohrer, Ch Gerber, E Weibel Phys. Rev. Lett. 49 57 (1982) 2. G Binnig, C F Quate, Ch Gerber Phys. Rev. Lett. 56 930 (1986) 3. A I Danilov Usp. Khim. 64 818 (1995) [Russ. Chem. Rev. 64 767 (1995)] 4. I V Yaminsky (Ed.) Skaniruyushchaya Zondovaya Mikroskopiya Biopolimerov (Scanning Probe Microscopy of Biopolymers) (Moscow: Nauchnyi Mir, 1997) No. 1 5. Y Martin, H K Wickramasinghe Appl. Phys. Lett. 50 1455 (1987) 6. P GruÈ tter, H J Mamin, D Rugar, in Springer Series in Surface Sciences. Scanning Tunneling Microscopy II Vol. 28 (Berlin, Heidelberg: Springer, 1992) p. 151 7. M Bammerlin, R LuÈ thi, E Meyer, A Baratoff, J LuÈ , M Guggisberg, Ch Gerber, L Howald, H-J Gmntherodt Probe Microscopy 1 3 (1997) 8. F J Giessibl Science 267 68 (1995) 9. L N Vu, D J van Harlingen IEEE Trans. Appl. Supercond. 3 1918 (1997) 10. O V Snigirev,K E Andreev,A M Tishin, S A Gudoshnikov, J Bohr Phys. Rev. B., Condens. Matter. 55 14429 (1997) 11. M W J Prins, R H M Groeneveld, D L Abraham, R Schad, H van Kempen, H W van Kesteren J. Vac. Sci. Technol., B 14 1206 (1996) 12. S Manalis, K Babcock, J Massie, V Elings,M Dugas Appl. Phys. Lett. 66 2585 (1995) 13. G N Philips, T Suzuki J. Magn. Magn. Mater. 175 115 (1997) 14. R Proksch, J Schmidt, S Austvold, G Skidmore J. Appl. Phys. 81 4522 (1997) 15. M R J Gibbs, M A Al-Khafaji,W M Rainforth, H A Davies, K Babcock, J N Chapman, L J Heyderman IEEE Trans. Magn. 31 3349 (1995) 16. M Hehn, K Cherifi-Khodjaoui, K Ounadjela, J P Bucher, J Arabski J. Magn. Magn. Mater. 165 520 (1997) 17. T Homma, Y Kurokawa, T Nakamura, T Osaka, I Otsuka J. Vac. Sci. Technol., B 14 1184 (1996) 18. A A Bukharaev, D V Ovchinnikov, N I Nurgazizov, E F Kukovitskii, M Klyaiber, R Veizendanger Fiz. Tv. Tela 40 1277 (1998) 19. R M H New, R F W Pease, R L White J. Vac. Sci. Technol., B 13 1089 (1995) 20. R B Proksch, T E SchaÈ ffer, B M Moskowitz, E D Dahlberg, D A Bazylinski, R B Frankel Appl. Phys. Lett. 66 2582 (1995) 21. L Kong, S Y Chou Appl. Phys. Lett. 70 2043 (1997) 22. L Kong, S Y Chou J. Appl. Phys. 81 5026 (1997) 23. G D Skidmore, E D Dahberg Appl. Phys. Lett. 71 3293 (1997) 24. J A Sidles Appl. Phys. Lett. 58 2854 (1991) 25. J A Sidles, J L Garbini, K J Bruland, D Rugar, O ZuÈ ger, S Hoen, C S Yannoni Rev. Mod. Phys. 67 249 (1995) 26. C S Yannoni, O Zmger, K Wago, S Hoen, H-M Vieth, D Rugar Brazil. J. Phys. 25 417 (1995) 27. D Rugar, C S Yannoni, J A Sidles Nature (London) 360 563 (1992)

ISSN:0036-021X    

出版商:RSC    

年代:1999

数据来源: RSC

摘要:

Russian Chemical Reviews 68 (3) 171 ± 181 (1999) Time-resolved IR chemiluminescence in gas-phase chemical kinetics E N Chesnokov, V N Panfilov Contents I. Introduction II. Processes resulting in IR chemiluminescence of vibrationally excited products of chemical reactions III. The sensitivity limit of the IR chemiluminescence method IV. Measurement of rate constants for non-chain reactions V. Modification of the time-resolved IR chemiluminescence method VI. Study of the kinetics of chain reactions by the IR chemiluminescence method VII. The time-resolved Fourier-transform spectroscopy of IR chemiluminescence VIII. Conclusion Abstract. The time-resolved IR chemiluminescence method based on the study of the chemiluminescence of vibrationally excited molecules formed in chemical reactions is discussed.The approaches used in the study of elementary reactions and complex processes are systematised. The technique is compared with other methods for the study of gas-phase chemical kinetics. The bibliography includes 76 references. I. Introduction In modern gas-phase chemical kinetics, methods that enable the real-time detection of chemically active species in an excited state are used in studies of elementary reactions. These methods include laser-induced fluorescence, intra-cavity laser spectroscopy, laser magnetic resonance, resonance-amplified multiphoton ionisation and the IR chemiluminescence method (IR-CL) based on the study of the luminescence of vibrationally excited molecules formed in reactions.The energy evolved in an elementary exothermic chemical process manifests itself most commonly as vibrational excitation of the reaction products.1 The practical application of this kind of reaction for the pumping of chemical lasers is well known.2, 3 The works devoted to the IR-CL study of the vibrationally excited products of chemical reactions may be divided in two groups. The first one includes those where a steady-state IR-CL spectrum with rather a high spectral resolution is the quantity determined experimentally. This spectrum contains information on the distribution of the reaction products over the vibrational and rotational states. Many reactions resulting in the formation of vibrationally excited molecules, such as HF,4±9 HCl,10 HBr,11 CO,12 OH.13 and H2O,14 have been studied by this method. The study of the reactions is complicated by the disturbing effect of fast vibration and rotation relaxation processes. To reduce the E N Chesnokov, V N Panfilov Institute of Chemical Kinetics and Combustion, Siberian Branch of the Russian Academy of Sciences, ul. Institutskaya 3, 630090 Novosibirsk, Russian Federation. Fax (7-383) 234 23 50. E-mail chesnok@ns.kinetiks.nsc.ru (E N Chesnokov). Tel. (7-383) 233 23 81. E-mail panfilov@ns.kinetiks.nsc.ru (V N Panfilov). Received 16 June 1998 Uspekhi Khimii 68 (3) 194 ± 204 (1999); translated by S S Veselyi #1999 Russian Academy of Sciences and Turpion Ltd UDC 541.141 171 171 173 174 175 175 179 180 effect of relaxation processes, the experiments are carried out at low pressure using fast gas flow.In another group of works, the kinetic approach is used. In these experiments, the dependence of the IR-CL intensity on the time elapsed after the pulse initiation of the chemical reaction is determined. The radiation is recorded in rather a wide spectral band. Based on this dependence, it is possible to determine the rate constants for reactions resulting in excited molecules and those of other reactions accompanying this process, as well as to find the rates of vibrational relaxation. From the methodical viewpoint, these works may be considered as a contribution to the develop- ment of the method of studying the vibrational relaxation of molecules based on their IR luminescence, which has been extremely fruitful in studies of the relaxation of polyatomic molecules.15 This review analyses the publications where the kinetic approach has been used.The main attention is given to methodical problems related to the use of kinetic IR-CL for the study of non- chain and chain reactions. A method for the measurement of the rate constants for reactions involving atoms and free radicals is discussed, in which a chain reaction resulting in the formation of vibrationally excited products manifests itself as an original `probe' which makes it possible to trace the changes in the concentration of reactive species with time. II. Processes resulting in IR chemiluminescence of vibrationally excited products of chemical reactions Extensive studies on the processes of the formation of vibration- ally excited molecules in exothermic reactions were linked with the research aiming at the development of chemical lasers and the optimisation of their operation.To date, the formation of diatomic vibrationally excited molecules in atom abstraction reactions have been studied rather thoroughly. Table 1 presents some typical exothermic reactions producing vibrationally excited molecules. Based on the analysis of the published data, one can state with a high degree of certainty that, if the energy liberated in the abstraction of an atom exceeds the energy of the quantum of the vibration energy of the molecule formed, this reaction should result in vibrationally excited molecules.The fraction of the vibrational energy is ten percent of the exotermicity of a reaction.172 Table 1. Mean vibration energy (hEvibi) of excited products and thermal effect (7DH0) of certain exothermic reactions. Reaction 7DH0 hEvibi Ref. Excited species kcal mol71 F.+H2?HF*+H. F.+CH4?HF*+CH3. HF(u=1, 2, 3) HF(u=1, 2, 3) F.+C6H12?HF*+C6H11 . HF(u=1, 2, 3) 32 33 41 HCl(u=1, ..., 6) 45 H.+Cl2?HCl*+Cl. Cl.+H2S?HCl*+HS. HCl(u=1) 12 Cl.+GeH4?HCl*+GeH3. HCl(u=1, 2, 3) 24 CO(u=5, ..., 18) 85 HCl(u=1) 12 OH.(u=1, 2, 3) 31 O..+CS?CO*+S.. Cl.+SiH4?HCl*+SiH3. O..+HI?OH.*+I. O..+GeH4?OH.*+GeH3.OH.(u=1, 2) 16 17 18 19 20 21 22 23 24 13 14 25 21.0 19.0 22.0 17.6 5.2 5.6 66.0 3.4 9.7 12.5 17.0 33.0 33 48 170 H2O CO OH.+HI?H2O*+I. O..(1D)+H2CO? 2 ?CO2 +H2 The study of the formation of polyatomic vibrationally excited molecules in chemical reactions is only beginning. How- ever, the data available in the literature are consistent with the qualitative concept that in this case, too, a considerable fraction of energy produced in the reaction is transformed into the vibra- tional energy of the product containing the newly formed chemical bond. The vibrationally excited molecules resulting from an exo- thermic reaction can lose energy either through spontaneous emission of IR radiation quanta or by relaxation of the vibrational energy in collisions.These processes are schematically shown in Fig. 1. a b3 1?0 2?1 3?2 V7T hn 2 hn V7T c 1 hn V7T 0 2800 2600 3000 n /cm71 Figure 1. Scheme of the processes forming an IR chemiluminescence spectrum; (a) vibrational bands of the corresponding transitions with unresolved rotational structure; (b) scheme of radiation transitive and vibration ± - translation (V ± T) relaxation processes; (c) IR luminescence spectrum of an HCl molecule with well resolved rotational structure. The characteristic probabilities of spontaneous radiative tran- sitions in unit time (W) for the vibrationally excited molecules are listed in Table 2. The transitions that change the vibration quantum number u by one unit have the highest probability.It is in rare cases thatWexceeds 100 s71 for the vibrations resolved in an IR spectrum. As a rule, the probability of transitions that change u by two units (overtone luminescence) is one or two orders lower. Accord- ingly, the intensity of the overtone luminescence turns out to be lower. On the other hand, it has to be noted that overtone transitions play a more significant role in the IR luminescence E N Chesnokov, V N Panfilov Table 2. Energy and probability of spontaneous radiative transitions for vibrationally excited molecules. Ref. W/s71 Transition Molecule E /cm71 26 HF 189.0 320.0 3961 3788 (u=1)?(u=0) (u=2)?(u=1) 26 HCl 35.0 59.0 3.5 0.037 2886 2782 5668 8347 (u=1)?(u=0) (u=2)?(u=1) (u=2)?(u=0) (u=3)?(u=0) 27 OH 20.0 25.0 14.0 0.9 3568 3398 6966 10 194 (u=1)?(u=0) (u=2)?(u=1) (u=2)?(u=0) (u=3)?(u=0) 28 CO 30.0 59 2170 2144 (u=1)?(u=0) (u=2)?(u=1) 29 400.0 2349 CO2 (0001)?(0000)a 30 180.0 2189 SiH4 (n3=1)?(n3=0)a Note.The table presents data for molecules with vibration frequencies >2000 cm71 (the molecules with lower vibration frequencies are not interesting due to the low probability of spontaneous transitions). a The linear three-atomic CO2 molecule has four vibrational degrees of freedom and three different frequencies. The five-atomic SiH4 molecule has even more frequencies. In both cases, the parameters of only one possible vibrational transition are presented.spectra than in IR absorption spectroscopy. A reason for this is that the overtone luminescence occurs in the region of shorter wavelengths (with respect to the fundamental luminescence), and hence more sensitive detectors can be used to record it. Let us consider the energy loss by vibrationally excited molecules in collisional relaxation. The rate constants for the vibration ± translation relaxation vary over a very broad range for various colliding partners. For example, the probability of vibra- tional relaxation of excited HCl molecules equals 1077 in colli- sions with He atoms, 1074 in collisions with HCl, 1073 in collisions with CH4, and 2 1073 in collisions with SiH2Cl2.In a gas mixture prepared for studying a chemiluminescent reaction, vibrational relaxation occurs upon collisions with the molecules of the starting substances. The probabilities of vibrational relaxation upon collisions with polyatomic molecules usually vary from 1072 to 1073, which corresponds to the time of vibrational relaxation 1074 ± 1073 s at a pressure of 1 Torr. The above estimates show that the radiative path plays an insignificant role in the energy loss by vibrationally excited molecules. The quantum yield of IR-CL at a pressure of several Torr usually does not exceed 1072 and decreases with an increase in the pressure. Such a dependence determines the upper limit of the pressure range used in experiments on IR-CL; this value is about 30 Torr.The necessity of using low pressures and the relative simplicity of the luminescing molecules, whose IR spectra display well resolved rotational structure, results in a specific IR-CL spectrum. At low pressures, the width of an individual rotation line is mainly determined by the Doppler effect and does not exceed 1072 cm71. The distance between the adjacent rotational lines is several units or even several tens of inverse centimetres. Therefore, the IR-CL spectrum is a set of very narrow lines far separated from each other. If a reaction produces excited molecules in different vibra- tional states, the bands in their spectra are shifted relative to each other owing to vibrational anharmonicity. The anharmonic shift is usually smaller than the width of a separate band, therefore overlapping of bands occurs.Figure 1 schematically shows the luminescent spectrum of HCl molecules excited in the states u=1,Time-resolved IR chemiluminescence in gas-phase chemical kinetics u=2, and u=3. There is no actual superposition of the lines in the spectrum, because the width of a separate line is much smaller than the distance between the neighbouring lines. However, high spectral resolution is required to detect the luminescence corre- sponding to a particular vibrational state in such a spectrum. The spectral resolution in kinetic experiments on the study of IR-CL is small, hence it is helpful to use the so-called `cold gas filter'. This is a cell filled with the gas whose luminescence is being studied.As the molecules in the gas filter are in the ground vibrational state, the gas filter enables blocking of the radiation of the 1?0 transition without affecting the radiation of the other transitions. III. The sensitivity limit of the IR chemiluminescence method A typical experimental set-up for the evaluation of the sensitivity of the IR-CL method includes a pulse laser (its radiation initiates the chemical reaction), a system for the preparation and injection of the gas mixture, and a system for the time-resolved recording of IR-CL.31 ¡¾ 39 The initiation of a reaction most commonly occurs due to the dissociation of molecules under the action of laser radiation in the UV range (excimer lasers, neodymium laser with frequency multiplication, the second harmonic of the ruby laser, the second harmonic of dye lasers).In addition, pulse CO2 lasers are used, whose IR irradiation causes the dissociation due to multi-photon absorption. The experiments are carried out at pressures from fractions of Torr to several tens of Torr. The repetition frequency of laser pulses is usually several Hertz, less commonly tens of Hertz. Figure 2 shows the scheme of a typical experimental set-up for recording the luminescence. Luminescence is recorded in a direc- tion perpendicular to the laser beam. Since the signal is usually insufficient for the use of a monochromator, interference filters combined with various absorption filters are used. Often a gas filter is used, which has the form of a gas cell several centimetres long containing an absorbing gas under a pressure of several tens of Torr.Semi-conductor photoresistors or photo diodes cooled to low temperatures are used as IR radiation detectors. Photo- detectors based on InSb are most commonly used for the mid IR region (3 ¡¾ 5 mm). These detectors have high sensitivity and are convenient because they do not require cooling below 77 K. The time constant of these detectors is somewhat smaller than 1 ms in the case of photodiodes and several microseconds in the case of photoresistors. A very important requirement for a detector is its large area. This is caused by the fact that an IR-CL source has b a S l D 2r 12 3 Figure 2. Scheme of set-up for the observation of the IR-CL kinetics (a); part of the set-up with indication of geometrical parameters required for sensitivity estimation (b); (1) interference filter; (2) gas filter; (3) pressure gauge.173 considerable geometrical dimensions, hence its radiation cannot be effectively focused on the small area of a detector. In the optimum variant, the size of the detector should match the size of the area in which the reaction occurs ( 1 cm). Smaller detectors are commonly used. One can estimate the minimum concentration of vibrationally excited molecules detectable by this method as follows. The noise of a theoretical IR radiation detector is determined by fluctuations of the thermal background radiation reaching this detector.A signal of the excited molecules can be detected if the number of IR luminescence photons (Ilum) that have reached the radiation detector during the resolution time of the detecting system (treg) exceeds the number of photons from the thermal radiation fluctuation (Itherm) (1) Ilumtreg> Ithermtreg . pAAAAAAAAAAAAAAAAAA For the flux of thermal radiation photons we have 2 (2) , D2l therm a l4aexpOhc=lkTU ¢§ 1a I 2pcSDl where c is the speed of light; S is the photodetector area; Dl is the wavelength range in which luminescence is recorded; l is the irradiation wavelength; D and l are geometrical parameters (see Fig. 2 b). The flux of luminescence photons can easily be found if the geometrical dimensions of the experimental set-up are known.Based on the formula (1), the following expression for the minimum detectable concentration of excited molecules was obtained: trad (3) , nmin a 2 pAAAAAAAA cDl l2 pAAAAA 2l 2p D rpAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA StregaexpOhc=lkTU ¢§ 1a where trad is the radiative life time of a vibrationally excited molecule. For an estimation of nmin, let us use the following parameters of a vibrationally excited HCl molecule: l=3.6 mm, trad= 31072 s.26 The typical geometrical parameters are as follows: S=1072 cm2, r=0.5 cm, 2l/D=5; the resolution time of the detecting system treg is assumed to equal 1076 s, and Dl^l. After substituting these parameters in the formula (3), we obtain nmin=1011 cm73.Analysis of formula (3) shows that the sensitivity can be increased by using radiation detectors with large area and focusing lenses with large aperture (D/l ratio). The sensitivity can also be increased by narrowing the wavelength range Dl of the radiation that reaches the detector to a value equal to the width of the luminescent spectrum with the use of spectral filters. However, the maximum difference in the estimate obtained above due to all of these factors is one order of magnitude. Therefore, the value of nmin=1011 cm73 should be considered as the sensitivity limit of the IR-CL method. It should be noted that this estimate was obtained under the assumption that the sensitivity is limited by the noise that originates from fluctuations of the thermal radiation reaching the detector.This is true in the standard experiment, in which the gas to be studied is placed in a cell whose walls and the surround- ing objects are at room temperature, and hence it is impossible to avoid the effect of thermal irradiation on the detector. The sensitivity is usually increased by accumulation of periodically repeated signals. A comparison of the IR-CL method with other kinetic methods32 leads to the following conclusions. The sensitivity of IR-CL is inferior to that of laser-induced fluorescence (LIF) and resonance-enhanced multiphoton ionisation (REMPI) and is comparable to the sensitivity of the time-resolved laser magnetic resonance (LMR) and intra-cavity laser spectroscopy (ICLS).The response time of the method is within 1077 to 1076 s. This time is174 smaller than the response time of time-resolved LMR and some- what larger than the response time of LIF, ICLS and REMPI. An important characteristic of the methods used in the study of gas- phase reactions is the product of the sensitivity and the response time. This value equals 1/(nmintreg)^1078 cm3 s71 for IR-CL, which is much more than the maximum rate constants for bimolecular reactions. Hence, the fastest gas phase reactions can be studied by this method. The main drawback of the IR luminescence method is its low spectral resolution. It does not exceed 20 ± 50 cm71 if interference filters are used. The use of a monochromator decreases the sensitivity.The low spectral resolution restricts the scope of the method considered. It can be used when one type of excited molecules is formed in the reaction or the spectra of different excited molecules are separated considerably. IV. Measurement of rate constants for non-chain reactions Cl.+HBr HCl*+Br. , Cl.+HI HCl*+I. . 2Cl., Cl2+hn k1 (4) HCl*+X. , Cl.+HX k2 (5) HCl+M, HCl*+M Thus, time-resolved IR-CL is an experimentally simple kinetic method with high sensitivity and fast response. The scope of this method is limited to systems which produce vibrationally excited molecules with simple spectra. The IR-CL method has been first used for the measurement of the rate constants for chemical reactions by Wodarczyk and Moore.33 The following processes were studied: The reactions were initiated by the action of a pulse of radiation of the second harmonic of the ruby laser on a mixture of Cl2 with a small amount of HBr or HI diluted with a noble gas.The action of a laser pulse on a Cl2 molecule resulted in its dissociation into two chlorine atoms. The IR luminescence of the excited HCl molecules formed in the reactions was recorded. The Br. and I. atoms have small reactivities, hence the set of kinetic processes can be represented by the following scheme where X.=Br., I.;M=He, Cl2. If a small fraction of Cl2 molecules dissociates under laser irradiation ([Cl.] [Cl2], [HX]), the pseudo-first order condition is obeyed for the processes (4) and (5), and the solution of the corresponding kinetic equations can be found easily.It has the form (6) [HCl*](t)=A[exp(7k2[M]t)7exp(7k1[HX]t)] . The experimentally observed time dependences of the lumi- nescence intensity are well described by the formula (6). Under the experimental conditions used in Ref. 33, the time of vibrational relaxation was much greater than the reaction time. Therefore, the region of increase in the signal intensity was determined by the reaction time, and after passing a maximum, the signal intensity decreased according to vibrational relaxation. Analysis of the region of increase in the signal made it possible to determine the product k1[HX] and hence the reaction constant k1. In another study,34 more accurate measurements of rate constants for reactions of chlorine atoms with hydrogen bromide and hydrogen iodide were carried out; in addition, the isotope effect of the reaction rate was studied.The accuracy was increased by more careful determination of the concentration of the reagent, HBr or HI. The rate constants for the reactions at ambient temperature were 7.4610712 and 1.64610710 cm3 s71, and the isotope effects (kH/kD) were 1.50 and 1.84, respectively. The measured temperature dependences (in the range from 220 to 400 K) of the rate constants for the same reactions were found to be of non-Arrhenius type.35 E N Chesnokov, V N Panfilov The reactions of F. with HCl, HBr and HI molecules were studied.37, 38 The fluorine atoms were formed upon dissociation of F2 molecules under the irradiation by the fourth harmonic of a Nd-laser.The processes considered are strongly exothermic; the HF molecules were excited to u=3 (for the reaction with HCl), u=4 (for the reaction with HBr), and u=6 (for the reaction with HI). This made it possible to detect the excitedHFmolecules using luminescence at the second overtone frequency. The maximum of the band of the (3?0) transition in HF is at 879 nm, therefore a photomultiplier was used to detect the radiation. The band corresponding to this transition could easily be separated from the other HF luminescence bands using an interference filter for 880 nm with a band pass of 10 nm. In addition to the rate constants for the reactions of the fluorine atom with HCl, HBr and HI, which are 7.0610712, 6.2610711 and 5.6610711 cm3 s71, respectively, the rate constants for vibrational relaxation of HF molecules from the state u=3 in collisions with HCl, CO2, N2O, CO, N2 and O2 were measured.The interpretation of various stages of the IR-CL signal was simple.33 ± 37 As a rule, the region of the signal increase determined the reaction time, and the region of the signal decay determined the time of vibrational relaxation. Such a simple interpretation was possible because the atoms formed in the reaction were less reactive than the starting atoms. Therefore, secondary chemical reactions did not contribute to the observed time dependence of the signal. If species with high reactivity were formed in the reaction, a simple interpretation of the kinetic IR-CL curves was impossible because of secondary reactions.In this case, the role of secondary reactions as a photochemical source of atoms can be deminished by using sufficiently stable molecules which do not react with the newly formed radicals. This approach was used 38 for the reaction HCl*+HCO. . Cl.+H2CO The CCl3F molecule dissociating under the action of radiation of a pulse CO2 laser served as a source of the chlorine atoms. It was shown that the multiphoton dissociation of CCl3F did not result in the formation of fluorine atoms. The CCl3F molecules are sufficiently inert and do not react with the HCO. radical. The rate constant for the reaction was 7.4610711 cm3 s71.Multiphoton dissociation of SF6 was found to be a convenient source of F.. This is explained by the high probability of SF6 dissociation under the action of the radiation of CO2 lasers and relative chemical inertness of SF6. The time-resolved IR-CL method was used to study the reaction of fluorine atoms that formed due to multiphoton dissociation of SF6, with various molecules. For example, the rate constants of reactions of fluorine with H2 and D2 were measured at ambient temperature.39 ± 41 To diminish warming of the gas by the radiation of pulse CO2 lasers, the measurements were carried out in mixtures strongly diluted with a noble gas. kH2 =110710exp ¡860 , RT The numerical simulation of chemical HF- and DF-lasers requires the knowledge of the temperature dependences of the reaction rate constants for fluorine atoms with H2 and D2.The most reliable experimental data for these dependences have been obtained by time-resolved IR-CL.42, 43 It has been found for the temperature range 190 ± 373 K:43 kD 2 =9.110711exp ¡1100 . RT For the temperature range 290 ± 765 K:43 kH 2 =2.110710exp ¡1180 , RT . kD2 =1.110711exp ¡ RT 1200 Time-resolved IR chemiluminescence in gas-phase chemical kinetics In the range of overlapping temperature ranges, the results differ by no more than 30% for the reaction with hydrogen and by much less for the reaction with deuterium. Deviation of the experimental data from the Arrhenius-type dependence over a wide temperature range was reported.The reactions of the fluorine atom with HCl, HBr, HI, DBr, DCl and DI molecules at room temperature were studied.5 The temperature dependences of the rate constants were measured in the range 195 ± 373 K for the first four processes.44 It was found that these dependences at temperatures below the room temper- ature deviate from the Arrhenius-type dependence. The experi- mental dependence can approximately be described by a sum of two terms, one of which does not depend on temperature and the other has an Arrhenius-type dependence with Ea=2± 3 kcal mol71. The explanation of this temperature dependence is that the reaction occurs by two pathways: first, direct elimination upon the attack by a fluorine atom towards the hydrogen atom in a hydrogen halide molecule, and second, formation of a complex upon the attack of a fluorine atom towards the halogen atom.It is considered that the first pathway does not require an activation energy, whereas the reaction according to the second pathway is supposed to overcome an activation barrier to the reorganisation of the complex F_X7H F_H7X , which precedes its decomposition. Cl.+S2Cl. . S2Cl2+hn A study of the multiphoton dissociation of CF3Cl by the time- resolved IR-CL method was reported.45 Observation of the kinetics of IR-CL of HCl and HF molecules formed in reactions with HBr as a trap for atoms showed that dissociation occurs by two pathways to give F.and Cl.. When HBr was replaced by H2, only the formation of excited HF molecules was observed. The rate constants for reactions of fluorine atoms with H2 and HBr and chlorine atoms with HBr were measured. The possibility of using the time-resolved IR-CL for the study of a particular reaction is determined to a considerable extent by the existence of a suitable pulse source of atoms. The photolysis of S2Cl2 is a convenient photochemical source of the chlorine atoms that makes it possible to avoid or diminish the role of secondary reactions (see Ref. 46). The photolysis of S2Cl2 was carried out under irradiation by the second harmonic of a dye laser (l=300 nm)46 and the fourth harmonic of a Nd-laser. The rate constants for chlorine reactions with H2S (see Ref.44), CH3SH (see Ref. 47), and SiH4 (see Ref. 48) were measured with the use of S2Cl2 as a source of chlorine atoms. Yet another photochemical source of chlorine atoms is the photolysis of COCl2 by irradiation with an excimer KrF-laser. This source was used in a study of the reaction of chlorine with SiH4 and SiH3 .(see Ref. 49). V. Modification of the time-resolved IR chemiluminescence method In all of the works considered above, the time-resolved IR-CL method was used for the study of reactions of atoms resulting in the formation of vibrationally excited molecules, whose IR luminescence could be recorded. An approach has been suggested which expands the scope of reactions that can be studied by the IR-CL method.50 The essence of this approach is that reactive species underwent an auxiliary reaction, in parallel with the `nonluminous' reaction being studied, which resulted in the formation of vibrationally excited luminescing molecules. By studying the kinetic characteristics of the luminescence signal from the auxiliary reaction, one can obtain information on the rate constant for the `nonluminous' reaction.This method was tested 51 for the reaction of fluorine with CH4. The reaction of fluorine with D2 was used as the auxiliary reaction. The fluorine atoms were formed by IR multiphoton 175 dissociation of SF6. The main processes can be presented by the following scheme: SF5.+F. , HF*+CH3. (reaction being studied), DF*+D.(auxiliary reaction), DF+M(vibrational relaxation). SF6+nhn F.+CH4 F.+D2 DF*+M Let us designate the rate constants for the basic reaction, the auxiliary reaction and vibrational relaxation as k1, k0 and k2, respectively. If the concentration of the fluorine atoms is much smaller than that of any of the stable components of the gas mixture, the pseudo-first order condition is obeyed for bimolecu- lar processes, and the following expression is valid for the luminescence intensity of vibrationally excited molecules DF* (7) IDF(t)=Ck0âD2äâFä0 âexpÖ¡w0tÜ ¡ expÖ¡w0tÜä , w0 ¡ w0 where C is a proportionality factor, [F]0 is the initial concentration of the fluorine atoms, w0 is the inverse time of the signal growth (7a) w 0=k0[D2]+k1[CH4] , and w0=k2[M] is the inverse time of the signal decay.The inverse time of growth of the luminescence signal of DF* molecules depends both on the rate constant for the reaction F.+D2 and on the rate constant for the parallel process F.+CH4. According to equation (7a), the plot of w0 versus the CH4 concentration is a straight line, whose slope determines the required rate constant k1, and the intercept with the ordinate axis determines the rate constant k0. Thus, the luminescence signal from the products of the `auxiliary' reaction contains the same kinetic information as that obtained from observation of the luminescence of the reaction of interest. As the reaction being studied, F.+CH4, also results in the formation of vibrationally excited HF molecules, it was possible to check the equivalence of kinetic information obtained from the auxiliary reaction and by observation of the luminescence of the reaction products.50 Experiments were carried out in which the signals of the HF* and DF* luminescence were recorded under identical conditions.It was found that the time of the growth of these signals coincided within the experimental error, as would be expected according to the kinetic scheme considered above. The same approach was used 51 to study the reaction FNO F.+NO2 2 . The fluorine atoms were obtained by multiphoton dissocia- tion of SF6. The process HF*+H. . F.+H2 was used as an auxiliary reaction producing vibrationally excited molecules.The dependence of the rate constant for the reaction of fluorine with NO2 on pressure in the range 1 ± 200 Torr was measured; based on this dependence, the ratio of the isomers FNO2 and FONO formed in the reaction was determined. VI. Study of the kinetics of chain reactions by the IR chemiluminescence method The time-resolved IR-CL method combined with pulse initiation of the reaction by laser irradiation was found to be very conven- ient for the study of the kinetics of chain reactions. This method made it possible to observe in real time a number of features of chain reactions, for example, the induction period of a reaction with very slow chain growth.52 Using the data on the luminescence of the chain reaction products, it became possible to develop new kinetic approaches that enable quantitative information on the rate constants for the elementary reactions to be obtained.176 For a non-branched chain reaction (or for a reaction with infrequent branchings) one can distinguish several stages that occur at different times after the pulse initiation of the reaction.The first one is the induction period, during which quasi-steady- state equilibrium between the concentrations of various active centres is established. The duration of the induction period approximately equals the time required for one step of a chain reaction to occur. Then the quasi-steady-state stage ensues. The concentration of active centres in this stage is approximately constant, and the accumulation of chain reaction products occurs.The third stage is the termination of the chain reaction, which occurs when the concentration of the active centres has decreased essentially owing to termination reactions. Let us consider how each of these stages manifests itself in the IR luminescence of the chain reaction products. The induction period. The induction periods of the chain reactions were studied for the chlorination of H2S.52 The follow- ing processes occur in a mixture Cl2+H2S after a pulse of UV irradiation: k1 (8) Cl.+H2S HCl*(u=2, 1, 0)+HS. , k2 (9) HSCl+Cl. . HS.+Cl2 In this case, excited molecules are formed in the first stage of the chain reaction. Let us designate the starting concentration of the chlorine atoms formed owing to the photolysis of Cl2 as [Cl.]0.hence [Cl.]0 [Cl2] and [Cl.]0 [H2S]. In the initial stage, it is Only a small fraction of the Cl2 molecules underwent dissociation, possible to neglect the chain termination and to neglect the vibrational relaxation of the HCl molecules, therefore the follow- ing expression can be written for the concentration of the chlorine atoms: (10) [Cl.](t )=[Cl.]0[y2+y1exp(7jt )] , where t is time, y1=k1[H2S]/j, y2=k2[Cl2]/j and j=k1[H2S]+k2[Cl2]. The following expression is obtained for the concentration of vibrationally excited HCl molecules: (11) [HCl*](t)=ak1[Cl.]0[H2S] j y2t+y1 1 ¢§ expO¢§jtU , where a is the probability of the formation of vibrationally excited molecules in reaction (8). During the initial period, the concen- tration of the chlorine atoms decreases from the starting value [Cl.]0 to y2[Cl.]0.According to formula (11), the rate of formation of HCl molecules should also decrease during this period. Thus, in this example the initial period of the chain reaction should manifest itself in the luminescence signal of HCl as a `kink' segment. During the time corresponding to the initial region, the rate of formation of excited molecules decreases from the initial value to that corresponding to a quasi-steady-state process. Figure 3a shows a luminescence signal of HCl observed after the irradiation of a Cl2+H2S mixture with a pulse of a UV laser.In the initial region of the signal, the rate of the product formation during the establishment of a quasi-steady-state equilibrium between the active centres decreases. After an equilibrium has established, the increase in the concentration of vibrationally excited HCl molecules continued. The deviation of this increase from the linear dependence is due to the vibrational relaxation of HCl molecules. If the vibrationally excited molecules are formed in the second stage of the chain process, the induction period of a chain reaction manifests itself in the luminescence signals in a different way. An example of such a process is the reaction of chlorination of hydrogen19 k1 (12) HCl+H. , Cl.+H2 k2 (13) HCl*+Cl. .H.+Cl2 a HCl (u=1) Induction period 0 20 10 b Induction period 0 200 Figure 3. Initial parts of signals of the luminescence of HCl* molecules formed in chain reactions of H2S (a) and H2 (b) chlorination. Partial pressure, Torr: (a) 0.183 (H2S), 2.20 (Cl2), 8.48 (Ar); (b) 9.59 (H2), 0.026 (Cl2). In this case, the formula describing the increase in the concentration of vibrationally excited HCl molecules after a laser pulse has the form [HCl*](t)=ak1[Cl.]0[H2] y1t7y2 1 ¢§ expO¢§jtU , where y1=k1[H2]/j, y2=k2[Cl2]/j and j=k1[H2]+k2[Cl2]. This formula shows that the rate of formation of the vibrationally excited product increases in the initial region from zero to a certain constant value. Figure 3 b displays an example of an IR-CL signal observed in a Cl2 +H2 mixture (see Ref.52). It is evident that the rate of formation of excited HCl molecules in the initial region increases (the curve is concave, unlike the curve in Fig. 3 a). The initial region contains complete information on the rate constants for both stages of the chain growth. Using the formulas (11) or (14), it is possible to retrieve this information from the experimental signal. For approximation of the experimental curve, for example by formula (11), only three independent parameters have to be found, i.e., the signal amplitude, the reaction rate constant k1 and one of the values y1 or y2 related by y1+y2=1. These parameters are sufficient for finding the rate constants. However, this kind of analysis of the shape of the initial region of the luminescence signal has not been carried out.52 Quasi-steady-state chain reaction.After the end of the induc- tion period of the chain reaction, a quasi-steady-state equilibrium is established between the concentrations of the active centres. The concentration of vibrationally excited products increases in this stage at a rate that depends on a combination of the rate constants for the elementary steps of chain growth. It is convenient to consider this using the same reaction of H2S chlorination as an example. The reaction rate is determined [taking the formula (11) into account] by the derivative . w=daHClaOtU a a k1k2aCl a0aH2SaaCl2a dt k1aH2Sa a k2aCl2a . It is difficult to find w from the luminescence signal, as precise calibration of the absolute sensitivity of the radiation detector is required.Therefore, formula (15) cannot be used to obtain kinetic E N Chesnokov, V N Panfilov t /ms t /ms (14) j (15)Time-resolved IR chemiluminescence in gas-phase chemical kinetics information. However, measurement of w even in relative units can give such a kinetic information. Taking into account that the initial concentration of the chlorine atoms [Cl.]0 is proportional to the energy of the laser pulse E and the concentration of molecular chlorine, formula (15) can be rewritten as . . (16) âH2Sä k âCl ä0âH2Sä à 1 w ak1 1 á k1 2âCl2ä Expression (16) means that the rate of the quasi-steady-state stage of the chain reaction normalised per pulse energy and the product of the concentrations of the starting substances depend only on the ratio of the rates of the stages of the chain growth.It follows from this formula that E[Cl2][H2S]/w should depend linearly on the concentration ratio [H2S]/[Cl2]. Figure 4 demon- strates a plot of this dependence. Analysis of formula (16) shows that the simple graphical method can be used to determine the ratio of rate constants for the elementary steps of chain growth. One has to determine the slope of the straight line and its intercept with the ordinate axis. The ratio of these parameters equals k1/k2. E [Cl2][H2S]/w 1.5 1.0 0.50 0.04 0.06 0.02 0.08 [H2S]/[Cl2] Figure 4.Dependence of inverse normalised rate of a chain reaction on the ratio of reagent concentrations.52 It should be noted that an account of the vibrational relaxa- tion complicates the determination of w from the observed luminescence signal. The formulas containing the necessary cor- rections are presented in Ref. 52. Using the technique described above, the ratio of the rate constants for the chain growth stages in the chlorination of H2S [reactions (8) and (9)] was determined: k1/k2=16.52 The chain reaction of the SiH4 chlorination was studied using this method.53 The ratio of rate constants for the reactions HCl*+SiH3. , Cl.+SiH4 SiH3Cl*+Cl. SiH3.+Cl2 was found to be 4.6. The chain reaction of the SiHCl3 chlorination was studied.54 The ratio of rate constants for the reactions HCl*+SiCl3., Cl.+SiHCl3 SiCl3.+Cl2 SiCl4 +Cl. , was found to equal 1.3. The same technique was applied to the study of the chain chlorination of butane and ethane. Certainly, this procedure does not correspond to direct methods for the determination of rate constants. However, it provides rather reliable information, which is difficult to obtain by other methods. The advantage of using the time-resolved lumi- nescence technique is that it is possible to avoid the complicating effect of chain termination reactions. A method for the measurement of rate constants based on the study of chain reaction termination stages. The IR-CL signal of chain reaction products recorded after a sufficiently long period 177 since its initiation contains information on the rate of decay of active centres in chain termination reactions.If the elementary reaction the rate constant of which has to be determined can serve as the chain reaction termination stage, it becomes possible to measure its rate. In this approach, the chain reaction resulting in the formation of vibrationally excited molecules plays the role of a probe for tracing the time dependence of the concentration of atoms or radicals. This allows one to study reactions that do not produce vibrationally excited molecules by the IR-CL technique. A similar approach for non-chain reactions has been devel- oped.50, 51 The use of a chain reaction gives two additional benefits.First, the sensitivity of the method increases as the total number of vibrationally excited molecules formed in a chain reaction can be many times greater than the number of active centres. Second, this expands the range of reactive species whose reactions can be studied by this method. A detailed analysis of the IR-CL kinetics of chain reaction products at various inhibitor concentration was carried out by Chesnokov.55 The exact solution of this problem is rather cum- bersome, but the results for reactions with a long chain are simple enough and have a simple qualitative interpretation. Achain reaction in a mixture of compoundsA+B with active centres X. and Y. involves the following elementary steps: (17) Y.+D , X.+A k1 (18) X.+F , Y.+B k2 X.k3 (19) termination. Y. k4 In the initial instant of time, a pulse of laser irradiation creates a certain concentration of active centres X. equal to x0. The active centres Y. are absent in the initial instant, [Y].=0. Then, during the chain reaction induction period, a quasi-steady-state equili- brium between the concentrations of X. and Y. is established; the X. concentration decreases, while the Y. concentration increases (Fig 5 a). The overall concentration of the active centres [X].+[Y]. remains approximately equal to x0. After a quasi-equilibrium has been established, the overall concentration of the active centres decreases owing to their decay in chain termination reactions.The fractions of X. and Y. in the overall concentration of active centres remain constant. The fraction of X. in the overall concentration of active centres equals (20) y k2âBä 2 à k1âAä á k2âBä , while the fraction of active centres Y. equals (21) y k1âAä 1 à k1âAä á k2âBä . (22) X.+C (23) (24) The decay of active centres occurs with an weighted average rate constant K=y1k4+y2k3 . If the active centres X. disappear in a reaction with substance C added to the reaction mixture: products, then the rate of decay of the active centres increases: K=y1k4+y2(k3+k[C]) , where k is the rate constant for reaction (23). The formula (24) underlies the method discussed for the determination of rate constants.If the life time of active centres of a chain reaction t is measured at various concentrations of reagent C, then the reciprocal value K=t71 should linearly depend on the reagent concentration. The factors y1 and y2 depend178 [X.], [Y.] (%) 100 80 60 2 40 1 200Ilum 20 0 Figure 5. Theoretical luminescence signal of chain reaction products. (a) establishment of quasi-steady-state equilibrium between the concen- trations of X. (1) and Y. (2); (b) luminescence intensity at quasi-steady- state equilibrium between X. and Y.. on the ratio of the starting concentrations of the original com- pounds A and B. If concentration B is chosen large enough, it is possible to reach the conditions where y2&1 and y1&0.If the reaction rate constant for the active centre Y. has to be measured, then, on the contrary, it is necessary to choose such conditions that y2&0 and y1&1. The procedure for the determination of the life time of active centres from the luminescence signal of the reaction products remains the same. The curve I(t) is described by a sum of exponential terms, which allow one to determine the time of vibrational relaxation and the life time of the active centres. One only has to exclude from consideration the initial period of the reaction, when the quasi-equilibrium between the concentrations of the active centres has not yet been established (see Fig. 5). This method has been used for the measurement of the rate constants for a number of reactions.55 Let us consider the measurement of the rate constants for the reactions Cl.+NOCl with the use of this method.First, one has to choose the chain reaction. Many chain reactions involving the chlorine atom and accompanied by the formation of vibrationally excited products are known. The reactions of chlorination of SiH4 and its halogen derivatives are very convenient. These reactions give vibrationally excited hydro- gen chloride molecules.23, 54 The stages of continuation in such reactions are fast,56 hence the chain length can be significant even at low pressures. The inconvenience of the reaction of SiH4 chlorination is that self-inflammation of its mixtures with Cl2 occurs in the absence of an inhibitor.The reactions of SiH2Cl2 and SiHCl3 chlorination are devoid of this drawback. Let us choose the faster reaction of SiH2Cl2 chlorination. The chlorination of SiH2Cl2 involves the following chain growth steps: HCl*+SiHCl2. , Cl.+SiH2Cl2 SiHCl2.+Cl2 SiHCl3 +Cl. . The rate constant for reaction (25) is 1610710 cm3 s71.56 The rate constant for reaction (26) is 2610711 cm3 s71.23 Reaction (25) gives HCl* molecules in the states u=0 and u=1 with probabilities of 0.67 and 0.33, respectively.23 ab40 60 t /ms (25) (26) E N Chesnokov, V N Panfilov [HCl*] (u=1) 1 21 2 3 0 500 0 1000 t /ms Figure 6. Examples of kinetic curves of luminescence of HCl* molecules formed upon chlorination of SiH2Cl2.Concentrations: SiH2Cl2 861014; Cl2 261016; He 1.361017 cm73; NOCl concentration/ cm73: (1) 2.261013; (2) 5.961013; (3) 1561013. Figure 6 shows examples of IR-CL signals of excited hydro- gen chloride molecules observed after reaction initiation in a SiH2Cl2+Cl2 mixture with addition of NOCl. An increase in the NOCl concentration decreases the amplitude of the lumines- cence signal. Such a dependence indicates that, under the con- ditions of the experiments, the time of vibrational relaxation exceeds the life time of active centres of the chain reaction. Figure 7 shows the dependence of the times of growth and decay of experimental curves on the NOCl concentration. It is evident that one of the characteristic times does not depend on the concentration of NOCl, while the other one varies over a wide range.The first time coincides with the time of vibrational relaxation and does not vary with the change in the NOCl concentration, since the concentrations of the other components of the mixture are much higher. The second time is the life time of the active centres of the chain reaction. At the concentrations [NOCl]>361013 cm73, the life time of the active centres is smaller than the time of vibrational relaxation; at concentrations [NOCl]< 361013 cm73, the life time of the active centres becomes longer than the vibrational relaxation time. The inverse life time of active centres linearly depends on the NOCl concen- tration. The ratio of the projections of any segment of this linear dependence on the coordinate axes equals (6.00.5)610711 cm3 s71. In view of the above values of the rate constants for the steps of propagation of chain reaction under the conditions of the experiment, we obtain y2=0.85 ± 0.9; y1=0.1 ± 0.15.The param- eter y1 cannot be regarded as negligibly small, hence it is necessary to take into account reactions of the active centres of both types (27) K2=(y2k3+y1k4)[NOCl]+const , where k3 and k4 are the rate constants for the reactions K /s71 10000 1 5000 2 0 10 10713 [NOCl]/cm73 5 Figure 7. Dependences of reciprocal times of signal growth and decay on NOCl concentration; (1) life time of active centres; (2) vibrational relaxation time.Time-resolved IR chemiluminescence in gas-phase chemical kinetics k3 Cl.+NOCl Cl2+NO, k4 SiHCl2.+NOCl SiHCl3 +NO .Thus, taking into account the slope of the straight line in Fig. 7, we obtain y2k3+y1k4=(6.00.5)610711 cm3 s71. A mixture with a larger fraction of SiH2Cl2 was studied to estimate the contribution of the term y1k4; in this case, y1=0.3 ± 0.4. It was found that the contribution of the second term in formula (28) did not exceed 10%± 15%. The resulting rate constant k3 equals (6:5 0:5)610711 cm3 s71. This method was used 57, 58 for measuring the rate constants for a number of reactions of the chlorine atom with silicon- containing radicals. The results of these studies and the available published data obtained by other methods are listed in Table 3.The prospects of this method for the measurement of the rate constants for a certain reactive particle are determined by whether a fast chain reaction accompanied by formation of vibrationally excited molecules can be found for this particle. The analysis carried out by Chesnokov55 shows that is possible to expect a gain in sensitivity only in the case where the rates of the chain propagation steps of the chain reaction exceed the rate of vibra- tional relaxation. This condition is similar to that demanded for the chain reaction for a chemical laser.2 Table 3. Rate constants for some reactions of the chlorine atom with silicon-containing radicals. Reaction studied Auxiliary reaction Cl.+NOCl?Cl2NO.* Cl2 +SiH2Cl2 , Cl2+H2 Cl2+H2 Cl.+ICl?Cl2 +I.Cl.+Br2?BrCl*+Br. Cl2+SiH2Cl2 Cl2+SiH4 SiH3.+NOCl? ?SiH3Cl*+NO. Cl2+SiH4 SiH3.+Br2? ? SiH3Br*+Br. Cl2+SiHCl3 SiCl3.+Br2? ?SiCl3Br*+Br. Cl2+SiH2Cl2 SiHCl2.+Br2? ?SiHCl2Br*+Br. Cl2+SiHCl3 Cl.+I2?ICl*+I. SiCl3.+I2?SiCl3I*+I. Cl2+SiHCl3 It should be noted that the idea of increasing the sensitivity by using a chain reaction as a `probe' has been suggested and implemented by Orkin and Chaikin 64 for the thermometric detection of atoms. With the use of IR-CL, it was found possible to implement the same idea in a time-resolved version. (28) Ref. 1011 k /cm3 s71 55 55 59 6.50.5 7.51.0 8.0 55 60, 61 62 1.20.2 0.8 1.00.3 55 50, 61 (1.10.2)610 1.2610 (6.02.0)61071 55 1.30.3 63 57 6.51.4 57 10.51.7 57 6.00.9 58 (2.50.7)610 58 (5.81.8)610 VII.The time-resolved Fourier-transform spectroscopy of IR chemiluminescence In the last decade, time-resolved Fourier-transform spectroscopy is being used ever more frequently for the study of the IR luminescence of the products of gas phase reactions. This method makes it possible to obtain the luminescence intensity as functions of both frequency and time after the reaction initiation. In excep- tional cases, it was also possible to obtain time-resolved IR-CL spectra by ordinary methods.65 For the first time, the time-resolved version of Fourier-trans- form IR spectroscopy was used for the study of chemilumines- cence in the gas phase by Aker and Sloan,66 who studied the initial distribution over vibrational states of the OH.radical formed in the reaction OH.+H. . O..(1D)+H2 A normal Fourier-transform spectrometer was used. The time resolution was achieved in these measurements by synchronisa- tion of the pulse laser initiating the reaction under study with the instants of time when the spectrometer measures the values of the IR radiation interferogram. Figure 8 illustrates the operation principle of a Fourier-trans- form IR spectrometer in the time-resolved mode. The directly measured characteristic is an interferogram, i.e., dependence of intensity of IR radiation at the interferometer output on the difference between the ray paths in the two arms of the interfer- ometer.The spectrum is obtained by Fourier transformation of the interferogram by a computer included in the set-up. The orientation of the moving mirror of the interferometer is deter- mined using a helium ± neon laser whose radiation passes through the auxiliary interferometer of the spectrometer combined with the main one. The controlling computer analyses the intensity of the ray of the helium ± neon laser passed through the auxiliary interferometer and issues the commands for the measurement of the interferogram value. The moving mirror of the interferometer moves at a constant rate S, and the instants of time when the commands are issued are separated by identical time intervals T0 (Fig.8, curve 1) T0= l 2S , a T0 Dt 200 100 0 Figure 8. Diagram clarifying the operation of a Fourier-transform IR spectrometer in time-resolved mode; (1) sequence of time instants of interferogram measurement; (2, 5) laser pulses; (3) IR radiation at interferometer output; (4) interferogram with discarded region a; (6) IR radiation in the next cycle of spectrometer operation. 179 (29) (30) 654321 400 300 t /ms180 where l=0.632861074 cm is the wavelength of the helium-neon laser. To synchronise the pulse laser, the computer command for performing the measurements is used for starting the pulse generator, which after the time Dt triggers the pulse laser (Fig. 8, curve 2).If the delay Dt is equal to the duration of the measure- ment recurrence period T0 or slightly smaller, the pulse laser will act immediately before the instant of the interferogram measure- ment. By decreasing the delay, one can obtain a luminescence spectrum for some definite time instant after the laser pulse. A difficulty in the implementation of such a scheme arises due to the fact that the usual measurement frequency of an interfero- gram by a Fourier-transform spectrometer is several kHz or several tens kHz. The lasers used for reaction initiation cannot work with such a pulse repetition rate. This means that only a part of the interferogram measurements contain the signal, while the major part of the measurements, which do not containing the signal, should not be taken into account (see region a of curve 4).The missing points in the interferogram can be obtained in the subsequent cycles of mirror scanning; however special measures should be taken so that the interferogram contains no gaps. The measurements in Refs 66, 67 were carried out according to such a scheme. The gaps in the measurement of an interferogram can be avoided at high pulse frequency of the laser or at very small movement speed of the spectrometer mirror. An excimer laser with a repetition frequency of 316 Hz was used,68 ± 70 and the interferometer mirror was moved very slowly (0.01 cm s71). At this movement speed of the mirror, the time interval between the interferogram measurements [formula (30)] is equal to the recur- rence period of the laser pulses, and rejecting a part of the measurements is no longer necessary.In the studies mentioned above,66 ± 70 the Fourier-transform IR spectrometer was used without updating the IR radiation intensity measurement system. In later studies,71, 72 advanced equipment was used that made it possible to make a measurement of the interferogram at several different delay times after each laser pulse, instead of one delay time as before. This required alteration of the standard measuring part of the spectrometer, which was replaced with a digital signal recorder connected to a computer with a sufficiently large memory size capable of simul- taneous accumulation of interferograms for all time instants.This updating increases considerably the speed of recording spectra. Additional specific noise appears in the time-resolved mode; this may result, e.g., from the power instability of the pulse laser. It was suggested 73 that this noise be decreased by normalising the measurement results in each pulse using the pulse power. Let us consider several examples of studies carried out by time- resolved Fourier-transform IR spectroscopy. The reaction of the electron-excited O..(1D) atom with the hydrogen molecule was studied.66 The distribution of the radical OH. formed in reaction (29) over vibration levels was determined and found to be as follows: P(u=1 : 2 : 3 : 4)=0.29 : 0.32 : 0.25 : 0.13. The time-resolved Fourier-transform IR spectroscopy made it possible to study the distribution undisturbed by relaxation processes.The distribution obtained is of intermediate type between that characteristic of reactions occurring through an intermediate complex and that characteristic of direct cleavage reactions. It was thus assumed that the reaction dynamics includes a stage of a very strongly excited water molecule, which decays after the time corresponding to several vibration periods. The reaction of the CHF.. radical with the NO molecule was studied.72 The radical was obtained by multiphoton IR dissocia- tion of CH2FCl or CH2F2. The luminescence of vibrationally excited HF molecules formed in the reaction was recorded. The addition of D2 to the reaction mixture resulted in the excited DF molecules, which allowed the determination of the ratio of the pathways yielding HF and F.for the reaction studied; this ratio was found to be 0.6 : 0.4. Vibration relaxation of NO molecules excited to high vibra- tion levels was studied.74 The photolysis of N2O (irradiation with a wavelength of 193 nm) gives O..(1D), which reacts with N2O to E N Chesnokov, V N Panfilov2. give the highly excited NO molecule. Twenty IR luminescence interferograms corresponding to various instants of time (step 30 ms) were obtained. Based on the interferograms, the spectra were reconstructed in the range from 2500 to 1500 cm71 with a resolution of 4 cm71. By plotting the spectra calculated in this way, a time dependence of the population of vibration levels from u=1to u=11 was obtained.The results were interpreted using a system of eleven kinetic equations that described the vibrational relaxation. The rate constants for the vibrational relaxation of separate vibration levels were determined. The relaxation con- stant for the level u=11 is 40 times greater than that for the level u=1. In several publications, the initial distribution of photodisso- ciation products of various molecules over vibration levels was studied using time-resolved Fourier-transform IR spectroscopy. For example, one of them69 is devoted to the study of excitation processes of HF molecules formed upon the photodissociation of CH2CClF (irradiation at the wavelength of 193 nm), while another one 67 deals with a study of distribution of the NH radical formed upon the photodissociation of NH3 (irradiation with a wavelength of 193 nm) over vibration levels.The studies using time-resolved IR chemiluminescence cannot be classified as purely kinetic ones, or to those where only the energy distribution in the reaction products is studied. The basic purpose of these works is to establish the distribution of products over vibration states. However, this can also provide quantitative information on the rates of vibrational relaxation processes and chemical reactions. VIII. Conclusion The time-resolved IR-CL method is used in gas-phase chemical kinetics in order to obtain quantitative information regarding the rates of elementary reactions.The application of this method for studying chain processes was found to be particularly fruitful. However, it should be noted that the method is limited to a narrow range of molecules the luminescence of which can be observed. In fact, the luminescence of either HCl or HF was used in all of the studies. Attempts to overcome this restriction were undertaken. Reactions were found that gave polyatomic vibra- tionally excited molecules yielding intense luminescence. For example, luminescence of SiH3Cl 75 and of products of butane and ethane chlorination 76 was observed. The luminescence kinetics of SiH3Cl was studied in detail;75 this process is mostly determined by the transfer of vibration energy and vibrational relaxation. It was found of little use for obtaining information on the rates of chemical reactions.The difficulties are basically caused by the fast vibrational relaxation of highly excited polya- tomic molecules. Further prospects of the IR-CL method are related to the use of the time-resolved Fourier-transform spectroscopy. References 1. R D Levine, R B Bernstein Molecular Reaction Dynamics and Chemical Reactivity (New York: Oxford University Press, 1974) 2. A S Bashkin, V I Igoshin, A N Oraevskii, V A Shcheglov Khimi- cheskie Lazery (Chemical Lasers) (Moscow: Nauka, 1982) 3. R Gross, J Bott (Eds) Handbook of Chemical Lasers ( New York: Willy-Interscience, 1976) 4. K Tamagake, D W Setser, J P Sung J. Chem. Phys. 73 2203 (1980) 5. E Wurzberg, A J Grimley, P L Houston Chem.Phys. Lett. 57 373 (1978) 6. D J Smith, D W Setser, K C Kim, D J Bogan J. Phys. Chem. 81 898 (1977) 7. N Jonathan, C M Melliar-Smith, S Okuda, D H Slater, D Timlin Mol. Phys. 22 561 (1971) 8. M Maneshkarimi, H Yedtmann Chem. Phys. Lett. 234 182 (1995) 9. K Dehe Ber. Bunsen-Ges. Phys. Chem. 100 1226 (1996) 10. S J Wategaonkar, D W Setser J. Chem. Phys. 90 251 (1989)Time-resolved IR chemiluminescence in gas-phase chemical kinetics 11. R J Malins, D W Setser J. Chem. Phys. 73 5666 (1980) 12. D J Donaldson, J J Sloan J. Chem. Phys. 82 1873 (1985) 13. B S Agrawalla, A S Manocha, D W Setser J. Phys. Chem. 85 2873 (1981) 14. N I Butkovskaya, D W Setser J. Chem. Phys. 106 5028 (1997) 15. G W Flynn, in Chemical and Biochemical Applications of Lasers Vol.1 (Ed. C B Moore) (New York: Academic Press, 1974) p. 163 16. M J Berry J. Chem. Phys. 59 6229 (1973) 17. G K Vasil'ev, V B Ivanov, E F Makarov, A G Ryabenko, V L Tal'roze Dokl. Akad. Nauk SSSR 215 120 (1974) a 18. W H Duewer, D W Setser J. Chem. Phys. 58 2310 (1973) 19. K G Anlauf, P J Kuntz, D H Maylotte, P D Pacey, J C Polanyi Disc. Faraday Soc. (44) 183 (1967) 20. B S Agrawalla, D W Setser J. Chem. Phys. 90 2450 (1986) 21. M A Wickramaaratchi, D W Setser J. Phys. Chem. 87 64 (1983) 22. G Hancock, C Morley, I W M Smith Chem. Phys. Lett. 12 93 (1971) 23. E N Chesnokov Khim. Fiz. 11 1202 (1992) b 24. B S Agrawalla, D W Setser J. Chem. Phys. 86 5421 (1987) 25. S R Gorelik, E N Chesnokov Khim.Fiz. 16 (1) 25 (1997) b 26. J M Herbelin, G Emanuel J. Chem. Phys. 60 689 (1974) 27. F H Mies J. Mol. Spectr. 53 15 (1974) 28. J W Rich J. Appl. Phys. 42 2719 (1971) 29. J C Stephenson, C B Moore J. Chem. Phys. 56 1295 (1972) 30. E N Chesnokov, L A Zamaraeva Khim. Fiz. 8 723 (1989) b 31. N V Karlov Lektsii po Kvantovoi Elektronike (The Course on Quan- tum Electronics) (Moscow: Nauka, 1983) 32. O M Sarkisov, S G Cheskis Usp. Khim. 54 396 (1985) [ Russ. Chem. Rev. 54 231 (1985)] 33. F J Wodarczyk, C B Moore Chem. Phys. Lett. 26 484 (1974) 34. K Bergman, C B Moore J. Chem. Phys. 63 643 (1975) 35. C C Mei, C B Moore J. Chem. Phys. 67 3936 (1977) 36. I W M Smith, D J Wrigley Chem. Phys. Lett. 70 481 (1980) 37. I W M Smith, D J Wrigley Chem. Phys. 63 321 (1981) 38. D M Fasano, N S Nogar Int. J. Chem. Kinet. 13 325 (1981) 39. C R Quick Jr , C Wittig Chem. Phys. Lett. 48 420 (1977) 40. J M Preses, R E Weston Jr , G W Flynn Chem. Phys. Lett. 48 425 (1977) 41. R F Heidner III, J F Bott, C E Gardner, J E Melzer J. Chem. Phys. 70 4509 (1979) 42. E Wurzberg, P L Houston J. Chem. Phys. 72 4811 (1980) 43. R F Heidner III, J F Bott, C E Gardner, J E Melzer J. Chem. Phys. 72 4815 (1980) 44. E WuÈ rzberg, P L Houston J. Chem. Phys. 72 5915 (1980) 45. A B Horwitz, J M Preses, R E Weston Jr J. Chem. Phys. 74 5008 (1981) 46. M Braithwaite, S R Leone J. Chem. Phys. 69 839 (1978) 47. D J Nesbitt, S R Leone J. Chem. Phys. 75 4949 (1981) 48. E N Chesnokov, V N Panfilov Khim. Fiz. 1 1349 (1982) b 49. A V Baklanov, E N Chesnokov, A I Chichinin Khim. Fiz. 15 (12) 28 (1996) b 50. D M Fasano, N S Nogar Chem. Phys. Lett. 92 411 (1982) 51. D M Fasano, N S Nogar J. Chem. Phys. 78 6688 (1983) 52. D J Nesbitt, S R Leone J. Chem. Phys. 72 1722 (1980) 53. E N Chesnokov, V N Panfilov Khim. Fiz. 3 62 (1984) b 54. E N Chesnokov, V N Panfilov Khim. Fiz. 3 1555 (1984) b 55. E N Chesnokov Khim. Fiz. 10 204 (1991) b 56. N K Serdyuk, V P Strunin, E N Chesnokov, V N Panfilov Khim. Fiz. 2 1527 (1983) b 57. E N Chesnokov Khim. Fiz. 10 200 (1991) b 58. A V Baklanov, E N Chesnokov, A I Chichinin Int. J. Chem. Kinet. 29 25 (1997) 59. S A Chasovnikov, L N Krasnoperov Chem. Phys. 116 95 (1987) 60. M A A Clyne, H W Cruse J. Chem. Soc., Farad. Trans. 2 68 1281 (1972) 61. M A A Clyne, H W Cruse J. Chem. Soc., Farad. Trans. 2 68 1377 (1972) 62. A I Chichinin, S A Chasovnikov, L N Krasnoperov Khim. Fiz. 6 281 (1987) b 63. S A Chasovnikov, L N Krasnoperov Khim. Fiz. 6 956 (1987) b 64. V L Orkin, A M Chaikin Kinet. Katal. 23 529 (1982) c 65. L R Copeland, F Mohammad,M Zahedi, D H Volman, W M Jackson J. Chem. Phys. 96 5817 (1992) 66. P M Aker, J J Sloan J. Chem. Phys. 85 1412 (1986) 181 67. E L Woodbridge,M N R Ashfold, S R Leone J. Chem. Phys. 94 4195 (1991) 68. T R Fletcher, S R Leone J. Chem. Phys. 88 4720 (1988) 69. T R Fletcher, S R Leone J. Chem. Phys. 90 871 (1989) 70. E L Woodbridge, T R Fletcher, S R Leone J. Phys. Chem. 92 5387 (1988) 71. G V Hartland, D Qin, H L Dai J. Chem. Phys. 100 7832 (1994) 72. R A Brownsword, G Hancock, K W Oum J. Chem. Phys. 100 4840 (1996) 73. J Lindner, J K Lundberg, S R Leone Rev. Sci. Inst. 66 2812 (1995) 74. X Wang, H Li, Q Lu, Q Zhu, F Kong Chem. Phys. Lett. 208 290 (1993) 75. E N Chesnokov, V N Panfilov Chem. Phys. 92 471 (1985) 76. D J Nesbit, S R Leone J. Phys. Chem. 86 4962 (1981) a�Dokl. Chem. Technol. (Engl. Transl.) b�Russ. J. Chem. Phys. (Engl. Transl.) c� Kinet. Catal. (Engl. Tr

ISSN:0036-021X    

出版商:RSC    

年代:1999

数据来源: RSC

摘要:

Russian Chemical Reviews 68 (3) 183 ± 201 (1999) Mechanism of the directing influence of functional groups and the geometry of reactant molecules on peroxide epoxidation of alkenes V G Dryuk, V G Kartsev Contents I. Introduction II. Epoxidation of alkenes with alkyl hydroperoxides III. Specific features of epoxidation of cycloalkenes and methylenecycloalkanes with peroxy acids IV. Mechanism of the directing influence of functional groups during epoxidation of alkenes with peroxy acids V. Complementarity of reactants as a factor of stereodirected epoxidation VI. Conclusion Abstract. The influence of steric and electronic factors on the reactivity and the stereochemical outcome of epoxidation of cycloalkenes and prochiral alkenes by alkyl hydroperoxides, peroxy acids, oxaziridines, dioxiranes and dimethyl-a-peroxy lactone is analysed comparatively and generalised.The distinctive features of the directing influence of functional groups on the stereochemistry of the epoxide ring closure in the series of ionic, radical and molecular reactions are demonstrated. Some variants alternative to known reaction mechanisms are proposed. The bibliography includes 114 references. I. Introduction Stereochemical regularities of the epoxidation of alkenes by peroxide reagents have been the subject of detailed studies,1 ±8 because reactions of this type are widely used in asymmetric synthesis and for the preparation of a number of polyfunctional compounds of specified structures. In the last two decades, the knowledge of the stereochemistry of epoxidation has become much deeper due to the understanding of the role of stereo- electronic microeffects in the transition state 2, 5±9 and long- range macrostereochemical effects at the stage of coming together and coordination of reactants.10±13 Thus it was found that the rate of epoxidation of aliphatic compounds by peroxy acids depends on the length and conforma- tion of the hydrocarbon chain of the molecule.1, 2 The dependence of the rate constants for epoxidation (kepox) on the number of carbon atoms in the molecule of the peroxy acidRCO3Hor alkene is a broken curve (alternation effect).10 When the size of the peroxy acid molecule increases, the rate and contribution of epoxidation decrease; simultaneously, the loss of active oxygen in the alkene-induced decomposition of the peroxy acid becomes more significant.2, 11, 12 The rate of epoxidation of the first double bond in the diallyl dicarboxylates H2C=CHCH2OCO..(CH2)nCOOCH2CH=CH2 markedly decreases at n>2, V G Dryuk Crimean Agriculture University, Agrarnoe, 333030 Simferopol, Ukraine. Fax (7-065) 222 39 66. Tel. (7-065) 226 35 10. V G Kartsev `Interbioscreen Ltd.', Institutskii prosp. 8, 142432 Chernogolovka, Moscow Region. Russian Federation. Fax (7-095) 913 23 19. Tel (7-096) 913 23 19 Received 5 January 1998 Uspekhi Khimii 68 (3) 206 ± 226 (1999); translated by Z P Bobkova #1999 Russian Academy of Sciences and Turpion Ltd UDC 547.222.127 183 183 188 192 196 199 although the electron-withdrawing influence of the ester group rapidly decays with an increase in n.13 The kepox is substantially influenced by the solvation of func- tional groups far removed from the reaction centre.This solva- tion, like the increase in the size of the molecule, results in the loss of rotational degrees of freedom of reactant molecules and thus decreases the probability of their efficient collision.2, 13 The requirements for the spatial compatibility of reactants become more rigorous with an increase in the size of the substituents surrounding the CO3H group up to the point when the steric factor becomes more significant than the electronic factor. cis-Alkenes better fit in the `niche' of the shielded peroxy- acid site.As a consequence, the kcis : ktrans value becomes relatively high. An increase in the number of alkyl substituents at the double bond decreases the reaction rate.14 The stereo- and regioselectivity of epoxidation are largely associated with the influence of alkyl substituents and functional groups in the alkene (OH, COOH, CONH2, C=O, SiR3, etc.) on the epoxidising reagent and with the geometry of the reactant molecules.2, 6 ± 8, 15 However, the features of the stereochemical influence of substituents and the stages responsible for this influence are still not quite clear. In particular, they have not yet been identified for the set of epoxidising reagents presented below.1, 2, 4, 5, 16 ROO7M+, ROOH± Cat, RCO3H, (CF3)2C(OH)OOH, R2 O O., R1R2C R1R2C COR3, R1R2C OO , R1 NR3 O O OOH In this review, we attempt to generalise the accumulated data and to reveal new aspects concerning the mechanism of influence of the geometry of reactant molecules and the nature of functional groups on the rate, route and stereochemical outcome of epox- idation of alkenes with the above reagents. Using epoxidation by peroxy acids as an example, we describe systematically the general features of the behaviour of cycloalkenes and methylenecycloal- kanes as functions of the strain and the degree of shielding of the double bond. II. Epoxidation of alkenes with alkyl hydroperoxides Epoxidation is normally carried out using alkyl hydroperoxide derivatives of types 1 ± 3 shown below184 R O M O ROO7 1 ROO 3 2 Mis a transition metal in the highest oxidation state (Mo6+, V5+, Ti4+, etc.).Alkylperoxide anions 1, like the hydroperoxide anion, oxidise polar C=C double bonds conjugated with a carbonyl group in chalcones, quinones, naphthoquinones,17, 18 a,b-unsaturated esters, sulfones, sulfoxyimines and amides19 ± 22 at moderate temperatures (720 to 0 8C) with relatively high diastereoselectiv- ity (20% ± 100%). These reactions are catalysed by bases (NaOH, Na2CO3). The use of salts (ROOKand ROOLi), which are formed on treatment of ROOH with the corresponding metal hydrides or alkylmetals, is also efficient. It is of interest that the use of the ButOOH± RLi oxidative system results in a side reaction, transfer of active oxygen to the carbanion, occurring in parallel with epoxidation.19 ButOH+RO7Li+ ButOOH+R7Li+ The regularities of the process have been studied most comprehensively in relation to epoxidation of a,b-unsaturated esters.This reaction is highly sensitive to steric restrictions, especially when the a- and b-positions in the substrate are substituted. The oxidation of cis-isomers is slower than that of trans-isomers. The reaction is completely stereospecific, except for oxidation of some sterically hindered esters of maleic acid. Di(tert- butyl) maleate is converted into the epoxide of di(tert-butyl) fumarate under the oxidation conditions.19 It is significant that epoxidation of a,b-unsaturated esters occurs diastereoselectively (the content of one isomer reaches 74%) only when lithium tert-butyl peroxide is used.When potassium tert-butyl peroxide is employed, the stereospecificity is lost. Apparently, the lithium cation, which has the most intense electromagnetic field among alkali metal cations, forms a stronger associative bond with the carbonyl oxygen atom in the substrate and thus stipulates the formation of cyclic transition state 4. One of the two possible orientations of the unsaturated compound results in a more stable conformation of the transition state (TS) (with equatorial R2); this ensures the predominant formation of one isomer. O OR1 O OR1 Li O ButOOLi+ H ButO H a e H H R2 R2 4 O O OR1 Li H OR1 O ButO H H R2 O H R2 The reaction is accompanied by several side processes, in particular, transesterification and a rearrangement of the a,b- epoxy ester.Thus epoxycinnamate can rearrange to give the ester of an oxo acid, which then undergoes the Claisen cleavage. Ph H Ph H H H HO7 H+ 7 Ph CO2Me O HO CO2Me CO2Me O 7 7 1. OH (OR) 2. H+ PhCOOH(R)+MeCO2Me PhCOCH2CO2Me Di(tert-butyl) maleate does not undergo stereocontrolled epoxidation.19 N,N-Dialkylamides of a,b-unsaturated acids undergo epoxidation with ButOOLi with complete regio- and V G Dryuk, V G Kartsev stereo-control and a small extent of side reactions. This method is relatively ineffective for secondary amides and totally ineffective for primary amides. As in the case of esters, oxidation of cis- amides occurs more slowly than that of the corresponding trans- isomers.The reaction rate depends appreciably on the size of the substituent at the b-position. Phenyl cis-styryl sulfone is epoxidised according to the same rules as a,b-unsaturated esters. Epoxidation with potassium tert- butyl peroxide is not stereopecific (the ratio of cis- and trans- epoxides is 2 : 3), whereas treatment with lithium tert-butyl peroxide under the same conditions gives cis-epoxide as the only product in a high yield. The trans-isomer of this sulfone is epoxidised in a similar way. Asymmetric a,b-unsaturated sulfox- yimines 5 undergo epoxidation with 100% diastereoselectivity. O Ph S CHCOOMe (PhCH2)2NCH(R)CH TsN 6 (R=Alk) Ph 5 RCH(OR0)CH RCH2CH CHSO2Ph CHSO2R 8 (R=Alk) 7 (R=Alk, Ar; R0 =Alk) In this case, unlike the reactions described above,19 the use of potassium tert-butyl peroxide in a THF±NH3 mixture permits stereoselective epoxidation of unsaturated compounds 6.20 The ratio of syn- and anti-diastereoisomers amounts to 95 : 5.a,b-Unsaturated sulfones 7 undergo stereoselective epoxida- tion by ButOOLi,21 and analogous alkenyl sulfones 8 can be stereoselectively epoxidised by an alkaline solution of potassium tert-butyl peroxide.22 In the latter case, the product of addition of alkyl hydroperoxide at the double bond was isolated, apart from the corresponding epoxide. Intramolecular epoxidation of compound 9 simulates a stage of the biological oxidation of vitamin K.23 O O Me Me KH, THF, 18-C-6 25 8C Me OO7K+ Me OOH 9 O O Me Me 7 O K+ O OK Me Me O The alkaline intramolecular epoxidation of cyclic a,b-unsatu- rated ketones 10 and 11 occurs in a similar way, yielding cis-epoxy alcohols.24, 25 OH O HO O But But O OOH But 10 11 It can be easily understood that a coplanar arrangement of the p electrons of the peroxide anion and the p* (antibonding) orbital of the double bond in the substrate is a necessary stereochemical condition for epoxide ring closure in the ketones 9 ± 11 (stereo- electronic factor).This is also true for a large number of other heterolytic and radical reactions involving not only p* orbi- tals 23 ± 26 but also s*O±O1, 27 and s*H±O28 type orbitals. In particular, this can be clearly seen in the case of photo or thermal isomerisation of endo-peroxides formed during oxygenation of cyclic 1,3-dienes by singlet oxygen.26Mechanismof the directing influence of functional groups and the geometry of reactant molecules on peroxide epoxidation of alkenes O O hn or D O2 (CH2)n (CH2)n (CH2)n O(CH2)n O O O Similar stereoelectronic effects are involved in the deoxygena- tion of endo-peroxides with triphenylphosphine.26 7 O O PPh3 O(CH2)n (CH2)n (CH2)n O 7OPPh3 Ph3P+O The scheme of epoxidation of alkenes with alkylperoxyl radicals with the intermediate formation of b-peroxyalkyl radi- cals 1, 27 is shown in Fig. 1.O R 1 O 2 ROO C C C C A C O C O R 7RO C C O 3 B Figure 1.Epoxidation of alkenes with alkylperoxyl radicals: A is the donor ±acceptor complex; B is the b-peroxyalkyl radical; (1) the sO¡O orbital; (2) the pC¡C orbital; (3) the s*antibond O7O orbital. b-Hydroxy radicals 12 are generated during decarboxylation of b-hydroxy acids in the presence of lead tetraacetate and during oxidation of b-oxo esters 13 with manganese triacetate.28 O O HO CO2Me CO2Me CO2Me Mn(III) CH2 R HO R HO O R 12 13 The epoxide ring closure occurring upon the oxidation of b-hydroxyl radicals by transition metal salts can be represented as follows: H C Mn+ C O 7H C C O santibond H¡O 12 Isomerisation of a-hydroxy epoxide 14 in an alkaline medium occurs in a similar way.29 Me Me But But 7O O MeOH, NaOH O7 14b (17% ) O 14a (83%) The generalisations made here can be invoked to interpret the mechanisms of some known reactions.Thus oxidation of alkenes with atmospheric oxygen on a vanadium catalyst 5, 30 gives allyl hydroperoxides, which undergo intramolecular epoxidation. This affords epoxy alcohols only as cis-isomers, which has been confirmed by simulation of the stage of self-oxidation of cyclo- alkenyl hydroperoxides.31 It is obvious that intramolecular cis- epoxidation rules out the possibility of the coplanar attack by the alkene p bond on the s*O±O orbital and the mechanismtypical of epoxidationof inorganic acids by peroxy esters.5, 7 Meanwhile, the structure of the substrate 15 is favourable for the nucleophilic attack by the outer peroxide oxygen atomon the p* orbital of the alkene activated by the catalyst.V O H OH V O O O O 15 Yet another example of reaction the course of which can be predicted based on the above stereochemical regularity is oxida- tion of a biological antioxidant, vitamin E (D-a-tocopherol 16).32, 33 It was reported 32 that the tert-butylperoxyl radical oxidises tocopherol 16 to give epoxy hydroperoxide 18 via the intermediate formation of hydroperoxide 17.HO O O O R R O OH 16 17 R=CH2[CH2CH2CH(Me)CH2]3H. When tocopherol 16 is oxidised by the radicals formed upon thermolysis of azobis-2,4-dimethylvaleronitrile in oxygen-satu- rated acetonitrile, the hydroperoxide 17 is formed in only small amounts and, judging by kinetic data, it is not an intermediate compound.33 It was suggestedthat the reactionfollows the scheme shown below: O O R0OO 16 O R O O R O OR0 O O2 O R O 20 O O O2 O R With allowance for the above-discussed stereoelectronic con- ditions for the closure of an epoxide ring, two ring formation mechanisms operating during the transformation of the radical 19 185 O + VO OH O O R O OH 18 O R 19 O O R O O O H 21 O O O R OOH186 into 20 and then into the epoxide 21 can be conceived.In the case of direct attack by the alkylperoxyl radical R0OO. on the p bond, the following transformations occur: O O R0OO 19 7R0O R O R O R0OO O 21 20 In the case where the radical 19 captures a triplet oxygen molecule, a different sequence of transformations is possible. O O O2 19 R O R O O O O O 22 O O ROO 21 7RO R O R O O O O O O The epoxidation mechanism assuming the formation of the alkenylperoxyl radical 22 is possible in the case of either dispro- portionation of radicals or exchange interaction RO O + OR0 RO + R0OOH.H One can expect that an equilibrium of this type in the reaction in question would be shifted towards the more stable hydro- peroxide 21 having an intramolecular hydrogen bond. It has been found that radicals formed from the superoxide ion 2 .) and polyhaloalkanes (CCl4, CHCl3, F3CCCl3, PhCCl3, question of what is the route leading to the oxo compound.(O¡¦ Cl2C=CCl2, etc.) 34, 35 containing a halogen atom which can be homolytically eliminated possess epoxidising ability under mild conditions. For example, when CCl4 is treated with potassium superoxide in acetonitrile in the presence of a phase transfer catalyst, the trichloromethylperoxyl radical Cl3COO. 23 acts a species of this type. In our opinion, the mechanism of generation of this radical includes radical decomposition of polyhaloalkanes initiated by the superoxide ion to give singlet oxygen. s* 7 O O Cl3C Cl [Cl3C+Cl O O7] 7Cl7 O] [Cl3C+O O] [Cl3C+O 7hn Cl3COO 23 The fact that the yield of the epoxide does not depend on the concentration of 3O2 indicates that the radical 23 is formed only from the initial compounds in a solvent cage.The radical character of the process is confirmed by the loss of stereospecificity D cis-stilbene is mostly converted under these conditions into trans-stilbene oxide. Additives able to transform Cl3COO. into the anion inhibit the epoxidation. Oxidation of alkenes by radicals of the type 23 is a good model for the study of general, including stereochemical, regularities of the set of consecutive and competing transformations involved in epoxidation by alkylperoxyl radicals, oxometal complexes and triplet oxygen, which is usually accompanied by extensive oxida- tion of substrates with complete cleavage of the alkene double bond.2, 5, 36 V G Dryuk, V G Kartsev In particular, attention is attracted by the fact that in addition to oxirane (yield 73%), epoxidation of cyclohexene in the CCl4 ¡À KO2 system gives cyclohex-2-enone (yield 9%), whereas 1-meth- ylcyclohexene is oxidised only to the corresponding oxirane.This difference is undoubtedly due to the higher nucleophilicity of the double bond in the latter compound. However, the steric factor also cannot be ignored; indeed, the methyl group introduced in the cyclohexene molecule decreases its conformational mobility. The stereochemistry of radical oxidation of cyclohexene at the a-C ¡ÀH bonds requires that the Cl3COO. radical 23 be inserted into the axial position; this should be followed (at the stage of formation of the carbonyl group) by ring inversion and migration of the substituents to the equatorial position.OCCl3 O OCCl3 O H 7Cl3CO O In addition to epoxides, the reaction affords products of complete cleavage of alkenes at the double bond (which are formed via a parallel route rather than in subsequent trans- formations). For example, acetophenone (19%) is formed in the oxidation of a-methylstyrene apart from the epoxide (73%). The highest yield of acetophenone is attained much earlier than that of the epoxide. It was found in special experiments that epoxide itself is not converted into acetophenone under the reaction conditions. It is also noteworthy that a-methylstyrene is oxidised more readily when taken as an equimolar mixture with styrene rather than in a pure state, although it is more nucleophilic.The character of the observed transformations implies that in addition to the classical epoxidation of the alkene via b-peroxy- alkyl radical 24 (pathway a),2, 36 transformations in this system include more extensive oxidation involving a second KO2 mole- cule, yielding intermediate 25 and resulting in complete rupture of the alkene bond. This brings about the fundamentally important Indeed, this product could be formed either via the ozonide and then the Criegee intermediate (pathway b) or via dioxetane (path- way c). Ph Ph Ph a O OCCl3 CH2 CH2 CH2+Cl3COO 7Cl3CO Me Me Me O 23 24 7 O O O K+ Ph b O O KO2 24 Ph Me O OCCl3 CH2 Me 25 O O Ph Ph Me +H2C O O +H2CO O Ph Me O+O7 Me c O O 25 PhCOMe+H2CO 7KCl,7HCOOH Ph Me Pathway b is a result of the transfer of oxygen from the peroxide group R¡ÀO¡ÀO¡ÀR0 to the peroxyalkyl anion, by anal- ogy with self-oxidation of peroxide compounds.2 This seems more likely than pathway c, which assumes reversible nucleophilic substitution giving a strained dioxetane ring at an initial stage.Pathway b involving the formation of a carbonyl oxide accounts for the fact that during oxidation of styrene, benzoic acid, formed in parallel with benzaldehyde, is accumulated in the reaction mixture.35Mechanism of the directing influence of functional groups and the geometry of reactant molecules on peroxide epoxidation of alkenes + OH OH O7 O Ph C O Ph C O Ph CH However, in the presence of KO2, oxidation of aldehydes, in particular benzaldehyde, is also possible; this gives rise to the benzoylperoxide anion, the oxidative capacity of which exceeds that of the radical 23.It is this fact that accounts for the promotory influence of styrene on the epoxidation of a-methylstyrene. The Cl3CO. radical formed in epoxidation is neutralised apparently by excess KO2. The epoxidising radical 23 can be consumed in a similar way. O O O KO2 7 Ph C Ph C Ph C +O OK+ OO7K+ H Cl 7 7 Cl C O O OK+ Cl3CO + O OK+ 71O2,7KCl Cl Cl H2O O H2CO3 Cl Cl 7 7 7 Cl C O O O OK+ O OK+ K+OOCCl3 71O2 Cl3COO + 23 Cl If the polyhalide molecule contains a double bond, cyclisation of the intermediate peroxyl radical 26 during the reaction becomes possible.34 Cl Cl Ph Ph Cl Ph KO2 KO2 Ph OO Ph Cl Ph O O 26 7 O Ph OOK+ Ph H2O PhCOPh+CO2 Ph Ph O O O O Cl 7H2O2, 7KCl Epoxidation of alkenes by peroxy esters of inorganic peroxy acids has been studied fairly comprehensively.1, 2, 5, 7, 37, 38 Apeculiar feature of theROOH± Cat epoxidising system (Cat is a transition metal complex) is that the hydroperoxide molecule enters the coordination sphere of the central atom as a nucleo- phile; this is accompanied by displacement of one ligand (acety- lacetonate, OR, RCO2, CO, etc.).Apparently, the alkene also participates in the ligand exchange. The rate of these reactions can be comparable with the epoxidation rate. Consequently, the overall rate of the process is controlled by the rate of diffusion and exhibits self-acceleration or, conversely, self-deceleration effects.2, 39 When the alkene contains a nucleophilic functional group (for example, an allylic hydroxy group), both the alkylperoxide frag- ment and this functional group get into the coordination sphere of the catalyst.5, 7 Thus, the stereodirecting influence of the hydroxy group in alkenes on the attack by alkyl hydroperoxide is exerted at the stage of construction of a highly ordered multiligand donor ± acceptor complex.It has been found that the stereoselectivity of formation of the corresponding oxiranes in the epoxidation of allylic alcohols decreases upon an increase in the degree of shielding of the hydroxy group.40 But But OH OH OH OH Com- pound But But 5 75 25 77 ee (%) Yield (%) >95 52 85 43 The geometry of the chiral environment of the catalytic center, which has a sort of matrix effect on the orientation of the prochiral double bond, is a crucial factor for the occurrence of stereo- controlled synthesis in the presence of the ROOH± Cat system.In 187 particular, the Sharpless reagent ensures not only high diastereo- selectivity but also enantiofacial selection caused by the ligand configuration (D- or L-tartrate). The strict spatial orientation of the molecular orbitals participating in the construction of the intermediate complex also makes a certain contribution to the matrix effect (stereoelectronic factor). The extent to which a hydroxy group is involved in the epoxidation of cyclic alkenes and alkadienes is determined not only by its position relative to the double bond but also by the conformation of the molecule as a whole.This can be judged by examining the relative rates of epoxidation of the double bonds [ButOOH, VO(acac)2, C6H6, 40 8C] in the following sequence of substrates:41 OH OH OH OH OH Com- pound 19 40 0.09 2.1 100 krel The introduction of a bulky trimethylsilyl group (e.g. at the 3-position) in the unsaturated alcohol molecule increases the stereoselectivity of epoxidation.42 The higher stereoselectivity observed in the presence of alkyl hydroperoxides and the greater versatility of these reagents compared to peroxy acids is due to the formation of a fairly strong donor ± acceptor bond between the hydroxy group of alkenol and the central metal atom.Detailed investigation of the ButOOH± diethyl tartrate ± Ti(IV) epoxidising system permitted the researchers7, 39 to con- clude that epoxidation occurs in binuclear complex 27 with six- coordinate titanium. O OR0 OR0 O But R0OOC O O O O RO ButOOH Ti R0O C Ti O O C C COH O O OTiOR OR COOR0 RO 27 R=Pri, R0 =Et. Change in the ligand nature, in particular, the use of titanium complexes containing chloride ions or amides of tartaric acid results in inverted stereoselectivity.43 It has been shown 44 that opposite enantiofacial selectivities are observed for allylic and homoallylic alcohols.This finding might suggest a synergistic effect of the two hydroxy groups in the optically active (1R,2R)-1,2-divinylethylene glycol 28. However, epoxidation of this compound by ButOOH led to an unexpected result, 40 namely, the inversion of enantioselectivity and enantio- facial selectivity was observed. Depending on the amount of the oxidant used, this reaction yielded either mono- (29) or di-epoxide (30). O O Ti(OPri)4, D-(7)-DIPT, ButOOH HO HO OH + HO OH OH O 30 (2S)-29 (R,R)-28 DIPT is diisopropyl tartrate Diisopropyl L-(+)-tartrate [L-(+)-DIPT], which should have been used according to the empirical rule formulated by Rossiter and Sharpless,44 proved to be inapplicable. However, epoxidation of the monobenzyl ether of glycol 28 occurred in conformity with this rule.45 The meso-form of 1,2-divinylethylene glycol 31 was epoxidised in a similar way.188 O O L-(+)-DIPT OH OH OH + OH OH OH 31 (2R) (2S) (87,5%) The result of the asymmetric epoxidation of the stereoisomeric glycols 28 and 31 was interpreted by assuming that the (R,R)- substrate 28 reacted as a monomeric (32) or dimeric (33) complex, in which the peroxide oxygen atoms are arranged as in the complex 27, whereas the meso-form reacted in complex 34, in which the oxygen atoms are arranged horizontally.But CO2R O OR O O C OTi D-(7)-DIPT OH O O O HO O H (2S)-29 32But 28 O RO2C OR C OR O D-(7)-DIPT O (2S)-29 ROTiO O H OTiO O CO2R O RO2C H 33 RO2C RO O O O L-(+)-DIPT O O 31 But Ti OH OH O O O (2S) 34 III.Specific features of epoxidation of cycloalkenes and methylenecycloalkanes with peroxy acids Cycloalkene molecules are characterised by various types of strain: cisoid stretching or compression strain and out-of-plane, one-sided, torsional and transannular strain.12, 46 ± 48 The three last mentioned types of strain are most typical of methylene- cycloalkanes.47, 48 The real contributions of the components to the total strain can be estimated based on thermochemical data and quantum-chemical calculations.12, 46 ± 49 Qualitative estimates can be made by comparing the relative rates of epoxidation (o) of several cycloalkenes under conditions A and B. A. Reaction conditions for cycloalkenes 35 ± 40: AcOOH, AcOEt, 25 8C.47 Compound (36) (38) (37) (35) 0.34 2.65 1.28 o *0.17 (39) (cis-41) (40) Compound 1.03 1.0 1.62 o V G Dryuk, V G Kartsev B.Reaction conditions for cycloalkenes 39, 41 and 42: PhCOOOH, THF, 20 8C.46 (trans-42) (cis-41) (39) Compound 90.0 1.6 1.0 o It can be seen that the reactivity of five- and six-membered rings increases in the sequence 39<38<35. This was attributed to the increase in the cisoid compression strain and out-of-plane strain.47, 49 The higher reactivity of the double bond of the norbornene fragment compared to that in the cyclopentene fragment is manifested when dicyclopentadiene is oxidised with peracetic and monoperoxyphthalic acids 50 and with geminal hydroxyalkyl hydroperoxides.51 The reaction of norbornene 35 is characterised, in addition to the typical exo-selectivity of the attack on the double bond, by a high rate of electrophilic addition, observed irrespective of the reagent used or the reaction mechanism.A certain contribution to the relatively high reactivity of norbornene is made by the out-of- plane deformation and hyperconjugation.52 PMX calculations showed that the =C±H bonds in norbornene 35, unlike those in cyclohexene 39 and bicyclo[2.2.2]octene 36, are bent by 4.28 to the endo-region. In view of this result, which has been confirmed by ab initio 53 calculations, the preferred exo-attack by the electrophile is explained by the fact that in the exo-region, the p orbital of norbornene is turned outwards due to the repulsion from the occupied orbitals of the methylene bridge,53, 54 whereas in the endo-region, the orbital is shielded by the carbon skeleton of the molecule.In cyclopentene, this effect is less pronounced.52 The replacement of the endo-methylene bridge in norbornene 35 by an endo-ethylene bridge relieves the cisoid compression strain and, apparently, enhances shielding of the double bond, which results in a markedly lower reactivity of bicyclo[2.2.2]- octene 36. Upon replacement of the six-membered ring by an eight- membered ring, the system becomes more flexible and the reaction rate increases. Unlike other cycloalkenes, cis-cyclooctene 41 is readily converted into the epoxide on treatment with various oxidants including molecular oxygen.This leads to the conclusion that both the intermediate states and species and the epoxide formed from the cycloalkene 41 are highly conformationally stable. trans-Cyclooctene 42 occupies a special place in the series of cycloalkenes.46, 55 It typically exists in a twist-conformation with highly pronounced out-of-plane torsional strain, favourable for syn-addition reactions. The electrophilic attack is directed only at one face of the double bond, which is rotated outwards due to twisting of the molecule. The general pattern of the electrophilic addition to double bonds in cycloalkanes is as follows: as the substrate becomes more strained, the formation of a cyclic transition state is facilitated, because this releases strain.46, 47, 56 The more atoms incorporated in the transition state, the greater the decrease in the strain of the system; consequently, the reaction rates can differ by 2 ± 3 orders of magnitude.56 The fact that the rates of epoxidation of norbor- nene and cyclohexene differ by a factor of less than three attests to the formation of three-membered transition states in both cases.It should be noted that in the case of typical 1,3-dipolar addition of phenyl azide (in CCl4 at 25 8C) to trans-cyclooctene 42, norbornene 35 and cyclohexene 39, the relative reaction rates are 2.16105, 5.7610 3 and 1.0. Apparently, the rate of epoxidation depends on the strain not only in the initial alkene but also in the final product, oxirane.It is the high conformational distortions in the latter in combination with steric shielding that account for the facts that 3,5-dibromo- cyclopentene and 3,6-dibromocyclohexene are much more diffi- cult to epoxidise than their open-chain analogue, 1,4-dibromobut-Mechanism of the directing influence of functional groups and the geometry of reactant molecules on peroxide epoxidation of alkenes 2-ene, and that cyclobutene 37 is much less reactive than cyclo- pentene 38.2 An important factor governing the stereochemistry of epox- idation of cycloalkenes is the principle of the least conformational strain formulated by Toromanoff.57 By means of dynamic con- formational analysis of the probable transition states with allow- ance for the Curtin ± Hammett principle, the researcher showed that insertion of the epoxide oxygen during the epoxidation of mono- and bicyclic alkenes follows predominantly the direction that ensures the least conformational distortions (thermodynamic control). However, the notion of conformational distortion is ambiguous and can comprise several components.The concepts of torsional,10, 58 hyperconjugative 59 and electrostatic 60 effects controlling the stereochemistry of epoxidation are being debated in the literature. It has been reported 57, 61 that bicyclononene 43 reacts with peroxy acids to give exclusively endo-epoxide 44. H1H4 H1H4 H H H H O H OOCC6H4NO2-p 43 O 44 (100%) This reaction route is apparently facilitated by shielding of the double bond by the axial H1 and H4 atoms at the stage when the reactants approach each other, by the torsional strain in the transition state, which would have been generated by an attack by the peroxy acid from the side of these atoms and, finally, by stabilisation of the transition state formed in the case of the anti- attack by RCO3H due to the interaction of the C±H1 and C±H4 s bonds with the electron-deficient sites arising in the bicyclono- nene complex 43.The latter type of interaction is involved in initial stages of classical rearrangements of carbenium ions of the type 45 and in the isomerisation of oxiranes 46 to oxo compounds,62 associated with hydride shifts. H H CH d+ H R2 H O+ d+ d7 H R1 R3 X45 46 The combined action of all these factors in the reaction of bicyclononene 43 results ultimately in the generation of a con- formationally more stable (see Section V) and, hence, energeti- cally more favourable transition state.The (s± d+) type interaction (in the s± s* variant) has been invoked 63 to explain the stereochemical outcome of epoxidation of the bicy- clo[2.2.2]octene derivative 47 by m-chloroperbenzoic acid (MCPBA). 2 3 1 7 6 MCPBA 5 4 8 X 47 O O H H H H + X X syn anti It was found that the proportions of the syn-isomer obtained with X = OMe, H, F and NO2 are 48%, 50%, 58% and 77%, respectively. In other words, the introduction of an electron- withdrawing substituent (F, NO2) decreases the s-donor capacity 189 of the C(1) ± C(6) and C(4) ± C(5) bonds and thus makes the syn- attack by the peroxy acid more favourable.The presence of an alkyl substituent in the five-membered ring and in polycyclic molecules 6, 50 can hamper the attack on the double bond from one side. O Me Me Me + H H H HH O (83%) H (17%) The presence of an axial methyl group at C(3) in 3,3,5- trimethyl-1-methylenecyclohexane decreases the proportion of the axial attack byRCO3Hon the double bond to 17% (compared to 64% observed for 3,5-dimethyl-1-methylenecyclohexane).15 CH CH2 CH CH2 HH HMe Me Me Me Me However, in flexible systems, for example, in cyclohexene derivatives direct steric shielding can be removed or minimised due to the conformational mobility of the molecule,29 because the most substantial steric restrictions are created by an axial sub- stituent. H H H O RCO3H But But + But O cis- (53%) trans- (47%) H H H H H H O RCO3H But But + But OAc OAc OAc cis- O (55%) (45%) Alkene 48, having a rigid alkenyl system, forms epoxide 49 with high diastereospecificity (93% ± 99%);18 in this case, the anti- attack by the oxidant predominates.R R O MCPBA H H N N Bz Bz 49 48 R=H, Br, CN, OMe.Conformational analysis of diastereoisomeric transition states (A and B, Fig. 2) permits the conclusion that gauche-structure A, leading to the anti-epoxide, is more favourable than eclipsed R C O Bz N H O R C O H O H N Bz B A Figure 2.Newman projections of the transition state formed in the oxidation of the alkene 48 with m-chloroperbenzoic acid: A is the gauche-conformation; B is the eclipsed conformation.190 structure B, in which the orientation of the benzamide group in one direction with the peroxy-acid fragment increases the tor- sional strain in the transition state. In the Newman projections, the line of sight of the observer is directed along the peroxide bond from the side of the attack of the alkene, the p bond passing through one of the two lone pairs of the active oxygen atom; this is a necessary condition for the occurrence of dative interaction at the stage of the epoxide ring formation.2 The composition of the products of epoxidation of two series of compounds, alicyclic compounds 50 ± 54 with conformation- ally fixed styrene fragments, and more flexible structures, cyclo- hexene derivatives 55 ± 58 and cyclopentene derivative 59, by peroxy acids shows that high diastereofacial selectivity is man- ifested only in the series of compounds 50 ± 54 (the ratio of syn- to anti-epoxides is given in parentheses). This may be explained by the conformational stability of the transition state with allowance for all factors which ensure this stability.H H Me Me 52 (15:85) 50 (1:99) 53 (50:50) 51 (1:99) But 55 (40:60) 54 (82:18) 57 (40:60) 56 (45:55) Ph But Me 58 (50:50) 59 (76:24) The regularities of epoxidation of methylene- and alkylidene- cycloalkanes have been briefly considered.64 The relative rates of epoxidation of monocyclic compounds with exo-double bonds by peracetic acid in ethyl acetate at 40 8C were determined.12 (CH2)12 Com- pound 0.21 1.12 1.1 1.0 1.95 0.62 krel Terminal double bonds in aliphatic compounds are known to be substantially less reactive than symmetrically dialkyl-substi- tuted bonds.2, 14 In the series of alicyclic compounds, the relative reactivities of exo- and endo-double bonds are substantially affected by cyclic strain.This is indicated by kinetic and activation parameters. As noted above, more strained cycloalkenes are more reactive. However, methylenecyclobutane, which has the most strained molecule in the series of its analogues, is the least reactive compound.It may be expected that the rate of epoxidation would be correlated with the HOMO energy of the alkene, calculated by a quantum-chemical method: the higher this energy, the easier the interaction between the p orbital and the sO¡O orbital of the peroxy acid. In the case of cycloalkenes, this correlation actually holds.47 In fact, EHOMO increases in parallel with the decrease in the ring size and with the enhancement of strain. In the series of methylenecycloalkanes, the opposite dependence is manifested.10 Methylenecyclohexane is epoxidised at a lower rate and with a higher activation energy than more strained methylenecyclopen- tane, although the data of photoelectron spectra indicate that they have close p-ionisation potentials. However, the low reactivity of methylenecyclobutane correlates with the fact that it has the highest ionisation potential in the series of compounds under study.10 V G Dryuk, V G Kartsev Nevertheless, the differences in the reactivity found in the series of medium rings (C4±C7) are relatively small, because in all these cases, a strained three-membered transition state is formed.Methylenecyclododecane occupies a special place in this series. Its low reactivity is inconsistent with the views on the ring strain and leads to the conclusion that the reaction rate is also influenced by the probability of effective collision of the reactant molecules, which varies depending on the size of the mole- cules.2, 10. 13 Epoxidation of alicyclic compound 60 presents interest because this compound contains both norbornene and ethylidene fragments.The reaction with monoperoxyphthalic acid affords nearly equal amounts of compounds 61 ± 63, i.e. only the exocyclic double bond is involved in the reaction.50 HX + + O O COMe Me Me Me H 60 61 63 62 HX=HOOCC6H4COOOH. The ratio of the epoxide 61 to the epoxide 62 is 1.9 after 1 h, and 0.9 after 2 h. When peracetic acid is used, this ratio does not change during the reaction and lies in the range 1.6 ± 1.7. It was found in special experiments that the ketone 63 is formed only from the oxirane 61 during oxidation by monoper- oxyphthalic acid. When peracetic acid is used, this isomerisation does not occur. This might be due to the lower acidity of the medium.Study of epoxidation of substituted methylenecyclohexanes 64 ± 68 revealed fine stereochemical features of this reaction.15, 64 ± 67 R R0 65 R 64 66 Me Me 68 67 The addition of an oxygen atom to an alkene can be directed at either axial (a) or equatorial (e) positions. Epoxide 69a in which the methylene group is equatorial is 0.6 ± 1.1 kJ mol71 thermody- namically more favourable than the product 69b. O a a O 69a (69%) +HO O b R O b 69b (31% ) The compositions of the isomeric epoxide mixtures formed from the alkenes 64 ± 68 were determined using low-temperature 1H NMR spectroscopy or stereochemical analysis of the alcohols formed upon hydride reduction of the epoxides. In the majority of cases, when peracetic, m-chloroperbenzoic and peroxyphthalic acids are used, the axial attack proved to be preferred. The inversion of the epoxidation stereochemistry was observed in the case of the alkene 68, due to the shielding of the double bond by the methyl group, and in the case where the methylenecycloalkanes 64 ± 68 were epoxidised with peroxybenz- imidic acid (C6H5CN+H2O2+KHCO3).It has been reported 61Mechanism of the directing influence of functional groups and the geometry of reactant molecules on peroxide epoxidation of alkenes that the change in the predominant direction of the attack in the latter case is due to the larger size of the peroxycarboimide group compared to the CO3H group. It should also be noted that the presence of an active proton and a basic imide nitrogen atom in the peroxyimidic acid molecule changes significantly the solvation conditions and may be the reason for the change in the optimum spatial orientation of the reactants.The predominance of the axial attack 66, 68 in the epoxidation of methylenecycloalkanes is mainly explained by hyperconjuga- tion effects. The axial attack is facilitated by some stabilisation of the transition state attained due to interaction of the a-C ±Hbond electrons with electron-deficient sites, similar to what has been observed in the epoxidation of the bicycloalkene 43. The axial attack of the oxidant predominates in the epoxida- tion of methylenenorbornane 70.64, 69 The introduction of a syn-7-methyl group in methylenenor- bornane (compound 71) results in inverted stereoselectivity.The selectivity of epoxidation of methylenenorbornane 70 is lower than that for norbornene (98%) because the double bond is further removed from the methylene bridge. H Me O O HO O HO O R R 71 (16%) 70 (88%) The increase in the size of the exocyclic group in the series =CH2<=CHMe<=CMe2 increases the rate of epoxidation by a large factor. Meanwhile, the rate of oxidation of the exocyclic double bond depends on the ring size and decreases in the order cyclohexane> cycloheptane>cyclopentane. Electrophilic addition to alicyclic alkenes is typically accom- panied by participation of neighbouring atoms and groups, in particular, by migration of C±C and C±H s bonds.70, 71 From the theoretical viewpoint, it is significant to distinguish the few cases in which the neighbouring nucleophilic groups directly participate in the transfer of active oxygen to the substrate. The nucleophilic assistance of the endo-CONH2 and endo- CH2OH groups to the epoxidation of norbornene has been considered in a review.2 Participation of this type of hydroxy group in the reaction has been noted in other studies.1, 70, 71 In particular, 5-hydroxymethylbicyclo[2.2.1]hept-2-ene reacts with perbenzoic acid 30 times faster than its methyl ether and 40 times faster than the corresponding acetate.70 Most often, however, the formation and opening of an epoxide ring in cycloalkenes occur as consecutive reactions. It is noteworthy that epoxy alcohol acetate 72 proved to be unstable on silica gel, its epoxide ring being cleaved, apparently due to participation of the neighbouring acetoxy group.Me O C Me O But H O 72 As noted above, the corresponding alcohol 14 exists in an alkaline solution of methanol in an equilibrium with its isomer. The exceptional instability of trans-2,3-epoxycyclohexanol ace- tate under conditions of epoxidation of cyclohex-2-enol with hexafluoro-2-hydroperoxypropan-2-ol has also been noted.72 Epoxycyclohexane containing a trans-benzamide group in the a-position behaves in a similar way.4 Epoxidation of 1,5-dimethylcyclooct-4-en-1-ol is accompa- nied by partial transannular cyclisation.73 191 Me Me OH Me OH MCPBA + O O OH Me Me Me(40%) (29%) The hydroxy group at the 5-position of the compound 73 has no influence on the course of epoxidation.74 However, cyclo- heptene derivatives 74 are epoxidised by m-chloroperbenzoic acid to give products of the transannular cleavage of the epoxide ring.H H R HO 73 HOOC 75 74 R=CH2OH, COOH. Epoxidation of the acid 75 of the norbornene series also affords initially the epoxy acid; however, due to the fast isomer- isation to hydroxy lactone, the acid has not been isolated. Kinetic data rule out the possibility of participation of the carboxy group in the rate-determining step of transfer of the active oxygen to the alkene,69 because the hydroxy group is more nucleophilic than the carboxy group.76 In the case of lactone 76, the cleavage of the epoxide ring during hydrolysis involves the hydroxy group rather than the carboxy group, because the latter is less nucleophilic.76 HO O H2O, H+ O COOH O O 76 Unlike norbornene, bicyclo[2.2.2]octene derivatives are epoxi- dised without exo-stereospecificity, which is due to the lower strain and the higher conformational mobility of the cage.endo-Acids and esters of the bicyclo[2.2.2]octene series 77 form endo- and exo-epoxides together with the lactones derived from the exo-isomer.76 CF3CO3H COOR COOR 77 HO O + COOR + COOR O O COOR COOR COOR O Oxidation of bicyclic imide 78 is accompanied by intramolec- ular cyclisation involving the oxygen atom of the carbonyl group,77 as has been observed for endo-amides of the norbornene series.2 In the oxidation of amide 79, the structure of the intermediate epoxide is favourable for the intramolecular cyclisa- tion involving the nitrogen atom to give an azaadamantane derivative.78 HO O MeCO3H N R O NHR O O 78 O O Ph Ph Ph HO N NH NH d+ RCO3H O O O 79192 Epoxidation of diene 80 occurs chemoselectivity according to the following scheme:79 O H Me OHMe Ph Ph O+ Ph Ph Me H Me 80 MeO MeO Ph O Ph OH OH Ph Me Me Ph During epoxidation by monoperoxyphthalic acid, tricyclic dienol 81 partially isomerises, diepoxides 82a,b being formed in a ratio of 65 : 35.80 O Me H O O O + O OH Me Me OH 82a 82b 81 Sterically hindered cumulenes, which are converted into cyclo- propanones upon a rearrangement of intermediate oxiranes, represent a peculiar system as regards epoxidation by peroxy acids.81 A probable mechanism for this reaction is shown below: O MCPBA p C C C But2C C C C C CBut2 C p But But 83 But But d+ d7 C C C O 2 p C C C p But 7 C C CBut CO + C C O But 84 RCOOH +CBut2 OOCR d+ C C C CBut2 7 C(O)CH CBut C 2 O C C CO The formation of the intermediate epoxide 83 was not detected; therefore, the isomeric ketone 84 might also arise upon disproportionation of the alkene ±RCO3H complex in the tran- sition state.IV. Mechanism of the directing influence of functional groups during epoxidation of alkenes with peroxy acids The stereodirecting influence of the hydroxy group in 2-, 3- and 4-alkenols on the attack by RCO3H has been discussed in numerous publications.1,2,6,82,83 Possible variants of the transition state geometry have been discussed. Stereochemical features of the epoxidation of cyclohex-2-enols have been considered.29 It was found that the directing influence is exerted by a pseudo-equato- rial (compound 85) rather than axial hydroxy group.29 The relationship between the rate and the route of epoxidation and the structure of cyclohexenols is clearly illustrated by the scheme given below, in which kepox6103 (perbenzoic acid, ben- zene, 5 8C) is resolved into components, kcis and ktrans, with respect to the hydroxy group.ktrans=0.30 HOH kcis=3.08 85a (66%) ktrans=0.19 H But OH kcis=4.59 6.33 It is significant that in the epoxidation ofC6±C9 cycloalkenols with m-chloroperbenzoic acid, the direction of the attack by the reagent changes on passing from seven- to eight-membered ring; the yields of cis-epoxides from the above cycloalkenols are 95.0%, 61.0%, 0.2% and 0.2%, respectively.41 When an alkyl hydro- peroxide and a vanadium catalyst are used in this reaction, the coordination of the hydroxy group to the metal is so strong that it leads to a change in the conformation and ensures the cis-attack in the two latter cases. It is notable that not only cis-cyclooct-2-enol 86 but also its methyl ether are epoxidised by RCO3H stereospecifically into the trans-position.However, the difference in the reaction rates (perbenzoic acid, benzene, 5 8C) implies active assistance from the hydroxy group of the cyclooctenol 86.29 Compound 13.7 103 kWhen cyclooctenol 86 occurs in a pseudo-chair conformation, electrophilic assistance to the peroxy acid comes, as in the case of cyclohexenol 85, from the pseudo-equatorial OHgroup; however, in epoxycyclooctanol, unlike epoxycyclohexanol, this group gets into trans-position with respect to the oxirane ring. It was suggested that the rear attack by the peroxy acid is hampered by the hydrogen atoms at C(5) and C(8), similarly to the situation observed in the epoxidation of the bicycloalkene 43 and methyl- enecyclohexane. The mechanism of interaction of the directing hydroxy group with a peroxy acid is not so unambiguous as that for alkyl hydroperoxides. It is clear that a peroxy acid is capable of forming hydrogen bonds with basic groups, including the hydroxy group.However, it is significant to elucidate not only the nature of these bonds but also the stage at which their role is manifested. On the one hand, a hydroxy group can be involved at the stage when the reactants approach each other and are coordinated; on the other hand, this group can stabilise the leaving RCO¡2 anion at the stage of decomposition of the alkene ± peroxy acid activated complex. Several schemes have been proposed describing the hydrogen bonds formed between allylic alcohols and peroxy acids, in particular, 87,2, 6 88 73 and 89.2, 78 V G Dryuk, V G Kartsev OH H 85b (34%) kcis=0.56 OH But H ktrans=0.11 H OMe 0.42 6 4 5 7 OMe (86) 1 OH 3 8 H 2 H HOOOCR 0.78 11.4Mechanism of the directing influence of functional groups and the geometry of reactant molecules on peroxide epoxidation of alkenes R R C C O O O O R HO O C H H H O O H(R) O O O HO CH2 CH2 CH2 C C C C C C 89 88 87 Evaluation of the relative strengths of the hydrogen bonds and stereoelectronic analysis of the structures 87 ± 89 lead to several conclusions. In conformity with the views on the acid ± base properties of the reaction participants, the strength of the hydro- gen bond must substantially decrease in the sequence 89 > 88 > 87.Moreover, the formation of a hydrogen bond between an allylic hydroxy group and anRCO3Hmolecule in the ground state according to the associate 87 pattern is relatively unlikely, because the p electrons of the O(2) atom are involved in conjugation and are difficult to displace. In addition, the corresponding n orbitals are arranged at an angle relative to the O±H bond of the alcohol. When the associates 88 and 89 are formed, the reaction sites (pbondingC±C and santibonding O¡O) are too far removed from each other for the epoxidation proper to occur. This rules out partic- ipation of the hydroxy group directly in the step of transfer of the active oxygen to the alkene. The problem of efficiency of the directing action of the hydroxy group at the stage when the reactants approach each other was solved based on the data on epoxidation of cyclohexene containing an axial OR group (R=Me, Bz) in the allylic position.74 It was found that when m-chloroperbenzoic acid is used as the oxidant, the hydrogen bond formed between the acid and the OR group, similar to that in 89, is not sufficiently strong to exert a syn- directing influence; steric effects of the OR groups induce pre- dominantly anti-epoxidation.Only replacement of m-chloroper- benzoic acid by CF3COOOH, which is the strongest peroxy acid having a relatively high pKa value, results in syn-epoxidation. This mechanism for the assistance by the OR group is supported by the fact that replacement of the inert solvent (CH2Cl2) by a basic solvent (THF) capable of solvating CF3COOOH changes the stereochemical outcome of epoxidation, which yields predomi- nantly the anti-isomer.The hypothesis that the reactants approach each other through the formation of species like 87 and 88 seems even less likely. a O C R 7 R C O O H H O H O H O CH2 O + CH2 C C 90 b c dO O O H H CR CR CR O O H H H O O O CH2 CH2 O H CH2 Figure 3. Activated complex 90 formed in the oxidation of allylic alcohols by peroxy acids; (a, b, c, d ) are the Newman projections. 193 Orbital consideration and quantum-chemical calculations2, 84 allow the conclusion that the directing influence of a hydroxy group is due to the interaction of the leaving anion of the acid with the hydrogen atom of the hydroxy group during decomposition of the activated complex 90 (Fig.3). It can be seen from Fig. 3 that in this case we are dealing not with a classical hydrogen bond, formed as a hydrogen bridge between two proton acceptors, but with interaction of the proton with a delocalised negative charge in a fairly polarised intermedi- ate complex. When constructing Newman projections a ± d for the transition state 90,we assumed that any of the two p-electron pairs of the active oxygen atom can participate in the formation of the oxirane ring. Analysis of projections a ± d with allowance for the Curtin ± Hammett principle demonstrates that structures b and d are the most favourable. The actual occurrence of structure b is confirmed by a comparison of the epoxidation mechanism with the closely related mechanism of aziridination of cyclohex-2-enol by 3-acet- oxyamino-2-ethylquinazolone.85 The latter reacts more stereo- and regioselectively than peroxy acids.In our opinion, this is due to the more rigorous steric requirements imposed on the transition state. Unlike the peroxide oxygen atom in RCO3H, nitrogen carries two substituents. This appreciably hampers the electro- philic attack on the alkene and makes it more strictly directed. In addition, the nitrogen atom has only one pair of p electrons. As a result, the optimum orientation of the reactants is attained only in structure 91 (Fig. 4), in which the bulkiest substituents occupy transoid positions and the NH group proton deflects from the plane of the O±C=O fragment. Me C O 7 O H O H CR O H N CH2 N O HCH2 R+ C C R 91 Figure 4.Activated complex 91 and its Newman projection for aziridi- nation of cyclohex-2-enol with 3-acetoxyamino-2-ethylquinazolone Et N R= N . O The transoid species d, which is energetically even more favourable, is sterically less strained than structure b; its acid proton participates in the stabilisation of the leaving RCO¡2 anion through interaction with both p-electron pairs of the O(2) atom. In structures b and d (Fig. 3) and 91 (Fig. 4), the allylic hydroxy group and the carboxy group are optimally removed from each other. The close arrangement of the hydroxy and carboxy groups in the energetically unfavourable eclipsed conformation a diminishes or even completely rules out the possibility for assistance of the hydroxy group to the leaving RCO¡2 anion; in the case of planar structure c, the allylic hydroxy group is removed too far from the leaving anion.The syn-directing effect is manifested in epoxidation of not only alkenols but also unsaturated carboxylic acids,86, 87 amides,88, 89 urethanes, urea derivatives,6, 90 acetals, sulfones, sulfoxides,6 sulfamides 91 and ketones of the aliphatic and aro- matic series.92 In some cases, concerted or competing action of two groups has been observed.6, 89, 90194 Several variants have been considered for the mechanism of the directing influence of some groups, for example, those involv- ing the formation of structures 92,89 93 90 and 94 ± 96.6 Ar Ar O O O H O H O O H O H O N N R R 92 93 Ar O OO H O PhCH2O HN O N 95 Kocovsky and Stary,6 who studied a broad range of unsatu- rated (allylic and homoallylic) carbamates, amides, urethanes and esters, in particular, cyclohexene (97, 98) and cyclopentene (99) derivatives and steroid type compounds 100 ± 105, including those differing in the position of the double bond, concluded that the stereodirecting influence exerted by the functional groups present in these substrates is due to involvement of the carbonyl oxygen atom, which carries the highest electron density into the hydrogen bond (see structure 95).NHCOOR3 OCONR1R2 97 98 R1=H, Me; R2=Me, CH2Ph (97); R3=Alk, NH2, EtO (98). RO RO H 101 100a,b RO H H RO 103 104 R=PhCH2NHCO (100a, 101, 102); R=Me2NCO (100b, 103, 104). The lower basicity of the carbonyl oxygen atom in esters compared to that in amides or carbamates accounts for the lower stereoselectivity of their epoxidation; however, syn-epoxidation of dimethyl trans-1,2-dihydrophthalate occurs to more than 90%.93 The assumption that it is the carbonyl group that participates in the reaction was confirmed by the IR spectroscopy data obtained for trans- (106) and cis-hydroxy amides (107) used as model compounds. In the latter case, it was found that no intramolecular hydrogen bond is formed. Ar O O O H O O N 94 Ar O C H O O O HO H96 OCONHCH2Ph 99 O RO H 102 OH O O O H 105 V G Dryuk, V G Kartsev OH O H O O NH NH Me Me 106 107 The directing influence of the carbonyl oxygen atom in the type 95 transition state, unlike that of the hydroxy group in the transition state 90, appears most likely at the stage of coordination of the reactants.The two mechanisms acting through the tran- sition states 90 and 95 are based on the formation of a hydrogen bond; however, they differ significantly regarding the stereo- chemical features and, hence, the general substrate selectivity. Thus allylic alcohol 101 (R = H) is converted into a mixture of cis- and trans-epoxy alcohols in a ratio of 3 : 1, whereas in the case of the corresponding N-benzylcarbamate, cis-epoxidation is pre- vented by the spatial shielding of the b-side, trans-epoxide 102 and compound 105, resulting from intramolecular opening of the epoxide ring, being isolated as the major reaction products.Carbamates 103 and 104, like the corresponding alcohols (R = H), are mainly converted into trans-epoxides. The mere replacement of the benzyl group in the structure 100 by a phenyl group or the introduction of an additional substituent, for example, a methoxy group, into the carbamate 104 can result in the reversed stereoselectivity.94 The N-ethylacetamide prevents epoxidation of amide 108, which is consistent with the data reported in another publication.95 However, the acetamide group in the molecule 109 exerts a syn-directing influence exceeding that of a hydroxy group.6 MeCON MeCON 108 Et H 109 The competition of the acetamide and hydroxy groups 78 in amide 110 also results in the predominance of the stereodirecting influence of the former.87 OH OH PhCO3H NHCOMe HO NHCOMe HO 110 O The distant acetamide and allylic hydroxy groups in the molecule of acid 111 exert a concerted influence.96 OH OH MCPBA O HOOC HOOC H NHAc H NHAc 111 The trialkylsilyloxy group in cis-cyclohexylcarbamate 112 stipulates the trans-attack by a peroxy acid.The reaction product undergoes partial intramolecular cyclisation.97 OSiMe2But MCPBA NHCOOCH2Ph 112 HO OSiMe2But OSiMe2But O + NH O NHCOOCH2Ph (54%) (6%) OMechanism of the directing influence of functional groups and the geometry of reactant molecules on peroxide epoxidation of alkenes Acyclic allyl Z-amides 113 are epoxidised by peroxy acids and tert-butyl hydroperoxide in the presence of Mo(CO)6 with a high threo-selectivity (75% ± 95%).87 The corresponding E-isomers are less sensitive to this reagent and to the influence of the amide group, the yield of the threo-isomer amounting to 60%± 78%.The general regularity is violated in the case of amides 114. The low stereoselectivity of the reaction, in which the erythro-isomers slightly predominate in the reaction products, is apparently due to the unfavourable structure of the major conformation, which is fixed by an intramolecular hydrogen bond.In the case of amide 115, participation of the carbonyl group in the orienting influence is relatively unlikely; nevertheless, the stereoselectivity of epox- idation is fairly high. This is apparently accounted for by the directing influence of theNHgroup, which has been postulated by Davies and Whitham.87 This type of electrophilic assistance to the epoxidising agent is also preferable for the toluenesulfamide group.88 NHCOR H COR HN H N O Ph O Me MeO Me H Me 113 114 115 R=CCl3, Ph, OMe, NHPh. An a-carboxy group exerts a strong orienting influence on the attack by RCO3H. Oxidation of both trans-1,2-dihydrophthalic acid and dimethyl trans-1,2-dihydrophthalate affords only mono- and diepoxides with cis-arrangement of the neighbouring epoxy and carboxy groups even in a basic solvent (ethyl acetate), 86 capable of solvating carboxy groups.It still remains unclear how the carboxy groups affect the course of the process, either similarly to a homoallylic hydroxy group or in accordance with the transition state 95. O COOH COOH COOH MCPBA MCPBA COOH COOH COOH O O The syn-stereoselectivity of epoxidation of trans-5-tert-butyl- cyclohex-2-enecarboxylic acid in inert solvents is not very high (54% ± 79%). Meanwhile, the epoxidation of the corresponding methyl ester affords predominantly the trans-isomer irrespective of the solvent used.98 Apparently, the tert-butyl substituent diminishes the coordination mobility of the ring and hampers the formation of the conformation optimum for the carbonyl group to be involved in the active oxygen transfer.It has been reported 92 that the carbonyl group in a,b- unsaturated steroid ketones 116 ± 119 and dienone 120 influences the rate and regioselectivity of their epoxidation by MCPBA via the formation of a hydrogen bond. O O O O 116 117 118 119 O O O 122 O O 121 120 195 The mere fact that these compounds do undergo epoxidation seems quite unexpected, because the double bond conjugated with a carbonyl group is usually inert to peroxy acids. Moreover, when the dienone 120 is oxidised in a non-polar solvent (benzene), the epoxidation involves the a,b-double bond rather then the remote double bond. In a polar solvent (acetonitrile), the efficiency of participation of the carbonyl group of the ketone 120 in the formation of the hydrogen bond decreases, the yields of the isomeric monoepoxides 121 and 121 becoming comparable.The S-cis-ketones 116 and 117 react with an oxidant faster and give the oxiranes in higher yields (63% and 51%) than the S-trans-isomers 118 and 119 (the yields of the corresponding oxiranes are 8% and 27%). In this connection, it is pertinent to consider the possible epoxidation mechanisms. Stereoelectronic analysis shows that in this reaction, there are no stereochemical prerequisites for the mechanism based on the transition state 95. The RCO3H mole- cule, associated with the carbonyl group through a hydrogen bond, is unable to attack the p electrons of the alkenyl fragment.Therefore, if the classical epoxidation mechanism is realised, the carbonyl group of a cycloenone can render assistance only at the stage when the reactants approach each other, thus increasing the probability of their efficient collision. However, epoxidation of the ketone 116 affords a- and b-oxiranes in comparable amounts, although, by analogy with the epoxidation of the methylenebicy- cloalkane 68 and alkyl-substituted cycloalkenes,6, 15 one could have expected that the methyl substituent would shield the b-side and promote the formation of the a-isomer. + O O O a (28%) O O b (35%) 116 The geometry of the molecules of the cycloenones 116, 117 and 120 and the whole set of the available experimental data suggest that the process follows a mechanism including a nucleophilic attack on the antibonding pC¡C orbital and 1,4-addition of RCO3H.7RCO2H O O O O O O H O O H R O R O The structure of the S-trans-isomers 118 and 119 excludes the possibility of a similar synchronous nucleophilic addition of RCO3H. In addition, the formation of only a-oxirane (27%) from the ketone 119 is evidence supporting the ordinary epox- idation mechanism, which assumes the electrophilic attack by the peroxy acid on the less shielded side of the double bond. A fairly unusual effect of the nature of the solvent on the stereochemistry of epoxidation of 2-hydroxycyclopent-4-enylace- tolactone has been observed.99 O O O MeCO3H O O O + O O The ratio of the cis to trans isomers in the resulting epoxides changes from 8.1 in acetic acid and 4.0 in hexane to 0.89 in benzene and 0.67 in CCl4.Since the carbonyl oxygen atom in the lactone is far removed from the double bond, its association with the peroxy acid molecule cannot influence significantly the epoxidation route. Apparently, solvation of the ester group, which determines the character of shielding of the double bond and the conforma- tional stability of the diastereoisomeric transition states, is the196 crucial factor governing the stereochemical outcome of the reaction. The pronounced difference between the reaction out- comes in inert solvents, for example, in hexane and benzene, indicates that the process stereochemistry depends substantially on the structural features of the solvent cage.A similar type of dependence of the enantioselectivity on the solvent nature is displayed in the epoxidation of a number of cyclohexene derivatives by dimethyldioxirane.4 It might be this factor that is responsible for the enantioselectivity of some enzyme-catalysed reactions 98 and for the difference between the yields of glycols in epoxidation of diallyl dicarboxylates 13 and phenylcyclohexene 62 in solvents with close basicities � tetra- hydrofuran and diethyl ether. V. Complementarity of reactants as a factor of stereodirected epoxidation As shown above, the presence in the alkene of a functional group capable of association with an epoxidising agent (ROOH, RCO3H) is not always a sufficient condition for an efficient directing influence.Spatial compatibility of the reactants favour- able for the reaction is also needed. This is ensured, on the one hand, by an appropriate molecular geometry and the environment of the reaction sites and, on the other hand, by a coplanar arrangement of the vacant and occupied orbitals which overlap during the reaction (stereoelectronic factor). In cycloalkenes and, especially, in polycycloalkenes, the optimum direction of the attack by the oxidant is provided bthe rigidly fixed structure of the carbon framework.8, 64 In alkenes, which are normally characterised by relatively low barriers to the rotation around s bonds, stereodirected epoxida- tion can be attained in those cases where the two diastereoisomeric transition states of the reaction have substantially different energies.According to the Curtin ± Hammett principle, the reac- tion proceeds via the more favourable transition state. This transition state often arises upon transformation of the most stable conformation with a transoid arrangement of the bulkiest substituents. The simultaneous influence of bulky groups such as SiR3 or OSiR3 and the corresponding functional group results in a single diastereoisomer being formed in an almost quantitative yield.42, 100 Only one diastereoisomer is produced, for example, in the epoxidation of amide 123,101 which contains a bulky sulfonyl group in addition to the directing amide group.HNCOCCl3 HNCOCCl3 O Me Me SO2Ph SO2Ph 123 In some cases, the stereoselectivity of the reaction can be ensured without the formation of a hydrogen bond with the peroxy acid but only due to the ordinary spatial shielding of one side of the p bond by bulky groups such as SiR3 in a fixed conformation of the alkene.42 This can account for the erythro- selectivity of epoxidation of alkenylphosphonates.102 The bulky phosphonate group and the peroxy acid occupy transoid positions in the transition state 124 formed in this reaction. H R1COO OH R3 R2 124 P(O)(OEt)2 The factors that govern the mutual arrangement of the reactants in space can be judged from a comparison of the stereochemical outcome of epoxidation of alkenes by peroxy acids and by hexafluoro-2-hydroperoxypropan-2-ol 125.72 Whereas cyclohex-2-enol reacts with m-chloroperbenzoic acid to give cis- and trans-epoxycyclohexanols in 93 : 7 ratio, the reaction V G Dryuk, V G Kartsev with hydroperoxide 125 yields only the cis-isomer.Furthermore, on treatment with the hydroperoxide 125, cyclohex-2-en-1-ol acetate is converted into the corresponding cis-epoxide by 80%, whereas the use of m-chloroperbenzoic acid results in a mixture of cis- and trans-isomers of epoxycyclohexyl acetate in a ratio of 2 : 3. Hexafluoro-2-hydroperoxypropan-2-ol oxidises bicyclic diene 126 to give only one monoepoxide. Other oxidants, namely, peroxy acids, ROOH± Cat and singlet oxygen combined with trimethyl phosphite, react with the diene 126 to give all four isomers of monooxirane.CH2OCH2Ph CH2OCH2Ph O O + (CF3)2C(OH)OOH 125 O O O 126 (90%) The specific behaviour of the hydroperoxide 125 can be explained by the fact that its molecule, unlike RCO3H, is tetrahe- dral, the hydroperoxide group occupying a vertex of the tetrahe- dron which has two bulky trifluoromethyl groups at the base (Fig. 5). Shielding of the peroxide site restricts the sphere of the attack on the alkene and imposes stringent steric requirements on the transition state caused by the torsional strain between the substituents in the hydroperoxide and the alkene. b a CF3OH CF3OH F3C F3C C C R1 H HR3 O O R1 R2 R2 125 R3 Figure 5. Newman projections of the transition state formed in the oxidation of alkenols with hexafluoro-2-hydroperoxypropan-2-ol (125); (a) spiro structure; (b) eclipsed conformation.Of the two transition state structures a and b (see Fig. 5), possible due to the presence of two lone electron pairs at the active oxygen atom, spiro structure a is preferred, in which the pseudo- axial electron pair in relation to the five-membered chelate ring of the hydroperoxide participates in ring formation. Epoxidation of the cycloalkene 126 involves the double bond removed further from the benzyloxymethyl substituent. The syn- orientation of the oxidant with respect to the substituent ensures the formation of the most favourable transoid conformation of the transition state (Fig. 6 a). The anti-orientation would result in gauche-conformation (Fig.6 b). a b CF3OH F3C C CF3OH F3C C H O H O O H2C O O BnO CH2 OBn O Figure 6. Newman projections of the transition state formed in the oxidation of the diene 126 by hexafluoro-2-hydroperoxypropan-2-ol (125); (a) transoid conformation; (b) gauche conformation.Mechanism of the directing influence of functional groups and the geometry of reactant molecules on peroxide epoxidation of alkenes CF3OH F3C CF3OH F3C C Ca b OC O H O H H MeCOO O O OOCMe Figure 7. Newman projections (a and b) of the transition state formed in the oxidation of cyclohex-2-enol acetate with hexafluoro-2-hydroperox- ypropan-2-ol (125). From this standpoint, it becomes clear why acylated cyclohex- 2-enol is converted into the syn-epoxide.Evidently, conformation a is more stable than conformation b (Fig. 7). Epoxidation of the same alkene by a peroxy acid affords mostly the anti-epoxide. When cyclohex-2-enol is epoxidised by hexafluoro-2-hydroperoxypropan-2-ol, the role of complemen- tarity is enhanced by the directing influence of the hydroxy group, thus making this reagent more selective than peroxy acids. The stereochemistry of the epoxidation of alkenes by a-hydro- peroxides 127 and a-hydroperoxy nitriles 128 has been described in reviews.1,2 X N R1 C O R1 C C H H C O O R2 O O R2 127 128 R1=Me, R2=Ph; X=OR3, NR2, Alk. The hydroxy group in cyclohex-2-enol has a syn-directing influence on epoxidation.However, unlike peroxy acids, the hydroperoxide 127 (X = OR) oxidises trans-stilbene more easily than cis-stilbene and oxidises trans-b-methylstyrene more easily than cyclohexene. Interpretation of the trans-selectivity should be sought in a comparison of the electronic and steric features of the transfer of active oxygen from the hydroperoxide 127 to the alkene with those for peroxy acids. The latter are known to be characterised by low energies of the O±O bond and high mobility of the OOH-group proton. TheRCO3H± alkene transition state is extended along the reaction coordinate, and, in conformity with the Bell ± Evans ± Polanyi principle, its structure is closer to the final products than to the initial compounds. This means that loosening of the per- oxide bond in RCO3H starts at an early stage of insertion of the alkene p orbital into the antibonding sO¡O orbital before the O± H bond is cleaved.The proton transfer does not limit the overall rate of the process.1, 2 In addition, in the case of peroxy acids, there is no torsional strain, involved in the transition state with hexa- fluoro-2-hydroperoxypropan-2-ol and the hydroperoxides 127. This accounts for the low sensitivity of theRCO3Hmolecule to the alkene structure; the cis-alkene is epoxidised slightly more readily than the trans-isomer,14 which can be easily explained by the higher thermodynamic stability of the latter isomer. Regarding the a-hydroperoxides 127, it should be noted that they are several orders of magnitude weaker oxidants than peroxy acids.2 The peroxide proton in the hydroperoxides 127 is substan- tially less active than that in RCO3H.Therefore, the a-hydro- peroxide ± alkene transition state 129 is compact and the intramolecular proton transfer on the leaving alkoxy anion is necessarily included in the step determining the overall rate of the process (Fig. 8). This, in turn, places certain steric demands on the orientation of theOHgroup in the hydroperoxide 127. On the one hand, this group tends to be coplanar with the axial lone electron pair of the neighbouring peroxide oxygen atom and, on the other hand, it tends to escape the eclipsed position with respect to the 197 R4 R1 H O R2 X O R1C C R3 1 C R3 R4 X R2 2 C p 129 Figure 8.Transition state 129 formed in the oxidation of alkenes by the hydroperoxide 127 and its Newman projection: (1) equatorial lone pair of the oxygen atom; (2) axial lone pair of the oxygen atom. bulky substituents at the alkene double bond. These requirements are satisfied in the case where the coplanar alkene p bond and chelated hydroperoxide molecule approach each other with theR3 substituent of the alkene being removed from the eclipsed position with respect to the OH group (under the p-bond plane) and the R4 substituent being located above the plane. This determines the trans-selectivity of the reaction. In the case of cis-alkene, the substituents R3 and R4 should be directed below the plane of the chelated hydroperoxide; this increases the strain in the transition state due to the interaction of these groups withR2.If the transition state had a spiro structure in which the alkene p plane passed through the na orbital of the active oxygen atom, the shift of the proton into the axial position and its interaction with the leaving alkoxy anion would be hampered. In this connection, it is noteworthy that the transition state formed in the epoxidation of alkenes by hexafluoro-2- hydroperoxypropan-2-ol 125 has a spiro structure (see Fig. 6 a). In this case, the problem of the proton transfer to the leaving alkoxy anion is eliminated because the process is synchronous. The complementarity factor, which determines the direction of the attack on the electrophilic site of the alkene, becomes significant when substituted oxaziridines are used as epoxidising agents.103 ± 107 Diastereoisomeric 2-sulfonyloxaziridines 130 ± 132 epoxidise alkenes containing no directing functional groups with higher enantioselectivity (ee 12%± 65%) than chiral peroxy acids and hydroperoxides (ee 0%± 8%).N ArSO2N CHAr 0 ArSO2N CR2 O O O 130 SO2 132 131 Based on kinetic and thermodynamic parameters, correlation analysis of the effects of substituents present in the phenyl groups of oxaziridines, a synchronous mechanism of epoxidation of alkenes including transition state 133 has been proposed. In accordance with this mechanism, the oxaziridine ring and the p bond are coplanar, the process stereochemistry being controlled by the configuration of substituents.104 ± 107 C NSO2Ar O C CHAr 0 133 Similar conclusions have been drawn from quantum-chemical calculations.108 Experimental data cited above 103 ± 107 can be interpreted in a different way by invoking general theoretical views on the stereoelectronic features of reactions of this type, in particular, epoxidation of alkenes by hydroperoxides 1, 2, 5 and dioxiranes.4, 109, 110 The oxidising capacity of oxaziridines is due most of all to the N±O bond, which is similar to the peroxide bond.The nitrogen atom is less electronegative than oxygen but the EN±O value in the oxaziridines 130 ± 132 decreases owing to the strong electron-198 withdrawing influence of the SO2 group. The difference between the O¡ÀN and O¡ÀC bond energies results in the loosening and rupture of the O¡ÀN bond at the stage of oxygen transfer to the substrate occurring somewhat ahead of the O¡ÀC bond cleavage.The asynchronous cleavage of bonds is apparently a general feature of small rings similar to oxaziridine, in particular, dioxir- ane and dioxetane. The nucleophilic attack by the alkene p electrons on the oxygen atom of the oxaziridine ring is directed at the antibonding orbital of the O¡ÀN bond along its axis (transition state 134, Fig. 9). In the initial interaction event, transfer of the p-electron density on the oxygen atom loosens the N¡ÀO bond and, simulta- neously, the axial lone electron pair of oxygen na interacts with the p orbital of the alkene.As in the case of hydroperoxides, the combination of two types of interaction D donor-acceptor and dative interactionDis a necessary condition for the synchronous formation of the C¡ÀO bonds in the oxirane ring. 6 1 5 Ar 0 N H Ar 0 H O Ar SO2 4 H R0 H 2 H O 3 R Cp R0 C SO2Ar H R 134 Figure 9. Transition state 134 formed in the epoxidation of alkenes with ozxaziridines and its Newman projection; (1) sN¡¦O; (2) equatorial lone pair of the oxygen atom(ne); (3) sN¡¦O; (4) p*; (5) sC¡¦O; (6) axial lone pair of the oxygen atom (na). The localisation of excess electron density at the nitrogen atom creates conditions for the overlap of the partially occupied sN¡¦O orbital (or the nitrogen n orbital) with the vacant sC¡¦O orbital, which, in turn, induces loosening of the C¡ÀO bond.It is clear that the angle between the attack on the alkene p bond and the plane of the oxaziridine ring is about 1808 ¡À 1098 = 718, the most significant restrictions hampering the approach of the reactants and construction of the transition state being caused by the carbon atom and its substituents rather than by the substituents at the nitrogen atom in the epoxidising agent. Therefore, the epoxidation transition state 134 in which the ring formation involves the cis-alkene and the axial lone electron pair of oxygen seems to be the least sterically hindered. b a H(R1) Ar 0 H(R1) Ar 0 C C R2 R2 O O R3 R3 SO2Ar SO2Ar c d H(R1) Ar 0 H(R1) Ar 0 C CR3 R3 O O R2 R2 SO2Ar SO2Ar Figure 10.Newman projections (a ¡À d) of the transition state of epoxida- tion of trans-alkenes with sulfonyloxaziridines. V G Dryuk, V G Kartsev The best transition state for the epoxidation of trans-alkenes should be chosen out of the four possible structures a ¡À d (Fig. 10) (in the Newman projections, the observer looks along the O¡ÀN bond from the side of the alkene attack). Analysis of the stereochemical outcome of epoxidation of trans-stilbene with (R,R)-(+)-sulfonyloxaziridines 135a ¡À d shows that the (R,R)-(+)-oxirane is formed with ee 34.9%. Hence, the reaction occurs mainly via transition state a. Indeed, transition state b is sterically much more strained and transition states c and d would lead to the (S,S)-oxirane. R C6H4NO2-p N C S O NO H O PhSO2 O 136 135a ¡À d R=Me (a), Bun (b), Bui (c), But (d).Our conclusions are also consistent with other experimental data.105 ¡À 108 Thus epoxidation of (R)-(+)-limonene by sterically shielded oxaziridine 135a is 20.7 times slower than that by oxaziridine 136.104 This reaction is fairly cis-selective (60% ¡À 74%), the selectivity increasing with an increase in the size of the group R. 135a + O O trans cis Note for comparison that oxidation of limonene by m-chlor- operbenzoic acid yields the isomers in 1 : 1 ratio. It is also noteworthy that the rates of limonene epoxidation by the oxazir- idines 135a ¡À c are related as 1 : 0.93 : 0.3, and the compound 135d barely enters into this reaction. The replacement of the oxaziridine 136 by its analogue containing a nitro group in the ortho-position rather than in the para-position decreases the rate of epoxidation of 1-methylcyclo- hexene by a factor of more than 6.107 To summarise the foregoing, we can conclude that the reaction in question occurs by an SN-type mechanism assuming the formation of a spiro transition state.The fact that the bonds in the oxaziridine ring are cleaved asynchronously induces some charge separation. The negative charge on the nitrogen atom is highly delocalised due to the electron-withdrawing influence of the SO2 group. The buffer function of this group markedly decreases the sensitivity of the reaction to the polar influence of the substituent X in the XC6H4SO2 group.Hence, the Hammett constants of the reaction (r) found upon variation of substituents in the benzene nucleus at the carbon atom and in the sulfamide moiety of the sulfooxaziridine molecule are nearly equal and amount to 1.07 and 1.09, respectively. Dioxiranes are very close to oxaziridines regarding the char- acter of their reactions with alkenes.4, 109, 110 In the case of dimethyldioxirane, the reaction is highly sensitive to steric restric- tions caused by the interaction of the methyl groups with the substituents at the double bond. Branched alkenes, trans-4,4- dimethylpent-2-ene and trans-2,2,5,5-tetramethylhex-3-ene, are epoxidised much more slowly than trans-hex-3-ene. In the series of ordinary dialkyl-substituted alkenes, cis-isomers are an order of magnitude more reactive than the corresponding trans-alkenes. Based on the kinetic and thermodynamic parameters, it was concluded that the reaction proceeds via a bimolecular complex having a spiro structure.110 O¡¦O By analogy with the transition state 134, it can be assumed that the attack by the alkene is directed at the antibonding s orbital of the dioxirane along the peroxide bond, the p-electron plane passing through the pseudo-axial non-bonding orbital of oxygen as has been shown in the structure 137 (Fig.11).Mechanism of the directing influence of functional groups and the geometry of reactant molecules on peroxide epoxidation of alkenes Me Me Me C O CH Me O H O H R0 R0 1 H O 2 C R p C H R 137 Figure 11.Transition state 137 formed in the epoxidation of alkenes with dioxiranes and its Newman projection; (1) ne of oxygen, (2) sO¡N. The loosening and rupture of theO±Obond in dioxirane at an initial stage of its reaction with the alkene occurs ahead of the C±O bond cleavage, a partial negative charge being created on the leaving oxygen atom. Unlike oxaziridine, dioxirane is unable to delocalise the excess charge and in the transition state 137, the leaving anion is solvated, which is typical of the SN-type reactions. It is due to this fact that the allylic hydroxy group has a directing influence on the oxidant during epoxidation of cyclohex-2-enol.4 It has also been found that admixtures of water in acetone catalyse the process.109 The decrease in the effect of water admixtures in the case of epoxidation of low-reactivity alkenes by dioxiranes is, apparently, due, as in the case of epoxidation by peroxy acids,1, 2 to the ability of the oxidant to undergo self-oxidation to give singlet oxygen in media favourable for the formation of hydrogen bonds.Reactive alkenes normally suppress decomposition of the epoxidising agent thus increasing the rate of formation and the yield of oxiranes. Chiral dioxiranes, prepared from chiral ketones and oxone (KHSO5), epoxidise alkenes with a substantial asym- metric induction (up to 87%).111 Correlation analysis and thermodynamic parameters point to a common character of electron density distribution in the transition states formed when dioxiranes, oxaziridines and peroxy acids are used as epoxidising agents.Epoxidation of di-, tri- and tetrasubstituted alkenes by dimethyl-a-peroxy lactone 138, the structure of which is similar to that of dimethyldioxirane, is controlled by absolutely different stereochemical factors. First, attention is attracted by the high trans-selectivity of epoxidation by peroxy lactone 138. cis-But-2-ene is virtually not epoxidised; instead, it is converted into cycloaddition product 139. However, trans-but-2-ene is transformed only into the epoxide. As the number of alkyl substituents at the double bond increases, the overall rate of the process increases, indicating that the alkene acts in this reaction as a nucleophile.Simultaneously, the contribution of cycloaddition, which is known to be highly sensitive to steric restrictions, diminishes. In the case of tetraalkyl-substituted alkenes, cycloaddition hardly occurs. Yet another characteristic feature of this process is the relatively high polarity of the intermediate complex. This is indicated by the fact that it can be efficiently neutralised by methanol, acting as a carbocation trap. The formation of the oxirane ring implies a concerted mech- anism for the electron density redistribution in transition state 140, which, judging from experimental data, is conformationally stable only for trans-alkene, as in the epoxidation of a,b-unsatu- rated carbonyl compounds 4.112 Me R3 O R1 Me + O O R4 R2 138 199 O O R1 R2 a Me R3 R1 O Me + O O R4139 O7 R2 O CH2 R3 R4 Me Me O b OH R2 R3 R4 Me Me O O Me O 7 Me Me O O O Me Me O Me O + + R3 R1 R3 R1 O R3 R1 R4 R2 R4 R2 R4 R2 140 (a) Cycloaddition; (b) ene reaction, R1=Me.It turns out that the cis-orientation of substituents in the alkene, which is favourable for the reactants to come together, prevents the formation of a planar, conformationally stable transition state 140 with delocalised charges. In this case, zwit- ter-ionic transition state 141 with sterically non-hindered rotation around the s-bonds, needed for 1,4-dioxane ring closure, becomes more preferable. O O O O 7 Me Me O Me 139 Me R3 R4 R4 R3 O + p R1 R2 R2 R1 141 The principle of complementarity of reactants underlies the asymmetric epoxidation of simple, non-functionalised alkenes by oxometal complexes containing Schiff's bases, porphyrins or other oxygen- and nitrogen-containing compounds as ligands.112 ± 114 The geometry of the environment of the reaction site determines the predominant orientation of the prochiral alkene at the stage when the reactants approach each other. For example, epoxidation of a number of alkenes with an oxygenated manganese complex gives the corresponding oxiranes in very high optical yields (92% ± 98%).112 However, detailed consideration of reactions of this type is beyond the scope of our review.VI. Conclusion Conformational analysis of the diastereoisomeric transition states (TS) with allowance for the stereoorbital conditions for the closure to give an oxirane ring is an efficient method for sub- stantiation and prediction of the route and the stereochemical outcome of epoxidation of alkenes with various peroxide reagents.The integral stereocontrolling factor in these reactions is the conformational stability of the TS, which is determined, in its turn, by the spatial compatibility (complementarity) of the reac- tants, torsional strain, influence of the neighbouring functional groups, hyperconjugation and other effects.200 The directing influence of allylic and homoallylic hydroxy groups in the case of alkyl hydroperoxides, which require metal complex catalysis, is attained at the stage of construction of a multiligand complex and the formation of a donor-acceptor bond between the OH group and the central atom.When epoxidation is carried out by an epoxy acid, the role of these groups is to stabilise the carboxylate anion, which is eliminated at the stage of decom- position of the transition state, whereas carbonyl groups in alkenyl-containing amides, esters, carbamates and urethanes exert a similar stereoeffect due to the formation of a hydrogen bond with RCO3H at the stage of coming together and coordina- tion of the reactants. Epoxidation of a,b-unsaturated S-cis-ketones of the steroid type occurs apparently by a non-classical mechanism assuming 1,4-addition of the peroxy acid. The stereochemistry of the non-catalysed epoxidation involv- ing active alkyl hydroperoxides is largely determined by the formation of more compact transition states than those in the case of peroxy acids and by the substituents attached to the sp3 hybridised carbon atom of the C±OOH group.Some general regularities of the formation of planar transition states and spiro structures were established. The spiro type TS, which are less sterically strained, are formed in the epoxidation of alkenes with RCO3H and (CF3)2C(OH)OOH. Under these con- ditions, the stage of transfer of the active oxygen to the substrate does not depend on the rate of proton transfer. Meanwhile, the epoxidation of alkenes with a-hydroperoxy-derivatives of esters is controlled by the transfer of the OOH group proton on the axial pair of p electrons of the neighbouring oxygen atom.The orientation of molecular orbitals participating in this process induces the formation of a planar transition state and requires a transoid configuration of the alkene molecule. trans-Selectivity is also typical of other epoxidation reactions involving the formation of planar TS, in particular, those using dimethyl-a-peroxy lactone as the epoxidising reagent and in the alkaline alkyl-peroxide oxidation of a,b-unsaturated esters. In the latter case, the reaction occurs stereoselectively because of the two possible conformations of the cyclic transition state, the more stable conformation with an equatorial orientation of the bulkiest substituent in the alkene molecule is formed preferentially.cis-Selectivity is an indication of a spiro configuration of the compact transition states formed in epoxidation of alkenes with oxaziridines and dimethyldioxirane. The process stereochemistry is controlled by the substituents at the carbon atom in these heterocycles; in the case of oxaziridines, this ensures a fairly high enantioselectivity. The overall effect of various types of strain in cycloalkenes and methylenecycloalkanes stipulates the predominance of the epox- idation pathway that relieves the strain in cycloalkene and results in the formation of the transition state and the oxirane with the least conformation distortion. References 1. V G Dryuk Usp. Khim. 54 1674 (1985) [Russ.Chem. Rev. 54 986 (1985)] 2. E A Blyumberg, T V Filippova, V G Dryuk, in Kinetika i Kataliz (Itogi Nauki i Tekhniki) [Kinetics and Catalysis (Advances in Science and Engineering Series)] (Moscow: Izd. VINITI, 1988) Vol. 18, p. 3 3. A H Hoveyda, D H Evans, G C Fu Chem. Rev. 93 1307 (1993) 4. R W Murray,M Singh, B L Williams, H M Moncrieff J. Org. Chem. 61 1830 (1996) 5. K A Jùrgensen Chem. Rev. 89 431 (1989) 6. P KocÄ ovsky, I Stary J. Org. Chem. 55 3236 (1990) 7. M G Finn, K B Sharpless J. Am. Chem. Soc. 113 113 (1991) 8. M J Martinelli, B C Peterson, V V Khau, D R Hutchison, M R Leanna, J E Audia, J J Droste J. Org. Chem. 59 2204 (1994) 9. S Yamabe, C Kondou, T Minato J. Org. Chem. 61 616 (1996) V G Dryuk, V G Kartsev 10.V G Dryuk, S P Shamrovskaya, E M Rybintseva,M O Lozinskii Ukr. Khim. Zh. 48 882 (1982) 11. V G Dryuk, S A Vasil'chenko, M S Malinovskii Kinet. Katal. 16 50 (1975) a 12. L I Kas'yan, M F Seferova, L G Gorb, M P Kozina, V G Dryuk Zh. Org. Khim. 25 1131 (1989) b 13. V G Dryuk, S P Shamrovskaya Ukr. Khim. Zh. 44 1087 (1978) 14. J Rebek, L Marshall, R Wolak J. Org. Chem. 51 1649 (1986) 15. E Vedejs,W H Dent III, J T Kendall, P A Oliver J. Am. Chem. Soc. 118 3556 (1996) 16. W Adam, L Blancafort J. Am. Chem. Soc. 118 4778 (1996) 17. H Pluim, H Wynberg J. Org. Chem. 45 2498 (1980) 18. R Helder, J G Hummelen, R W P M Laane, J S Wiering, H Wynberg Tetrahedron Lett. 1831 (1976) 19. O Meth-Cohn, C Moore, H C Taljaard J. Chem. Soc., Perkin Trans. 1 2663 (1988) 20.M T Reets, E H Lauterbach Tetrahedron Lett. 32 4477 (1991) 21. L L Vasil'eva, V I Mel'nikova,K K Pivnitskii Zh. Org. Khim. 20 548 (1984) b 22. R F W Jackson, S P Standen, W Clegg Tetrahedron Lett. 32 5393 (1991) 23. S W Ham, P Dowd J. Am. Chem. Soc. 112 1660 (1990) 24. M Maumy Bull. Soc. Chim. Fr., Pt. II 2895 (1974) 25. A Nishinaga, T Itahara, T Matsuura Tetrahedron Lett. 4481 (1974) 26. M Balci Chem. Rev. 81 91 (1981) 27. N A Porter,M A Cudd, P W Miller, A T McPhail J. Am. Chem. Soc. 102 414 (1980) 28. B B Snider, T Kwon J. Org. Chem. 55 1965 (1990) 29. P Chamberlain, M L Roberts, G H Whitham J. Chem. Soc., B 1374 (1970) 30. K Kaneda, K Jitsukawa, T Itoh, S Teranishi J. Org. Chem. 45 3004 (1980) 31. T Itoh, K Kaneda, S Teranishi Bull.Chem. Soc. Jpn. 48 1337 (1975) 32. M Matsuo, S Matsumoto, Y Iitaka, E Niki J. Am. Chem. Soc. 111 7179 (1989) 33. D C Liebler, P F Baker, K L Kaysen J. Am. Chem. Soc. 112 6995 (1990) 34. H Yamamoto, T Mashino, T Nagano,M Hirobe J. Am. Chem. Soc. 108 539 (1986) 35. E J Corey, M M Mehrotra, A U Khan Biochem. Biophys. Res. Commun. 145 842 (1987) 36. V G Dryuk, M A Voitsekhovskaya, V G Kartsev Epoksidirovanie Olefinov Tripletnym Molekulyarnym Kislorodom�Intermediaty i Stereokhimicheskii Aspekt (Epoxidation of Olefins by Triplet Molecular Oxygen�Intermediates and Stereochemical Aspect) (Chernogolovka: Institute of Chemical Physics in Chernogolovka, 1993) 37. G A Tolstikov Reaktsii Gidroperoksidnogo Okisleniya (Reactions of Hydroperoxide Oxidation) (Moscow: Nauka, 1976) 38.A S Rao, in Comprehensive Organic Synthesis Vol. 7 (Ed. BM Trost) (Oxford: Pergamon Press, 1991) p. 357 39. S S Woodard M G Finn, K B Sharpless J. Am. Chem. Soc. 113 106 (1991) 40. M J Schweitzer, K B Sharpless Tetrahedron Lett. 26 2543 (1985) 41. T Itoh, K Kaneda, S Teranishi J. Chem. Soc., Chem. Commun. 421 (1976) 42. J R Hwu, N Wang Chem. Rev. 89 1599 (1989) 43. L D-L Lu, R A Johnson, M G Finn, K B Sharpless J. Org. Chem. 49 728 (1984) 44. B E Rossiter, K B Sharpless J. Org. Chem. 49 3707 (1984) 45. S Takano, Y Iwabuchi, K Ogasawara J. Am. Chem. Soc. 113 2786 (1991) 46. K T Burgoine, S G Davies,M J Peagram, G H Whitham J. Chem. Soc., Perkin Trans 1 2629 (1974) 47. L I Kas'yan,M F Seferova, S I Okovityi Alitsiklicheskie Epoksidnye Soedineniya. Metody Sinteza (Alicyclic Epoxide Compounds.The Methods of Synthesis) (Dnepropetrovsk: Dnepropetrovsk State 48. M P Kozina, V S Mastryukov, E M Mil'vitskaya Usp. Khim. 51 49. L I Kas'yan, L G Gorb, N V Stepanova, N S Zefirov Zh. Org. 50. L I Kas'yan, M F Galafeeva, V V Kovalenko, V G Dryuk Ukr. University, 1996) 1337 (1982) [Russ. Chem. Rev. 51 763 (1982)] Khim. 22 893 (1986) b Khim. Zh. 53 960 (1987)Mechanism of the directing influence of functional groups and the geometry of reactant molecules on peroxide epoxidation of alkenes 51. V G Dryuk, E M Rybintseva, A F Kurochkin, N G Krivosheeva, M S Malinovskii Ukr. Khim. Zh. 53 642 (1987) 52. J Spanget-Larsen, R Gleiter Tetrahedron Lett.23 2435 (1982) 53. C Wipff, K Morokuma Tetrahedron Lett. 21 4445 (1980) 54. I Inagaki, H Fujimoto, K Fukui J. Am. Chem. Soc. 98 4054 (1976) 55. G H Whitham,M Wright J. Chem. Soc., C 883 (1971) 56. F Freeman Chem. Rev. 75 439 (1975) 57. E Toromanoff Tetrahedron 36 2809 (1980) 58. Y-D Wu, J A Tucker, K N Houk J. Am. Chem. Soc. 113 5018 (1991) 59. R L Halterman, M A McEvoy J. Am. Chem. Soc. 114 980 (1992) 60. S S Wong, M N Paddon-Row Aust. J. Chem. 44 765 (1991) 61. A G Anastassiou, R L Mahaffey Angew. Chem. 90 646 (1978) 62. V G Dryuk, M S Malinovskii, S P Shamrovskaya, S A Vasil'chenko, S A Maslov Zh. Org. Khim. 9 1228 (1973) b 63. T Ohwada, I Okamoto, N Haga, K Shudo J. Org. Chem. 59 3975 (1994) 64. M F Seferova, L I Kas'yan, V G Dryuk, V G Kartsev Osoben- nosti Obrazovaniya i Raskrytiya Epoksidnogo Tsikla v Ryadu Tsiklo- i Bitsikloalkanspirooksiranov (Features of Formation and Opening of the Epoxy Ring in the Series of Cyclo- and Bicycloalkanespiro- oxiranes) (Chernogolovka: Institute of Chemical Physics in Chernogolovka, 1991) 65. A G Causa, H Y Chen, S Y Tark, H J Harwood J. Org. Chem. 38 1385 (1973) 66. R G Carlson, N S Behn J. Org. Chem. 32 1363 (1967) 67. C R Johnson, B D Tait, A S Cieplak J. Am. Chem. Soc. 109 5875 (1987) 68. A S Cieplak J. Am. Chem. Soc. 103 540 (1981) 69. A Yasuda, H Yamamoto, H Nozaki Bull. Chem. Soc. Jpn. 52 1705 (1979) 70. G.Berti. Top. Stereochem. 7 93 (1974) 71. Y Arai, S Kawanami, T Koizumi Chem. Lett. 1585 (1990) 72. R P Heggs, B Ganem J. Am. Chem. Soc. 101 2484 (1979) 73. M F Schlecht, H-j Kim J. Org. Chem. 54 583 (1989) 74. G Berti, F Bottari, B Macchia Gazz. Chim. Ital. 90 1763 (1960) 75. D Feeya, B J Nunes Chem. Lett. 1569 (1982) 76. A Edelsbacher, E Urban, W Weidenauer Monatsh. Chem. 123 741 (1992) 77. A P Gray, D E Heitmeier J. Org. Chem. 34 3253 (1969) 78. W H Staas, L A Spurlock J Org. Chem. 39 3822 (1974) 79. J M Coxon, M P Hartshorn, A J Lewis Aust. J. Chem. 24 1009 (1971) 80. V G Dryuk, E M Rybintseva, N G Krivosheeva, L Yu Gnedenkov, M S Malinovskii Ukr. Khim. Zh. 53 764 (1987) 81. J K Crandall, D M Coppert, T Schuster, Feng Lin J. Am. Chem. Soc. 114 5998 (1992) 82. K B Sharpless, T R Verhoeven Aldrichim. Acta 12 63 (1979) 83. A McKittrick, B Ganem Tetrahedron Lett. 26 4895 (1985) 84. V N Kokorev, N N Vyshinskii, V P Maslennikov, I A Abronin, G M Zhitomirskii, Yu A Aleksandrov Zh. Strukt. Khim. 23 13 (1982) c 85. R S Atkinson, B J Kelly J. Chem. Soc., Chem. Commun. 624 (1988) 86. B A Chiasson, G A Berchtold J. Am. Chem. Soc. 96 2898 (1974) 87. S G Davies, G H Whitham J. Chem. Soc., Perkin Trans. 1 572 (1977) 88. F Mohamadi,M M Spees Tetrahedron Lett. 30 1309 (1989) 89. W R Roush, J A Straub, R J Brown J. Org. Chem. 52 5127 (1987) 90. H Kogen, T Nishi J. Chem. Soc., Chem. Commun. 311 (1987) 91. H E Schink, H Pettersson, J-E Bickvall J. Org. Chem. 56 2769 (1991) 92. V CÏ erny, M Budesinsky,M Ryba, F TurecÏ ek Collect. Czech. Chem. Commun. 53 1549 (1988) 93. S A Cerefice, E K Fields J. Org. Chem. 41 355 (1976) 94. R Bucourt, P Clapier, D Guenard, C Thal Tetrahedron Lett. 30 3973 (1989) 95. D P Rotella Tetrahedron Lett. 30 1913 (1989) 96. M Souchet,M Baillarge, F Le Goffic Tetrahedron Lett. 29 191 (1988) 97. D P lla Tetrahedron Lett. 30 1915 (1989) 98. P A Fitzpatrick, A M Klibanov J. Am. Chem. Soc. 113 3166 (1991) 99. E J Corey, R Noyori Tetrahedron Lett. 311 (1970) 100. K A Parker, D Fokas J. Org. Chem. 59 3933 (1994) 201 101. F M Hauser, S R Ellenberger, J P Glusker, C J Smart, H L Carrell J. Org. Chem. 51 50 (1986). ) 102. T Nagase, T Kawashima, N Inamoto Chem. Lett. 1655 (1985) 103. F A Davis, J C Towson, D B Vashi, R ThimmaReddy, J P McCauley Jr,M E Harakal, D J Gosciniak J. Org. Chem. 55 1254 (1990) 104. F A Davis, M E Harakal, S B Awad J. Am. Chem. Soc. 105 3123 (1983) 105. F A Davis, J M Billmers, D J Gosciniak, J C Towson J. Org. Chem. 51 4240 (1986) 106. F A Davis, A C Sheppard Tetrahedron 54 5703 (1989) 107. F A Davis, N F Abdul-Malik, S B Awad,M E Harakal Tetrahedron Lett. 22 917 (1981) 108. R D Bach, G J Wolber J. Am. Chem. Soc. 106 1410 (1984) 109. R W Murray Chem. Rev. 89 1187 (1989) 110. A L Baumstark, P C Vasquez J. Org. Chem. 53 3437 (1988) 111. D Yang, Y-C Yip, M-W Tang, M-K Wong, J-H Zheng, K-K Cheung J. Am. Chem. Soc. 118 491 (1996) 112. E N Jacobsen, W Zhang, A R Muci, J R Ecker, L Deng J. Am. Chem. Soc. 113 7063 (1991) 113. Y Naruta, F Tani, N Ishihara, K Maruyama J. Am. Chem. Soc. 113 6865 (1991) 114. J P Collman, V J Lee, C J Kellen-Yuen, X Zhang, J A Ibers, J I Brauman J. Am. Chem. Soc. 117 692 (1995) a�Kinet. Catal. (Engl. Transl.) b�Russ. J. Org. Chem. (Engl. Transl.) c�J. Struct. Chem. (Engl. Tr

ISSN:0036-021X    

出版商:RSC    

年代:1999

数据来源: RSC

摘要:

Russian Chemical Reviews 68 (3) 203 ± 214 (1999) Fluorine-containing 2,4-dioxo acids in the synthesis of heterocyclic compounds { V I Saloutin, Ya V Burgart,ONChupakhin Contents I. Introduction 203 II. Synthesis and structures of esters of polyfluorinated 2,4-dioxo acids 203 III. Transesterification reactions 204 IV. Reactions with amines 205 V. Reactions with dinucleophiles 205 VI. Preparation and reactions of 3-substituted polyfluorinated 2,4-dioxo acids 207 VII. Reactions of 2-ethoxycarbonyl(carboxy)-5,6,7,8-tetrafluorochromone 209 VIII. Conclusion 213 Abstract. The review surveys the data on the synthesis, tautomer- ism, electronic structures and chemical transformations of 4-poly- fluoroalkyl- and 4-pentafluorophenyl-2,4-dioxo acids and their derivatives.The reactions yielding fluorinated heterocyclic com- pounds and their further conversions are considered. The bibliog- raphy includes 86 references. I. Introduction Fluorine-containing a-oxo esters,15 a-diketones,1 b-oxo esters 4 ±6 and b-diketones 7±9 are used in studies of tautomerism, carbon- otropy, stereoisomerismand reactivity of dicarbonyl compounds (DCC). Fluorinated DCC often serve as building blocks for the preparation of various heterocyclic compounds.1, 6, 7, 10 Particu- larly impressive progress has been achieved in the design of drugs of the fluoroquinolone series with unique antibacterial activity, which are analogues of nalidixic acid.11± 16 These antibiotics contain a fluorobenzoylacetic acid structural fragment; for a number of these compounds, fluorinated b-DCCserve as starting compounds.11 ±16 The use of fluorinated DCC is not confined to their applica- tion as biologically active compounds.Certain fluorine-contain- ing DCC and their derivatives can be used as catalysts of various reactions, surfactants, shift reagents, analytical reagents, includ- ing those used for the determination and separation of a number of metals by gas chromatography, extractive agents for various metals, dyes and oil and composite additives.1, 6, 7, 17 Therefore, further progress in the chemistry and practical application of fluorinated dicarbonyl compounds seems to be very promising. Polyfluorinated 2,4-dioxo acids and their derivatives contain- ing simultaneously a- and b-dicarbonyl fragments are convenient starting compounds for the preparation of fluorinated hetero- cycles.Therefore, the development of procedures for the synthesis VI Saloutin, YaVBurgart,ONChupakhin Institute of Organic Synthesis, Ural Branch of the Russian Academy of Sciences, ul. S Kovalevskoi 20, 620219 Ekaterinburg, Russian Federation. Fax (7-343) 274 59 54. Tel. (7-343) 274 59 54. E-mail: saloutin@ios.uran.ru (V I Saloutin). Tel. (7-343) 249 34 91 (Ya V Burgart), (7-343) 274 11 89 (ONChupakhin) Received 25 November 1998 Uspekhi Khimii 68 (3) 227 ± 239 (1999); translated by TNSafonova #1999 Russian Academy of Sciences and Turpion Ltd UDC 547.484.708140831.7 of these compounds and investigation of their reactivity are topical problems.Although the chemistry of nonfluorinated 2,4- dioxo acids has been well studied (see, for example, Refs 18 ± 21), this class of fluorine-containing compounds was not known until our first publications.22 ±25 II. Synthesis and structures of esters of polyfluorinated 2,4-dioxo acids Nonfluorinated 2,4-dioxo acids and their esters had been first prepared at the end of the 19th century. Esters of 4-polyfluo- roalkyl- (1a± d) 22 and 4-pentafluorophenyl-2,4-dioxo acids (1e,f) 23 ±25 were first synthesised by the Claisen condensation starting fromfluoroalkyl- and pentafluorophenyl ketones, respec- tively, and dialkyl oxalates. Lithium hydride was used as a condensing reagent. The target compounds were isolated via copper chelates 2a± f (Scheme 1).Copper chelates of esters 2a±d are quite stable compounds.22 However, chelates of pentafluorobenzoylpyruvates 2e,f undergo cyclisation in DMSO or DMF to 2-alkoxycarbonyl-5,6,7,8-tetra- fluorochromones 3a,b.23± 25 Chromones 3a,b are also formed upon heating of pentafluorobenzoylpyruvates 1e,f above 25 8C.23 ±25 Cyclisation occurs through intramolecular replace- ment of the ortho-fluorine atomof the pentafluorophenyl group. In the design of syntheses on the basis of polyfluoro- acyl(pentafluorobenzoyl)pyruvates, it is necessary to have an idea of keto± enol tautomerism, charge distribution on atoms and frontier-orbital electron density in these compounds. As for enolisation, the tautomerism of nonfluorinated ana- logues of dioxo esters 1 has been reported in a series of publica- tions.Thus 1H NMR spectral studies demonstrated 28 that aroylpyruvates exist mainly as enols. It was also concluded 28 that the intramolecular hydrogen bond in the b-dicarbonyl frag- ment of the molecule is strengthened as the electron-accepting ability of substituents increases. On the basis of the 1H and 13C NMR spectral data, it was concluded that there was no tautomerismbetween two possible enol forms.28, 29 The proton is delocalised between two potential wells due to tunnelling. This agrees with the results of quantum-chemical SCF MO LCAO calculations by the CNDO/2 method.30 In going from one substituent to another, 13C chemical shifts are changed due to { Dedicated to the memory of our teacher Academician I Ya Postovskii on the occasion of his 100th birthday.204 Scheme 1 R1 OR2 R2O 1.LiH 2. MeCO2H 3. Cu(OAc)2 .H2O + O O O 3 4 2 R1 R1 CO2R2 CO2R2 1 HCl O O O O H Cu/2 1a ± f (92%± 94%) 2a ± f (60%± 65%) O F 2e,f F DMSO or DMF 7CuF2 D F O CO2R2 1e,f F 3a,b (35%± 100%) 1, 2: R1=CF3, R2=Me (a); R1=CF3, R2=Et (b); R1=C4F9, R2=Et (c); R1=HCF2, R2=Et (d); R1=C6F5: R2=Et (e),Me (f); 3: R2=Et (a),Me (b). the electron density redistribution in the dicarbonyl fragment.31 It was attemptedtodetermine the positionof the protonina series of b-DCC(including the acetylpyruvate molecule) by comparing the 13C chemical shifts for b-DCC and their BF2 chelates.32, 33 Presumably,32, 33 insignificant changes in the chemical shifts on going from b-DCC to their BF2 chelates indicate that the structures are nearly quasi-symmetrical and that the proton is delocalised between the two oxygen atoms to approximately the same extent.It was established by X-ray diffraction analysis that ethyl acetopyruvate is enolised at the C(2) atom.34 A comparative analysis of the 13C NMR spectra of ethyl acetylpyruvate and ethyl trifluoroacetylpyruvate (1b) demonstrated that compound 1b is also enolised at the C(2) atom.35 It was found that polyfluoroacyl(pentafluorobenzoyl)pyruvates 1 are completely enolised.22, 23 It is remarkable that, unlike fluoroacyl(aroyl)pyruvates under consideration, fluorinated b-diketones and b-oxo esters are only partially enolised.6, 7 The degree of enolisation reaches 100%only in fluorine-rich b-DCC.In this case, enolisation occurs at the carbonyl group bound to the fluorinated substituent.6, 7 With the aim of discussing the reactivity of fluoro- acyl(aroyl)pyruvates 1, quantum-chemical SCF MO LCAO cal- culations of charges and Fukui indices were performed for (fluoro)acylpyruvates 35 by the CNDO/2 method and for penta- fluorobenzoylpyruvic acid and methyl pentafluorobenzoylpyru- vate { by the AM-1 method 37 using the MNDO-89 program.36 The calculations demonstrated that the largest positive charge in fluoroacyl(aroyl)pyruvates is localised on the C(1) atom. The Fukui indices for the lowest unoccupied molecular orbitals (LUMO) in fluoroacylpyruvates and methyl pentafluorobenzoyl- pyruvate have the maximum values for the C(2) and C(4) atoms, respectively.In pentafluorobenzoylpyruvic acid, the values of the Fukui indices for LUMO of the C(2) and C(4) atoms have close values. Therefore, under kinetically controlled conditions the attack of a nucleophilic reagent occurs preferentially on the C(1) atom according to the charge control. According to the orbital control, the reactions of fluoroacylpyruvates should occur at the C(2) atom, while the reactions of methyl pentafluorobenzoylpyr- uvate should occur at the C(4) atom. In the case of pentafluor- obenzoylpyruvic acid, the orbital-controlled process is approximately equally probable for the C(2) and C(4) reaction centres (Table 1).{V I Saloutin, Ya V Burgart,ONChupakhin, unpublished data. V I Saloutin, Ya V Burgart,ONChupakhin Table 1. Charges and Fukui indices for the electrophilic centres in acyl- (aroyl)pyruvates. Charges (Fukui indices) R2 Com- R1 pound H C(1) C(2) C(4) 1g Me Me +0.2586 +0.3609 +0.2076 +0.2996 (0.1880) (0.5250) (0.3613) 1h HCF2 Me +0.2561 +0.3624 +0.2123 +0.2429 (0.1459) (0.5170) (0.4306) 1a CF3 Me +0.2549 +0.3628 +0.2128 +0.2216 (0.1289) (0.5134) (0.4540) 1i C4F9 Me +0.2558 +0.3630 +0.2128 +0.2502 (0.1240) (0.5661) (0.4624) 1f C6F5 Me +0.2651 +0.3302 +0.1456 +0.3252 (0.0271) (0.1630) (0.1740) 1j C6F5 H +0.2665 +0.3378 +0.1439 +0.3245 (0.0365) (0.1862) (0.1858) III.Transesterification reactions Esters are prone to transesterification. This property substantially enhances the synthetic potential of fluoroacyl(aroyl)pyruvates when using them as the starting compounds for constructing various heterocyclic systems. Copper chelates of ethyl(methyl) acylpyruvates 2a,c can be readily transesterified with a higher alcohol (borneol) even in the absence of catalysts.38 R1 R1 CO2R3 CO2R2 HCl O O O O R3OH 4 h Cu/2 Cu/2 2g,h (91%± 95%) 2a,cR1 CO2R3 O O H 1k,l (85%±92%) OH R1=CF3, R3=Born (2g, 1k), where Born= R1=C4F9, R3=Born (2h, 1l ). Boiling the copper chelate of ethyl pentafluorobenzoylpyru- vate 2e in methanol also results in transesterification to form the chelate of methyl pentafluorobenzoylpyruvate 2f.39 Thereafter methyl pentafluorobenzoylpyruvate (1f) can be readily prepared fromthe copper chelate 2f.CO2Et CO2Me F5C6 F5C6 MeOH HCl O O O D Cu/2 2e O Cu/2 2f (*100%) CO2Me F5C6 O O H1f (92%) It should be noted that this reaction is common to copper chelates of b-oxo esters because the chelates of esters of both aceto- and trifluoroacetoacetic acids enter into this reaction.38 However, the time required to achieve high degrees of conversion of the latter compounds is anorder of magnitude larger thanintheFluorine-containing 2,4-dioxo acids in the synthesis of heterocyclic compounds case of copper chelates of acylpyruvates 2a,c. Apparently, this is associated with the involvement of the ester group of b-oxo ester in intrachelate conjugation.Free ligands can also undergo trans- esterification; however, the selectivity of the reaction decreases sharply and substantial resinification of the reaction mixture occurs. Apparently, copper(II) ions favour the reaction by orient- ing an alcohol molecule through coordination and suppress side processes. IV. Reactions with amines The reaction of methyl acetopyruvate with ammonia affords an enamine at the carbonyl C(2) atom.40 The reaction of methyl trifluoroacetopyruvate (1a) with ammonia yields [methyl (tri- fluoroacetopyruvato)]ammonium (4), which remains unchanged on boiling in toluene.41, 42 However, compound 1a reacts with a softer base (aniline) at the C(2) centre to form an enamine, viz., methyl 2-anilino-5,5,5-trifluoro-4-oxopent-2-enoate (5),41, 42 according to orbital control over the reaction.CO2Me F3C NH3 CO2Me F3C O + O7 NH4 MeOH 4 (93%) O O H CO2Me F3C PhNH2 1a O NPh H5 (59%) Treatment of pentafluorobenzoylpyruvate 1a with gaseous or aqueous ammonia affords chromone 3a. Apparently, the corre- sponding ammonium salt is initially formed, which is followed by intramolecular substitution of the aromatic ortho-fluorine atom.42, 43 F5C6 CO2Et O O H1e O F F NH3 (NH4OH) 7NH4F O F CO2Et F 3a (*100%) O F F cyclo-C6H11NH2 CCl4 , DMSO, D O CO2Et cyclo-C6H11NH 6 (63%) F The reaction of pentafluorobenzoylpyruvate 1e with cyclo- hexylamine proceeds analogously.However, in this case cyclisa- tion is accompanied by the orbital-controlled replacement of the fluorine atom at position 7 of chromone to form 7-cyclohexyl- amino-2-ethoxycarbonyl-5,6,8-trifluorochromone (6).42, 43 Thus, in the reactions of compound 1e with ammonia or cyclohexylamine, intramolecular cyclisation dominates over addi- tion of the nucleophile at the C(2) centre regardless of the solvent. Pentafluorobenzoylpyruvic acid (1j) prepared by hydrolysis of ester 1e reacts with anhydrous ammonia in dioxane or with tertiary amines (triethylamine) to form 2-carboxy-5,6,7,8-tetra- fluorochromone (3c).41, 42 The reaction of acid 1j with ammonium hydroxide affords 2-amino-3-(3,4,5,6-tetrafluoro-2-hydroxyben- zoyl)acrylic acid (7), which exists as a zwitterion.41, 42 When heated in an acidic medium, the amino acid 7 is hydrolysed to the acid 1j or undergoes cyclisation to form the chromone 3c.205 When treated with aqueous ammonia followed by acidification, the latter, in turn, gives the amino acid 7.41, 42 Consequently, in these cases intramolecular cyclisation also prevails. F5C6 CO2H H+ O O 1e 35 ± 40 8C H1j (65%) O F F 1. NH3 or NEt3 2. H+ 7NH4F O F CO2H 3c (64%) F H+, D 1. NH4OH 2. H+, 20 8C O F NHá3 F CO¡2NH4OH, H2O H+, D OH F 7 (51%) F The reactions of the acid 1j with primary amines (aniline, isopropylamine or cyclohexylamine) yield addition ± elimination products at the C(2) centre, viz., 2-alkylamino(anilino)-2-penta- fluorobenzoylacrylic acids 8a ± c, which indicates that this reac- tion is an orbital-controlled process.In an alkaline medium, compounds 8a,b undergo cyclisation and nucleophilic replace- ment of the fluorine atom at the C(7) atom by the hydroxy group, which is typical of these fluorine-containing systems, to form 5,6,8-trifluoro-7-hydroxy-1-R-4-quinolone-2-carboxylic acids 9a,b.41,42 The fact that it was the fluorine atom at position 7 of quinolone that has been replaced was established by X-ray diffraction analysis of a complex of compound 9a with DMSO.44, 45 Cyclisation of compound 8a in the presence of morpholine affords 1-cyclohexyl-5,6,8-trifluoro-7-morpholino-4- quinolone-2-carboxylic acid (10).41, 42 COO7 F5C6 H2NR + 1j O NH2R D 8a ± c (47% ± 78%)F O F KOH, H2O 90 ± 95 8C N HO CO2H F R 9a,b (75%)O F F NH O 1.N N CO2H 2. DMSO (90 ± 100 8C) 3. KOH F O C6H11-cyclo 10 (35%) R=cyclo-C6H11 (8a, 9a), Pri (8b, 9b), Ph (8c). V. Reactions with dinucleophiles Various heterocyclic systems can be constructed by reactions of 2,4-dioxo esters with bifunctional nucleophiles. The reactions of acyl(aroyl)pyruvates can involve both the a-dicarbonyl and b-dicarbonyl fragments depending on the nature of the nucleo- phile.206 1. Reactions with hydrazines and hydroxylamine The reactions of acetyl(aroyl)pyruvates with hydrazines give 3-alkoxycarbonyl-5-methyl(aryl)pyrazoles.26, 27, 46 ± 48 The reac- tions of ethyl acetylpyruvates with hydroxylamine yield 3-ethox- ycarbonyl-5-methylisoxazole, isomeric 5-ethoxycarbonyl-3- methylisoxazole or a mixture of isoxazoles depending on con- ditions.26, 49 Ethyl benzoylpyruvate reacts with hydroxylamine to afford 3-ethoxycarbonyl-5-phenylisoxazole, the reaction proceeds via intermediate a-oxime.27, 50 Ethyl(methyl) fluoroacylpyruvates 1a,c,d react with hydrazine hydrate and phenylhydrazine at the b-dicarbonyl fragment like hydrocarbon analogues and fluorine-containing b-oxo esters 6 and b-diketones.7 However, unlike the latter compounds, the reactions with 1a,c,d give stable 3-alkoxycarbonyl-5-fluoroalkyl- 5-hydroxy-D2-pyrazolines 11a ± d (Scheme 2).The position of the hydroxy group in the pyrazoline ring was established by 13C NMR spectral study of compound 11b.35 Scheme 2 R1 OH CO2R2 R1 CO2R2 R3NHNH2 O O MeOH N R3N H 11a ± d (67 ± 73%) 1a,c,d 11: R1=CF3, R2=Me: R3=H(a), Ph (b); R1=C4F9, R2=Et, R3=H(c); R1=HCF2, R2=Et, R3=H(d).Unlike methyl(ethyl) fluoroacylpyruvates 1a,c,d, the reactions of bornyl esters 1k,l with hydrazine hydrate give 3-bornyloxycar- bonyl-5-fluoroalkylpyrazoles 12a,b.38 R1 CO2Born NH2NH2 .H2O 1k,l MeOH N HN 12a,b (61% ± 68%) 12: R1=CF3 (a), C4F9 (b). The reactions of chelates 2b,c with hydrazine and phenyl- hydrazine hydrochlorides in water or methanol afford pyrazoles 13a ± c rather than hydroxypyrazolines (Scheme 3).51 Scheme 3 R1 CO2Et R1 CO2Et R2NHNH2 . HCl O O NaOH, H2O N R2N Cu/2 13a ± c (70% ± 75%) 2b,c R1=C4F9, R2=H(2c, 13a); R1=CF3, R2=H(2b, 13b), Ph (13c).The reactions of copper chelates of trifluoroacetylacetone and ethyl trifluoroacetylacetate with hydrazine hydrochloride in DMF, which were studied for comparison, yielded 3-methyl-5- trifluoromethylpyrazole and 5-hydroxy-3-trifluoromethylpyr- azole, respectively.52 Pentafluorobenzoylpyruvate 1e and its copper chelate 2e react with hydrazine hydrate to give 3-ethoxycarbonyl-5-pentafluoro- phenylpyrazole 13d, which can be readily hydrolysed in an acidic medium to 3(5)-pentafluorophenylpyrazole-5(3)-carboxylic acid (14).51 Pentafluorobenzoylpyruvate 1e reacts with phenylhydrazine and copper chelate 2e reacts with phenylhydrazine hydrochloride to form pyrazole 13e.53 The reactions of hydroxylamine hydro- chloride with compounds 1e and 2e afford 5-pentafluorophenyl- isoxazole-3-carboxylic acid (15).53 V I Saloutin, Ya V Burgart, O N Chupakhin CO2H F5C6 NH N14 (79%) H+ R=HCO2Et F5C6 RNHNH2 .HCl RNHNH2 N RN13d,e (15% ± 67%) 2e 1e CO2H F5C6 1. HONH2 . HCl 2. H+, H2O 1. HONH2 . HCl 2. H+, H2O N O15 (25% ± 30%) 13: R=H(d), Ph (e). The formation of pyrazole and isoxazole derivatives in the reactions with hydrazines and hydroxylamine is typical also of both pentafluorobenzoylacetic ester 54 and derivatives of non- fluorinated aroylpyruvic acids.55 2. Reactions of 2,4-dioxo esters with aliphatic and aromatic 1,2-dinucleophiles Acyl(aroyl)pyruvates react with 1,2-dinucleophiles at the a-oxo ester fragment. The reactions with ethylenediamine, o-phenyl- enediamine or o-aminophenol as dinucleophiles give piperazinone derivatives,56 substituted quinoxalinones 57 ± 63 or benzoxazi- nones, respectively.63 ± 65 The reactions of polyfluoroacylpyruvates 1b ± d with ethyl- enediamine and o-phenylenediamine give 3-(2-oxofluoroalkylide- ne)piperazin-2-ones 16a ± c and 3-(2-oxofluoroalkylidene)- 1,2,3,4-tetrahydroquinoxalin-2-ones 17a ± c, respectively.35 Cop- per chelates 2b ± d react with o-phenylenediamine hydrochloride in a similar fashion.51 O R R CO2Et NH (CH2)2(NH2)2 N O O O MeOH, 20 8C H H 16a ± d (18% ± 67%) 1b ± e 16: R=CF3 (a), C4F9 (b), HCF2 (c), C6F5 (d). O o-(NH2)2C6H4 1b ± e R 20 8C NH MeOH R CO2Et N O o-(NH2)2C6H4 .2HCl H O O Cu/2 17a ± d (50% ± 85%) 2b ± e 17: R=CF3 (a), C4F9 (b), HCF2 (c), C6F5 (d).D 16e 1e R=o-HOC6F4 (16e). Under mild conditions, pentafluorobenzoylpyruvate 1e reacts with ethylenediamine to form piperazinone 16d. However, heating of the reaction mixture affords piperazinone 16e containing the tetrafluoro-2-hydroxyphenyl substituent.53 The mechanism of formation of the latter is discussed below. The reactions of compound 1e and its copper chelate 2e with o-phenylenediamine or its hydrochloride yield quinoxolone 17d.51, 53Fluorine-containing 2,4-dioxo acids in the synthesis of heterocyclic compounds The reaction of pentafluorobenzoylpyruvic acid (1j) with ethanolamine yields 3-pentafluorobenzoylmethylidenemorpho- lin-2-one (18).41,42 When refluxed in DMSO, the morpholinone 18 undergoes cyclisation to form 7,8,9,10-tetrafluoro-4-oxo- 1,2,4,6-tetrahydro[1,4]oxazino[4,3-a]-4-quinolone (19).Treat- ment of compound 19 with an aqueous KOH solution affords potassium 5,6,7,8-tetrafluoro-1-(2-hydroxyethyl)-4-quinolone-2- carboxylate (20).41,42 This procedure is one of a few methods for the synthesis of fluorine-containing 2-carboxyquinolones. O F5C6 CO2H F5C6 O DMSO H2N(CH2)2OH N O O O D D H H 18 (46%) 1j O F O F F F KOH O F F N N CO2K O F F (CH2)2OH 20 (76%) 19 (46%) Pentafluorobenzoylpyruvate 1e and its chelate 2e react with o-aminophenol and its hydrochloride under mild conditions to form 3-pentafluorobenzoylmethylidene-2H-1,4-benzooxazin-2- one (21a). Under more severe conditions, this reaction, like the reaction of compound 1e with ethylenediamine,53 yields 3-(3,4,5,6-tetrafluoro-2-hydroxybenzoylmethylidene)-2H-benzo- oxazin-2-one (21b) containing the tetrafluoro-2-hydroxyphenyl substituent as a minor product in addition to compound 21a.53, 66 Apparently, the product 21b is formed either from 2-ethoxycar- bonyl- (3a) or from 2-carboxy-5,6,7,8-tetrafluorochromone (3c), which are generated under the reaction conditions.This sugges- tion was confirmed by the synthesis of compound 21b directly from the chromones 3a or 3c.53, 66 NH2 CO2Et F5C6 OH O O O ROH, 20 8C F5C6 O H1e N O NH2 . HCl H CO2Et F5C6 OH O 21a (33% ± 51%) MeOH, D F O Cu/2 2e F F O NH2 O F OH N O O 21a (53%)+ 1e ROH, D H H 21b (25%) R=Me, Et, Pri.The reactions of pentafluorobenzoylpyruvate 1f and its cop- per chelate 2f with o-aminobenzenethiol were studied. It was demonstrated that the chelate 2f reacted with 2-aminobenzene- thiol hydrochloride at the a-oxo-ester fragment to form 3-penta- fluorobenzoylmethylidene-2H-1,4-benzothiazin-2-one (22). In the reaction with o-aminobenzenethiol under mild conditions, the ester 1f, unlike the chelate 2f, undergoes acid scission accom- panied by nucleophilic replacement of the fluorine atom in the pentafluorobenzoyl fragment of the molecule by the 2-amino- phenylthio group to form 2-[4-(2-aminophenylthio)-2,3,5,6-tetra- fluorophenyl]ben-zothiazole (23).39 207 O F5C6 CO2Me F5C6 S o-H2NC6H4SH.HCl O HN O O Cu/2 22 (18% ± 32%) 2f CO2Me F5C6 o-H2NC6H4SH O O H F F 1f S SC6H4NH2-o N F F 23 (40% ± 75%) Thus, polyfluoroacylpyruvates react with hydrazines at the b-dicarbonyl fragment, while their reactions with ethylenediamine and o-phenylenediamine proceed at the a-oxo-ester fragment. Apparently, the first stage of the reactions with HN-dinucleo- philes, as in the case of aniline, involves the attack of one amino group on the electrophilic C(2) centre according to the orbital control over the reaction. Subsequent attack of the second amino group can occur on two centres, viz., either on the electrophilic C(1) centre or on the C(4) atom. Apparently, the nucleophilic attack on the C(4) centre to form five-membered rings in the case of hydrazines and on the C(1) centre to form six-membered rings in the case of ethylenediamine and o-phenylenediamine is gov- erned by thermodynamic factors.In the reactions of pentafluorobenzoylpyruvate 1e with amines, intramolecular cyclisation to 2-ethoxycarbonylchromone 3a is the dominant reaction route. Reactions at the b-dicarbonyl fragment are typical of the reactions of pentafluoro- benzoylpyruvates with hydrazines and hydroxylamine, while reactions at the a-oxo-ester fragment are characteristic of the reactions with ethylenediamine, o-phenylenediamine and o-ami- nophenol. It is believed that the main regularities manifested in these reactions are similar to those observed in the case of polyfluoroacylpyruvates. The use of copper chelates of b-di- and tricarbonyl com- pounds instead of free ligands in the reactions with nucleophiles does not necessarily lead to the formation of identical products.Thus the reactions of copper acylpyruvates 2b,c with hydrazines afford pyrazoles 13a ± c rather than hydroxypyrazolines 11 (see Schemes 2 and 3). Apparently, this is due to the template role of the copper cation. In some instances, for example, in the reactions of b-DCC chelates with hydrazine hydrochlorides as well as in the reactions of copper acylpyruvates with hydroxylamine hydro- chlorides and o-phenylenediamine hydrochlorides, identical prod- ucts were obtained in comparable yields. In addition, the use of the copper chelate of pentafluoroben- zoylpyruvate 2f allows one to obtain substituted benzothiazinone 22 by the reaction with o-aminobenzenethiol, while pentafluor- obenzoylpyruvate 1f as such undergoes acid scission under the reaction conditions.VI. Preparation and reactions of 3-substituted polyfluorinated 2,4-dioxo acids Preparation of fluorine-containing 3-substituted chromones and quinolones by cyclisation of aroylpyruvates requires that an alkoxymethylene group be introduced at the C(3) atom of the initial pyruvates. Ethyl pentafluorobenzoylpyruvate (1e), like other of b-DCC,11, 12, 23, 24, 67 readily reacts with ethyl orthoformate to form ethyl 3-ethoxymethylidene-2,4-dioxo-4-pentafluorophenyl- butyrate (24).The reactions of compound 24 with amines fol- lowed by cyclisation the resulting ethyl 3-208 alkylaminomethylidene-2,4-dioxo-4-pentafluorophenylbutyrates (25) afford 3-ethoxalyl-1-R-5,6,7,8-tetrafluoro-4-quinolones (26). 2-(1-R-5,6,7,8-Tetrafluoro-4-oxo-1,4-dihydroquinolin-3-yl)gl- yoxylic acids (27) were prepared by hydrolysis of the esters 26.68 H EtO CO2Et F5C6 HC(OEt)3 RNH2 CO2Et F5C6 O O (CH3CO)2O H O O 24 (83%) 1e H HRN LiH CO2Et F5C6 DMSO O O 25 (20% ± 75%) F O O O F O F F H+ CO2H CO2Et F F NRRN F F 27 (71% ± 94%) 26 (29% ± 91%) R=H, Me, Et, cyclo-C3H5, C6H13, C2H4OH, o-MeC6H4 . The active methylene group in compounds containing a b-dicarbonyl fragment is the reaction site for azocoupling with aryldiazonium salts to form the corresponding arylhydrazones.69 Until recently, the data on the participation of fluorine-containing b-DCC in azocoupling have been limited to only a few examples of the reactions of fluorinated b-diketones,70, 71 trifluoroacetoace- tates 70 and pentafluorobenzoylacetates.72 Recently, the synthesis of fluorinated 2-arylhydrazono-1,3-dicarbonyl compounds was reported and their reactivity with respect to N,O-dinucleohilies was studied.73 Data on the possibility of the synthesis of arylhy- drazones using fluorine-containing acyl(aroyl)pyruvates are lack- ing in the literature although nonfluorinated analogues of acyl(aroyl)pyruvate arylhydrazones were reported.74 3-Arylhydrazones of 5,5,5-trifluoro-2,3,4-trioxopentanoates and 4-pentafluorophenyl-2,3,4-trioxobutyrates 28a ± f were first prepared by the reactions of trifluoroacetyl(pentafluoroben-zoyl)- pyruvates 1b,e and their copper chelates 2b,e with aryldiazonium chlorides in an aqueous medium.75 N H2N NHR3 R1=CF3, R2=H F3C N NR3 29a,b (67% ± 74%) NHC6H4R2-p N R1 o-(NH2)2C6H4 R1=CF3, C6F5, R2=H R1 CO2Et O O N H N O 28a,d ± f Ph 30a,b (85% ± 88%) F F R1=C6F5 , R2=H, Me, OMe F F 31a ± c (47% ± 80%) 29: R3=H(a), Ph (b); 30: R1=CF3 (a), C6F5 (b); 31: R2=H(a), Me (b), OMe (c).V I Saloutin, Ya V Burgart, O N Chupakhin R1 CO2Et O O NHC6H4R2-p + H N p-R2C6H4N N Cl7, NaOAc, H2O 1b,e R1 CO2Et R1 CO2Et O O 28a ± f (63% ± 91%) O O Cu/2 2b,e 28: R1=CF3: R2=H(a), Me (b), OMe (c); R1=C6F5: R2=H(d ), Me (e), OMe (f ).Arylhydrazones 28a,d were subjected to heterocyclisation with hydrazines and o-phenylenediamine. Compound 28a reacts with hydrazine hydrate and phenylhydrazine to give 1-R3-5-ethox- ycarbonyl-4-phenylazo-3-trifluoromethyl-D2-pyrazol-ines 29a,b, unlike pentafluorobenzoyl-substituted arylhydrazone 28d, which reacts with hydrazine hydrate to form a mixture of products which are difficult to separate. 3-(2-R-Ethyl-2-oxo-1-phenylhydrazono)- 1,2-dihydroquinoxalin-2-ones 30a,b were synthesised from aryl- hydrazones 28a,d and o-phenylenediamine by boiling in diethyl ether (Scheme 4).75 Thus, arylhydrazones of fluoroacyl(aroyl)pyruvates, like their nonsubstituted analogues, react with hydrazines and o-phenyl- enediamine at the b-dicarbonyl and a-oxo-ester fragments, respec- tively. The presence of a pentafluorobenzoyl substituent in arylhy- drazones 28d ± f makes it possible to use them for constructing heterocyclic compounds of the cinnolone series.Thus when heated in DMSO in the presence of K2CO3 or refluxed in chloro- form with a twofold excess of triethylamine, arylhydrazones 28d ± f give 3-ethoxalyl-5,6,7,8-tetrafluoro-1-(4-R2-phenyl)-1,4- dihydrocinnolin-4-ones 31a ± c.75 Cyclisation of quinoxalinone 30b upon heating affords 5,6,7,8-tetrafluoro-3-(2-oxo-1,2-dihydroquinoxalin-3-yl)-1-ph- enyl-1,4-dihydrocinnolin-4-one (32). Compound 32 is also formed in the reaction of cinnolinone 31a with o-phenylenediamine. Nucleophilic replacement of the fluorine atom at position 7 in the reactions with various alkylamines is typical of fluorine- containing cinnolinones, fluorochromones and quinolones.12 For example, the reaction of cinnolinone 32 with an excess of NPh Scheme 4 CO2Et N O F N NH F *280 8C NH R1=C6F5 O N N F O F Ph 32 (98%) O O CO2Et o-(NH2)2C6H4 N 32 (65%) N MeOH, 20 8C R2=H C6H4R2-pFluorine-containing 2,4-dioxo acids in the synthesis of heterocyclic compounds morpholine in DMSO yields a product of replacement of the fluorine atom, viz., 5,6,8-trifluoro-7-morpholino-3-(2-oxo-1,2- dihydroquinoxalin-3-yl)-1-phenyl-1,4-dihydrocinnolin-4-one (33).75 NH O N O F 32 NH F 7HF O N N N F O 33 (66%) Ph From the aforesaid it may be concluded that modification of fluoroacyl(aroyl)pyruvates by introducing alkoxymethylidene and arylhydrazone fragments at position 3 qualitatively changes and substantially extends synthetic possibilities of the compounds under consideration.VII. Reactions of 2-ethoxycarbonyl(carboxy)- 5,6,7,8-tetrafluorochromone A characteristic feature of pentafluorobenzoylpyruvate 1e and its chelate 2e (see Scheme 1) is their conversion into 2-ethoxycarbo- nylchromone 3a due to their ability to undergo intramolecular cyclisation to form a six-membered ring.23, 24 Under analogous conditions, ethyl pentafluorobenzoylacetate (34) undergoes self- condensation. The latter reaction is accompanied by the Die- ckmann condensation and intramolecular cyclisation of an inter- mediate product to yield 1-oxo-3-pentafluorophenyl-1H- pyrano[4,3-b]-6,7,8,9-tetrafluorochromone (35).76 2-Pentafluoro- benzoylmethyl-5,6,7,8-tetrafluorochromone (36) was prepared by acid hydrolysis of compound 35.It should be mentioned that self- condensation is typical of both fluorinated 77 and nonfluorinated b-oxo esters.78 However, in the case of pentafluorobenzoylpyr- uvate 1e, intramolecular cyclisation dominates. O CO2Et F5C6 OEt OH F5C6 2 7EtOH O O 7HF, 7EtOH HO C6F5 34 O O F F H2O, H+ O 7CO2 F O C6F5 35 (37%) F O F F O O F C6F5 36 (43%) F It should also be noted that ethyl 2-ethoxymethylidenepenta- fluorobenzoylacetate (37), like the ester 1e, undergoes cyclisation to form 3-ethoxycarbonyl-5,6,7,8-tetrafluorochromone (38).23, 24 O F CHOEt F CO2Et CH(OEt)3 D 34 OEt F5C6 O F O O 37 (81%) 38 (62%) F 209 Chromones 3a and 38 are readily hydrolysed to the corre- sponding acids 3c and 39, which undergo decarboxylation upon heating to form 5,6,7,8-tetrafluorochromone (40).23, 24 O F O F H2O, H+ O F O CO2H CO2Et 3a 3c (80%) F O F O 7CO2 F CO2H CO2Et H2O, H+ F O O 38 39 (69%) F O F F O F 40 (72% ± 79%) F The reactivity of fluorochromones was discussed 79 with recourse to quantum-chemical AM-1 37 calculations of the charges and Fukui indices for tetrafluoro-2-methoxycarbonylchromone, 2-carboxytetrafluorochromone and its anion and their nonfluori- nated analogues using the MNDO-90 method 36 (Table 2).The calculated data make it possible to reveal the following regularities. The introduction of fluorine atoms into the aromatic ring of chromone has virtually no effect on the charge distribution in the pyrone ring. The maximum positive charges in the pyrone and fluorine-containing aromatic rings are localised on the C(9) and C(5) atoms, respectively.79 In the pyrone rings, the maximum values of the Fukui indices for LUMO correspond to the C(2) atom in the fluorine-substi- tuted ester and acid and to the C(4) atom in the anion. In the fluorine-containing aromatic rings of the ester, acid and anion, the maximum values of the Fukui index correspond to the C(7) atom.79 Thus, according to the charge control, the kinetically con- trolled reactions of chromones with nucleophilic reagents should occur predominantly at the C(9) atom of the ester fragment, carboxyl group and the anion of the acid.According to orbital control, the reactions of the ester and acid should occur at the C(2) atom of the pyrone ring, while the reactions of the anion should occur at the C(4) atom. The orbital-controlled nucleophilic replacement of the fluorine atom should occur predominantly at the C(7) atom.79 2-Ethoxycarbonyl- 3a and 2-carboxychromones 3c possess different reactivity with respect to ammonia and primary amines.43 Thus 2-ethoxycarbonylchromone 3a does not react with ammonia or aniline. Methylamine reacts with the ester group and the C(7) atom of the fluorinated ring of compound 3a to form N-methyl-5,6,8-trifluoro-7-methylaminochromone-2- carboxamide (41) (Scheme 5).This behaviour is untypical of the known nonfluorinated chromones. Under these conditions, the latter add a nucleophile at the C(7) atom with the opening of the heterocycle.78 Under the action of cyclohexylamine, only the fluorine atom at the C(7) atom of chromone 3a is replaced to form chromone 6 (see Scheme 5).79 It should be noted that the replacement at the C(7) atom is an orbital-controlled reaction, while the formation of methylamide at the C(9) atom is a charge- controlled process.210 Table 2. Charges and Fukui indices for the electrophilic centres in substituted chromones. X Charges R C(4) C(2) Me F +0.0564 +0.3041 +0.1618 +0.0060 +0.1015 +0.0429 +0.3454 0.197 0.186 0.312 0.00158 0.365 0.207 0.0406 H F +0.0543 +0.3033 +0.1620 +0.0072 +0.1019 +0.0440 +0.3531 0.224 0.192 0.300 0.00026 0.333 0.197 0.0521 See.a F +0.0754 +0.3184 +0.1539 +0.0306 +0.0748 +0.0297 +0.3916 0.0246 0.0676 0.338 0.0165 0.564 0.370 7 Me H +0.0567 +0.3039 70.0451 70.1630 70.0748 70.1536 +0.3439 0.476 0.237 0.124 0.00650 0.0959 0.0743 0.153 H H +0.0547 +0.3036 70.0449 70.1622 70.0742 70.1531 +0.3514 0.480 0.226 0.114 0.00710 0.0837 0.0672 0.171 See.a H +0.0836 +0.3162 70.0553 70.1973 70.0977 70.1669 +0.3861 0.0567 0.153 0.333 0.0154 a Anion of 2-carboxychromone. F MeNH2 MeCN, 20 8C MeNH 3a cyclo-C6H11NH2 D cyclo-C6H11NH NH XNEt3 , MeCN XO 42: X=O(a), NMe (b), CH2 (c).The reactions of chromone 3a with secondary amines (mor- pholine, N-methylpiperazine or piperidine) proceed analogously without the opening of the heterocycle (which is typical of the reactions of nonfluorinated chromones with secondary amines) to form the corresponding 2-ethoxycarbonyl-7-R-5,6,8-trifluoro- chromones 42a ± c.Boiling of chromone 42a with HCl gives 5,6,8-trifluoro-7-morpholinochromone-2-carboxylic acid (43) (see Scheme 5).43 Thus, the reactions of 2-ethoxycarbonylchromone 3a with primary and secondary amines are orbital-controlled and yield products of replacement at the C(7) atom. In contrast to 2-ethoxycarbonylchromone 3a, the reactions of 2-carboxychromones 3c and 43 with ammonia are accompanied by the opening of the pyrone ring, which is typical of the known chromones.78 These reactions afford 2-amino-3-(4-R-3,5,6-tri- fluoro-2-hydroxybenzoyl)acrylic acids 7 and 44, which can undergo recyclisation to form the initial compounds 3c and 43 upon boiling in an acidic medium.43 X5 X 67 X 8 XC(8) C(7) C(6) C(5) Scheme 5 O F CONHMe O 41 (41%) F O F F O CO2Et 6 (31%) FO F F O N CO2Et F 42a ± c (47% ± 52%) HCl X=OO F FN O CO2H 43 (70%) F V I Saloutin, Ya V Burgart, O N Chupakhin O4 32 1 9 O CO2R Fukui indices C(9) C(8) C(7) C(5) C(6) C(4) C(2) C(9) 0.542 0.285 7 F F R O F F CO2H F 1.NH3 2. H+, 20 8C H+, D NH O OH R O CO2H H 3c, 43 F 7, 44 (49% ± 57%) R=F(3c, 7), O N (43, 44). The reactions of 2-carboxychromone 3c with primary amines are governed by both the nature of the amine and the reaction conditions.79 Thus boiling of chromone 3c with an equimolar amount of amine (cyclohexylamine or hexylamine) in dioxane affords cyclohexylammonium (hexylammonium) 5,6,7,8,-tetra- fluorochromone-2-carboxylate (45a,b).Salts 45a,b are stable on prolonged boiling in toluene. In the presence of an excess of amine, the pyrone ring in compound 45a is opened to form 2-cyclohexylamino-3-(3,4,5,6-tetrafluoro-2-hydroxybenzoyl)- acrylate (46). Acidification of the salt 46 affords 2-cyclohexyl- amino-3-(3,4,5,6-tetrafluoro-2-hydroxybenzoyl)acrylic acid (47). Treatment of the hexylammonium salt 45b with hydrochloric acid affords the initial chromone 3c (Scheme 6).79 Scheme 6 F O F RNH2 RNH2 3c + R=cyclo-C6H11 F O CO¡2 .NH3R H+, H2O R=C6H13 45a,b (40% ± 87%) F + OH O CO¡2 .NH3R F HCl NHR F F 46 (46%) F OH O CO2H RNH2 3c F NHR D 45a F F 47 (45%) F 45: R=cyclo-C6H11 (a), C6H13 (b).Fluorine-containing 2,4-dioxo acids in the synthesis of heterocyclic compounds The reactions of chromone 3c with hexylamine and aniline in a mixture of chloroform and water at 30 ± 35 8Ccan proceed both as nucleophilic addition of the amine at the activatedC=Cbond and as the reaction at the carbonyl group of the chromone.Thus chromone 3c reacts with aniline to form anilinium 4-anilino- 5,6,7,8-tetrafluoro-4-hydroxychromene-2-carboxylate (48). The reaction of chromone 3c with hexylamine affords hexylammo- nium 2,4-bis(hexylamino)-5,6,7,8-tetrafluoro-4-hydroxychro- mane-2-carboxylate (49), which is converted into 5,6,7,8- tetrafluoro-2-hexylamino-4-oxochromane-2-carboxylic acid (50) upon acidification (Scheme 7).43 Scheme 7 FHO NHPh F PhNH2 + H+ F O CO¡2 .NH3Ph F 48 (36%) 3c FHO NHC6H13 F C6H13NH2 NHC6H13 + F O CO¡2 .NH3C6H13 F 49 (78%) H+, H2O O F FF O CO2H F NHC6H13 50 (81%) The reaction of 2-ethoxycarbonylchromone 3a with hydrazine yields a mixture of products, which are difficult to identify.2-Carboxychromone 3c, like nonfluorinated analogues, reacts with hydrazine and phenylhydrazine more selectively to form the corresponding 1-R-5-(tetrafluoro-2-hydroxyphenyl)pyrazole-3- carboxylic acids 51a,b.79 F F OH NH2NHR 3c MeOH CO2H F N F RN 51a,b (66% ± 72%) R=H(a), Ph (b).The reaction of 2-ethoxycarbonylchromone 3a with ethyl- enediamine yields either piperazin-2-one 16e as a result of the reaction at the C(2) atom and the ester group or a product of nucleophilic aromatic replacement of the fluorine atom at posi- tion 7, viz., N,N0-ethylenebis(7-amino-2-ethoxycarbonyl-5,6,8- trifluorophenylchromone) (52), depending on the solvent (Scheme 8).43 The formation of these compounds is attributable to an increase in the electron-withdrawing ability of the poly- fluoroaryl ring (and consequently, the ability to undergo nucleo- philic replacement of the fluorine atom) in going from protic solvents (alcohols) to a bipolar aprotic solvent (DMSO).80 How- ever, the reaction of chromone 3a with ethylenediamine in acetonitrile also affords piperazin-2-one 16e.43 Apparently, ace- tonitrile, unlike DMSO, does not hinder the formation of an ionic pair of ethylenediamine with chromone at the electrophilic carbon atom of the ester group or at the C(2) atom.211 Scheme 8 O F F O F CO2Et 3a F (CH2)2(NH2)2 DMSO, NEt3 CH2Cl2, MeOH, NEt3 O F O o-HOC6F4 F NH N O O NHCH2 EtO2C H 2 16e (50% ± 70%) F52 (54%) H+, D 3c (55%) 2-Ethoxycarbonylchromone 3a reacts with diethylenetriamine with the involvement of all three nucleophilic centres to form a binuclear triazaheterocyclic derivative, viz., 9-(3,4,5,6-tetrafluoro- 2-hydroxybenzoyl)perhydropyrazino[1,2-a]pyrazin-1-one (53).81 An analogous bicyclic system is obtained by the reaction of 2-amino-4-iminoperfluoropent-2-ene (an aza analogue of hepta- fluoroacetylacetone) with diethylenetriamine.82, 83 O HN O F F N H2N(CH2)2NH(CH2)2NH2 CH2Cl2 , MeOH F F HN OH 53 (65%) H+ 3a CH2OH OH N O NH F H2N(CH2)2NH(CH2)2OH CH2Cl2 , MeOH O F F 54 (72%) F 3c (50% ± 76%) The reaction of chromone 3a with N-(2-hydroxyethyl)- ethylenediamine under analogous conditions is completed in the stage of formation of a mononuclear heterocyclic compound, viz., 3-(3,4,5,6-tetrafluoro-2-hydroxybenzoylmethylidene)-4-(2-hydr- oxyethyl)piperazin-2-one (54).81 Attempts to perform further intramolecular heterocyclisation of compound 54 with the use of acid or base catalysis, which favours nucleophilic addition of the hydroxy group at the C=C bond, failed.Under conditions of acid catalysis in the presence of water, compound 54 is readily hydrolysed to form carboxychro- mone 3c. When boiled in toluene with p-toluenesulfonic acid, the initial piperazinone 54 remains unchanged. Heating of compound 54 in an alkaline medium results in its decomposition to 3,5,6- trifluoro-2,4-dihydroxyacetophenone 55 or, in the case of the shorter reaction time, to tetrafluoro-2-hydroxyacetophenone 56.81Analogous hydrolytic cleavage to form dihydroxy(hydroxy)- polyfluoroacetophenones was also observed in the cases of piperazinone 16e and aminoacrylic acid 7.84212 O F F 2 h OH HO 55 F NaOH 54 H2O O F F 20 min OH F 56 F 2-Ethoxycarbonylchromone 3a and 2-carboxychromone 3c react with o-phenylenediamine to form quinoxaline derivative 17e (the yields were 70% and 30%, respectively) (Scheme 9).79 The reactions of compounds 3a and 3c with o-aminophenol afford benzooxazinone 21b containing the tetrafluorohydroxyphenyl fragment.53, 66 Scheme 9 O F NH2 O F HN O XH X O F C6F4OH-o CO2R 17e, 21b (25% ± 87%) 3a,c F R=Et (3a), H (3c); X=NH (17e), O (21b). The reaction of 2-methoxycarbonylchromone 3b with o-ami- nothiophenol yields only a product of nucleophilic replacement of the fluorine atom, viz., 7-(2-aminophenylthio)-5,6,8-trifluoro-2- methoxycarbonylchromone (57).39 O F O F F F RH F O O R CO2Me CO2Me 3b F 57 (55% ± 80%) F R=o-H2NC6H4S. When heated in DMSO in the presence of triethylamine, both quinoxalones containing the hydroxy group in the fluoroaromatic fragment (17e) and hydroxy-free quinoxalones (17d) undergo heterocyclisation to form 1,2,3-trifluoro-4-R-(5H)-5-oxoquino- lino[1,2-a]-8H-quinoxalin-7-ones 58a,b due apparently to the completely aromatic character of the possible zwitterion.79 O R O7 R F F 17d,e O OH N F F +N D DMSO, Et3N NH F N F 58a,b (30% ± 42%) R=F(17d, 58a), OH (17e, 58b).In this connection it should be noted that piperazinone 16e whose nitrogen atoms should be more nucleophilic than those in quinoxalone does not give the corresponding heterocyclic system 59 either under analogous conditions or under more drastic conditions (K2CO3 or LiH).Apparently, this is associated with the fact that none of its possible tautomeric forms is completely aromatic.79 V I Saloutin, Ya V Burgart, O N Chupakhin O O O NH o-HOC6F4 NH N HO N O H 16e F F 59 F It is remarkable that the benzooxazinone derivative 21a also undergoes intramolecular cyclisation upon heating in DMSO. This reaction, unlike the above-mentioned transformation of quinoxalones 17d,e into quinolinoquinoxalones 58a,b, affords 4,5,6-trifluoro-3H-pyrido[3,2,1-k,l]phenoxazin-3-one (60). Appa- rently, the formation of compound 60 proceeds via intermediates shown in the following scheme:85 O F O F F5C6 O O DMSO, NEt3 N F O N 7HF O F H 21a O F O F F F H2O 7CO2 N F N F O O O 60 (55%) Summarising the data on the reactions of 2-alkoxycarbonyl- (3a,b) and 2-carboxy-5,6,7,8-tetrafluorochromones (3c) with binucleophiles, it can be suggested that the mechanisms of the first stages of the reactions of chromones 3a,b and 3c are different, although the reactions can afford identical products (for example, in the reactions with o-phenylenediamine and o-aminophenol). Apparently, the initial stage of the reactions of chromones 3a,b with N-dinucleophiles involves the charge-controlled attack of one amino group of the reagent on the electrophilic C(9) centre.It counts in favour of this suggestion that the reaction of chromone 3a with methylamine affords N-methylamide 41 (see Scheme 5).However, the reaction with an excess of methylamine involves also the orbital-controlled attack of the nucleophile on the C(7) centre. In this connection it should be noted that the orbital control may become predominant, e.g., in the reactions of chromone 3a with primary and secondary amines in dioxane yielding 7-substituted products 42 and 6 (see Scheme 5) or in the reaction of chromone 3a with ethylenediamine in DMSO to form product 52 (see Scheme 8). This regioselectivity is apparently determined by the effect of specific solvation of the initial reagents by the solvent, much as in the reactions of 5-aryl-2,3-dihydro- furan-2,3-diones with aromatic amines in dioxane.86 The second amino group of the N-dinucleophile (ethylenedi- amine, o-phenylenediamine or o-aminophenol) attacks the nearest C(2) atom of chromone 3a.In this case, the pyran ring is opened to form new heterocyclic compounds, viz., piperazinones 16e, qui- noxalones 17e or oxazines 21b, respectively (see Schemes 8 and 9). Evidently, this process is governed by thermodynamic factors. Unlike 2-alkoxycarbonylchromones 3a,b, 2-carboxychro- mone 3c reacts with an equimolar amount of primary amines to form stable salts 45 (see Scheme 6). The reactions of these salts with an excess of amine follow different routes. Thus heating in dioxane results in resinification of the reaction mixture. In an aqueous medium, the reversible interaction of the amino group of primary amine with the electrophilic C(4) and C(2) centres occurs.In the latter case [the reaction at the C(2) atom], either products ofFluorine-containing 2,4-dioxo acids in the synthesis of heterocyclic compounds addition at the double C(2)=C(3) bond (products 49 and 50) can be formed (see Scheme 7) or derivatives of aminoacrylic acid, viz., compounds 46 and 47, can be obtained due to the opening of the heterocycle of the chromone, as in the case of the reaction with cyclohexylamine (see Scheme 6). However, when heated in diox- ane, the products of addition of cyclohexylamine undergo identi- cal conversions to form apparently the more stable initial salts. It is remarkable that under kinetically controlled conditions the reaction at the C(4) atom can occur as a charge-controlled process because the charge on this atom is the second largest, exceeded in value only by the C(9) atom.However, the reaction of amine at the C(2) atom of the carboxylate anion, as in the case of 2-ethoxycarbonylchromone, is not apparently kinetically con- trolled. Actually, calculations of model compounds demonstrated that the attack of a nucleophile on the C(2) atom of the fluorinated carboxylate anion affords a thermodynamically more stable reaction product than the attacks on the C(4) and C(7) nucleo- philic centres. This is evident from the comparison of the enthal- pies of formation of the following compounds (DH /kJ mol71):79 O F FHO NH2 F F CO¡2 O F F O CO¡ NH2 2 F F DH=71388.47 DH=71313.94 O F O F F F CO¡2 O O CO¡ NH2 H2N H2N 2 F F DH=71217 DH=71128 In our opinion, the formation of the corresponding carbox- ylate anion followed by the attack of a nucleophile (an excess of amine in the case of hydrazines and the second amino group in the case of o-phenylenediamine and o-aminophenol) on the C(2) atom is also typical of the reactions of 2-carboxychromone 3c with hydrazines, o-phenylenediamine and o-aminophenol.The subse- quent reaction path is determined by the thermodynamic stability of the final products, as in the case of nonfluorinated aroylpyruvic acids. VIII. Conclusion Analysis of the above-considered published data demonstrated that the reactions of fluorinated acyl(aroyl)pyruvates are analo- gous to the reactions of nonfluorinated a- and b-DCC.Thus fluoroacyl(aroyl)pyruvates react at the b-dicarbonyl fragment (for example, with hydrazines) and enter into the reactions at the active methylene group as b-DCC (for example, with orthofor- mate and aryldiazonium salts) and at the a-oxo-ester fragment as a-DCC (for example, with diamines). However, the introduction of fluorine atoms into aroylpyr- uvate molecules can radically change their reactivity. Thus the heterocyclisation of fluoroaroylpyruvates, which is untypical of their nonfluorinated analogues, affords 2-ethoxycarbonyl(car- boxy)-5,6,7,8-tetrafluorochromones. The latter, in turn, can react with HO-, HN- and HS-nucleophiles to form various fluorinated heterocyclic compounds. In summary the above-considered data substantially extend the knowledge of synthetic potentialities of fluorinated 2,4-dioxo acids and their derivatives for constructing various classes of heterocyclic systems. 213 References 1.V I Saloutin, K I Pashkevich, I Ya Postovskii Usp. Khim. 51 1287 2. A S Golubev, A F Kolomiets, A V Fokin Usp. Khim. 61 1422 (1992) 3. S N Osipov, A F Kolomiets, A V Fokin Usp. Khim. 61 1457 (1992) 4. V P Kukhar', Yu L Yagupol'skii, I I Gerus, M T Kolycheva Usp. 5. V P Kukhar', N Yu Svistunova, V A Solodenko, V A Soloshonok 6. K I Pashkevich, V I Saloutin Usp. Khim. 54 1997 (1985) [Russ. Chem. 7. K I Pashkevich, V I Saloutin, I Ya Postovskii Usp. Khim. 50 325 8. V V Takhistov, A A Rodin, B N Maksimova Usp. Khim. 60 2143 (1982) [Russ.Chem. Rev. 51 736 (1982)] [Russ. Chem. Rev. 61 779 (1992)] [Russ. Chem. Rev. 61 798 (1992)] Khim. 60 2047 (1991) [Russ. Chem. Rev. 60 1050 (1991)] Usp. Khim. 62 284 (1993) [Russ. Chem. Rev. 62 261 (1993)] Rev. 54 1185 (1985)] (1981) [Russ. Chem. Rev. 50 180 (1981)] (1991) [Russ. Chem. Rev. 60 1101 (1991)] 9. E I Tsyganova, L M Dyagileva Usp. Khim. 65 334 (1996) [Russ. Chem. Rev. 65 315 (1996)] 10. G G Furin Zh. Org. Khim. 30 1704 (1994) a 11. V T Andriole (Ed.) The Quinolones (New York: Academic Press, 1988) 12. G A Mokrushina, S G Alekseev, V N Charushin, O N Chupakhin Zh. Vsesoyuz. Khim. O-va im. D I Mendeleeva 36 447 (1991) 13. R G Glushkov, I B Levshin, N B Marchenko Khim.-Farm. Zh. 1048 (1984) b 14. N Isikava (Ed.) Soedineniya Ftora.Sintez i Primenenie (Compounds of Fluorine. Synthesis and Application) (Translated into Russian; Moscow: Mir, 1990) 15. R Albrecht Prog. Drug. Res. 21 9 (1977) 16. J B Cornett, M P Wentland Annu. Rev. Med. Chem. 21 139 (1986) 17. D N Sokolov Usp. Khim. 57 1670 (1988) [Russ. Chem. Rev. 57 956 (1988)] 18. Yu S Andreichikov, G D Plakhina Zh. Org. Khim. 23 872 (1987) a 19. A P Kozlov, L I Varkentin, Yu S Andreichikov Zh. Org. Khim. 22 354 (1986) a 20. S A Khatipov, N N Shapet'ko, Yu S Bogachev, Yu S Andreichikov Zh. Fiz. Khim. 59 2097 (1985) c 21. S A Khatipov, N N Shapet'ko, Yu S Bogachev, Yu S Andreichikov Zh. Fiz. Khim. 59 2095 (1985) c 22. P N Kondrat'ev, Z E Skryabina, V I Saloutin,M N Rudaya, T A Sinitsina, K I Pashkevich Izv.Akad. Nauk, Ser. Khim. 1410 (1990) d 23. V I Saloutin, Z E Skryabina, I T Bazyl', O N Chupakhin Izv. Akad. Nauk, Ser. Khim. 362 (1993) d 24. V I Saloutin, Z E Skryabina, I T Bazyl', O N Chupakhin J. Fluor. Chem. 65 37 (1993) 25. V I Saloutin, Z E Skryabina, I T Bazyl', S G Perevalov, O N Chupakhin Zh. Org. Khim. 30 1225 (1994) a 26. R Bromme, L Claisen Berichte 21 1132 (1888) 27. L Claisen Berichte 22 3271 (1889) 28. L N Kurkovskaya, N N Shapet'ko, Yu S Andreichikov, R F Saraeva Zh. Strukt. Khim. 13 1026 (1972) e 29. N N Shapet'ko, Yu S Bogachev, I L Radushnova, D N Shigorin Dokl. Akad. Nauk SSSR 231 409 (1976) f 30. S S Berestova, N N Shapet'ko, D N Shigorin, V G Medvedeva, A P Skoldinov, G D Plakhina, Yu S Andreichikov Teor.Eksp. Khim. 15 575 (1979) g 31. N N Shapet'ko, S S Berestova, G M Lukovkin, Yu S Bogachev Org. Magn. Res. 7 237 (1975) 32. S A Khatipov, N N Shapet'ko, Yu S Andreichikov, Z M Muldakhmetov Zh. Fiz. Khim. 59 2843 (1985) c 33. N N Shapet'ko, S S Berestova, V G Medvedeva, A P Skoldinov, Yu S Andreichikov Dokl. Akad. Nauk SSSR 234 876 (1977) f 34. W S Sheldrick,W Trowitzsch Z. Naturforsch., B Chem. Sci. 38 220 (1983) 35. P N Kondrat'ev, Z E Skryabina, V I Saloutin, L M Khalilov Zh. Org. Khim. 28 1380 (1992) a 36. A A Bliznyuk, A A Voityuk Zh. Strukt. Khim. 27 (4) 190 (1986) e 37. M J S Dewar, E G Zoebisch, E F Healy, J J P Stewart J. Am. Chem. Soc. 107 3902 (1985)214 38. V I Saloutin, P N Kondrat'ev, Z E Skryabina Izv. Akad.Nauk, Ser.Khim. 902 (1993) d 39. S G Perevalov, V I Saloutin, in Molodezhnaya Nauchnaya Shkola po Organicheskoi Khimii (Tez. Dokl.), Ekaterinburg, 1998 [Youth Sci- entific School on Organic Chemistry (Abstracts of Reports), Ekater- inburg, 1998] p. 20 40. P G Baraldi, A Barco, S Benetti, S Manfredini, G P Pollini, D Simoni Tetrahedron 43 235 (1987) 41. V I Saloutin, I T Bazyl', Z E Skryabina, P N Kondrat'ev, O N Chupakhin Izv. Akad. Nauk, Ser. Khim. 299 (1994) d 42. V I Saloutin, Z E Skryabina, I T Bazyl', P N Kondratev, O N Chupakhin J. Fluor. Chem. 69 126 (1994) 43. V I Saloutin, I T Bazyl', Z E Skryabina, O N Chupakhin Izv. Akad. Nauk, Ser. Khim. 904 (1994) d 44. V I Saloutin, I T Bazyl', Z E Skryabina, G G Aleksandrov, O N Chupakhin Zh.Obshch. Khim. 64 2054 (1994) h 45. V I Saloutin, I T Bazyl', Z E Skryabina, G G Aleksandrov, O N Chupakhin J. Fluor. Chem. 74 15 (1995) 46. K Seki, J Isegawa, M Fukuda,M Ohki Chem. Farm. Bull. 32 1568 (1984) 47. V A Zagorevskii, D A Zykov Zh. Obshch. Khim. 33 2469 (1963) h 48. S I Yakimovich, V N Nikolaev Zh. Org. Khim. 17 284 (1981) a 49. S Sumimoto J. Chem. Soc. Jpn. 66 1831 (1963) 50. S Cusmano, G Sigillo Chem. Zentralblatt 1 2191 (1939) 51. V I Saloutin, Z E Skryabina, P N Kondrat'ev, S G Perevalov Zh. Org. Khim. 31 266 (1995) a 52. P N Kondrat'ev, Z E Skryabina, V I Saloutin, K I Pashkevich, N A Klyuev, G G Aleksandrov Izv. Akad. Nauk, Ser. Khim. 640 (1990) d 53. V I Saloutin, S G Perevalov J. Fluor. Chem. (1999) (in the press) 54.A T Prudchenko, V A Barkhash Zh. Org. Khim. 6 727 (1970) a 55. A N Maslivets, O P Tarasova, I S Berdinskii, Yu S Andreichikov Zh. Org. Khim. 25 1039 (1989) a 56. Yu S Andreichikov, T N Tokmanova, L N Voronova, Yu A Nalimova Zh. Org. Khim. 12 1073 (1976) a 57. V Evdokimoff Gazz. Chim. Ital. 90 1133 (1960) 58. von S Bodforss Liebigs Ann. Chem. 676 136 (1964) 59. Yu S Andreichikov, S G Pitirimova, S P Tendryakova, R F Saraeva, T N Tokmakova Zh. Org. Khim. 14 169 (1978) a 60. Yu S Andreichikov, S G Pitirimova, R F Saraeva, V L Gein, G D Plakhina, L A Voronova Khim. Geterotsikl. Soedin. 407 (1978) i 61. Yu S Andreichikov, R F Saraeva, A A Fridman Khim. Geterotsikl. Soedin. 259 (1973) i 62. Yu S Andreichikov, S P Tendryakova, Yu A Nalimova, S G Pitirimova, L A Voronova Zh.Org. Khim. 13 529 (1977) a 63. Y Iwanami, T Seki, T Inagaki Bull. Chem. Soc. Jpn. 44 1316 (1971) 64. Y Iwanami, T Inagaki J. Heterocycl. Chem. 13 681 (1976) 65. Yu S Andreichikov, L A Voronova, A P Kozlov Zh. Org. Khim. 15 520 (1979) a 66. V I Saloutin, S G Perevalov, Z E Skryabina Zh. Org. Khim. 32 1386 (1996) a 67. D B Moran, C B Ziegler Jr , T S Dunne, N A Kuck, Y-i Lin J. Med. Chem. 32 1313 (1989) 68. Z E Skryabina, G A Obanin, Y V Burgart, V I Saloutin, in International Memorial I Postovsky Conference on Organic Synthesis (Abstracts of Reports), Ekaterinburg, 1998 p. 52 69. D Barton,WD Ollis (Eds) Comprehensive Organic Chemistry Vol. 2 (Oxford: Pergamon Press, 1979) 70. A Mitchell, D C Nonhebel Tetrahedron 35 2013 (1979) 71. A F Shivanyuk, L S Kudryavtseva,M O Lozinskii Ukr. Khim. Zh. 47 1078 (1981) 72. A T Prudchenko, G S Shchegoleva, V A Barkhash Zh. Obshch. Khim. 37 2478 (1967) h 73. O G Kuzueva, Ya V Burgart, V I Saloutin Izv. Akad. Nauk, Ser. Khim. 695 (1998) d 74. A Favrel Bull. Soc. Chim. Fr. 37 1238 (1914) 75. Y V Burgart, A S Fokin, O G Kuzueva, O N Chupakhin, 76. V I Saloutin, I T Bazyl', Z E Skryabina, V M Krokhalev, 77. L S German, S R Sterlin, V F Cherstkov Izv. Akad. Nauk SSSR, 78. D Barton,WD Ollis (Eds) Comprehensive Organic Chemistry Vol. 4 V I Saloutin J. Fluor. Chem. 82 101 (1998) O N Chupakhin Izv. Akad. Nauk, Ser. Khim. 2186 (1992) d Ser. Khim. 1657 (1982) d (Oxford: Pergamon Press, 1979) V I Saloutin, Ya V Burgart, O N Chupakhin 79. V I Saloutin, I T Bazyl', Z E Skryabina, S N Shurov, S G Pereva- lov Zh. Org. Khim. 31 718 (1995) a 80. G G Yakobson (Ed.) Reaktsionnaya Sposobnost' Poliftoraromati- cheskikh Soedinenii (Reactivity of Polyfluoroaromatic Compounds) (Novosibirsk: Nauka, 1983) p. 220 81. V I Saloutin, I T Bazyl', Z E Skryabina,M I Kodess, O N Chupakhin Zh. Org. Khim. 31 1432 (1995) a 82. V I Saloutin, Z E Skryabina, Ya V Burgart, O N Chupakhin, M Font-Al'taba, Kh Solans, M Font-Bardia Izv. Akad. Nauk, Ser. Khim. 1773 (1993) d 83. V I Saloutin, Z E Skryabina, Y V Burgart, O N Chupakhin, M Font-Altaba, X Solans, M Font-Bardia J. Fluor. Chem. 69 25 (1994) 84. I T Bazyl', Z E Skryabina, V I Saloutin Zh. Org. Khim. 32 148 (1996) a 85. S G Perevalov, Z E Skryabina, V I Saloutin Zh. Org. Khim. 33 1418 (1997) a 86. A P Kozlov, D I Sychev, Yu S Andreichikov Zh. Org. Khim. 22 188 (1986) a a�Russ. J. Org. Chem. (Engl. Transl.) b�Pharm. Chem. J. (Engl. Transl.) c�Russ. J. Phys. Chem. (Engl. Transl.) d�Russ. Chem. Bull. (Engl. Transl.) e�J. Struct. Chem. (Engl. Transl.) f�Dokl. Chem. Technol., Dokl. Chem. (Engl. Transl.) g�Theor. Exp. Chem. (Engl. Transl.) h�Russ. J. Gen. Chem. (Engl. Transl.) i�Chem. Heterocycl. Comp

ISSN:0036-021X    

出版商:RSC    

年代:1999

数据来源: RSC

摘要:

Russian Chemical Reviews 68 (3) 215 ± 227 (1999) Phosphine in the synthesis of organophosphorus compounds B A Trofimov, S N Arbuzova, N K Gusarova Contents I. Introduction II. Phosphine in substitution reactions III. Phosphine in addition reactions IV. Other reactions of phosphine with organic compounds V. Conclusion Abstract. Published data on the synthesis of organophosphorus compounds based on phosphine are fully surveyed, described systematically and analysed for the first time. The bibliography includes 211 references. I. Introduction Phosphine is used in the chemistry of organic compounds of phosphorus for the formation of C± P bonds and for the synthesis of organic and heteroorganic phosphines including functionally substituted ones, which are important auxiliary reagents, building blocks, intermediate products, ligands for metal-complex cata- lysts, extractants and fire-proofing agents.1 ±11 Phosphine, possessing versatile reactivity, reacts with various classes of organic compounds (oxidants, organyl halides, alkenes, alkynes, aldehydes, ketones, oxiranes, thiiranes, amines, alcohols, esters, organyl isocyanates, etc.) both with transition into the tetracoordinated state and according to the substitution ± addi- tion patterns under conditions of base and acid catalysis and radical initiation.The interest in the chemistry of phosphine does not attenuate; in our opinion, phosphine deserves even more attention. Known methods for the synthesis of organic compounds of phosphorus based on phosphine are being developed and improved; simulta- neously, new phosphine-based methods for the synthesis of organophosphorus compounds appear (for example, the method based on the use of superbasic suspensions such as `alkali metal hydroxide ± high-polarity non-hydroxylic solvent' systems 6, 7, 12 or phase transfer catalysis 6, 7, 12).In recent years, considerable attention has been paid to nucleophilic reactions of phosphine with organyl halides 12, 13 and reactions with electrophilic aryl(hetaryl)alkenes 14 ± 20 and -alkynes 21 ± 23 in superbasic systems, which permit selective and efficient syntheses of primary, secondary and tertiary phosphines. Most of these reactions occur under mild conditions at an atmospheric pressure of phosphine.The use of these methods was greatly facilitated by the development of a convenient BATrofimov, SNArbuzova,NKGusarova Irkutsk Institute of Chemistry, Siberian Division of the Russian Academy of Sciences, ul. Favorskogo 1, 664033 Irkutsk, Russian Federation. Fx: (7-395)239 6046. Tel. (7-395) 246 1411. E-mail: (bat@acet.irkutsk.su) Received 11 June 1998 Uspekhi Khimii 68 (3) 240 ± 250 (1999); translated by Z P Bobkova #1999 Russian Academy of Sciences and Turpion Ltd UDC 547.34 215 215 218 224 225 procedure for the generation of phosphine from red phosphorus and an alkali metal hydroxide in a water-organic medium.14 Although the chemistry of organic phosphines has been the subject of numerous reviews 10, 11, 24, 25 and even mono- graphs,1, 9, 25 the reactions of phosphine with organic compounds have not been considered systematically and are represented by few examples. Several reactions of phosphine are described in monographs 1, 2, 9 and handbooks (see, for example, Ref.25). The data on the use of phosphine in the synthesis of organophospho- rus compounds published before 1961 were discussed most fully (but not exhaustively) in a short (13 pages) review,3 the bibliog- raphy of which includes 70 references. In another review,11 which is devoted to a-hydroxyalkylphosphines and -phosphine oxides, reactions of PH3 and organic phosphines with carbonyl com- pounds have been considered in detail. The purpose of the present review, in which data on the phosphine-based methods of the synthesis of organophosphorus compounds are described fully and systematically for the first time, is to provide the reader with not only general information but also data concerning particular reactions of phosphine and its organic derivatives.II. Phosphine in substitution reactions 1. Alkylation of phosphine a. Alkylation with organic halides According to patents,26 ± 29 the vapour-phase (210 ± 280 8C) cata- lytic alkylation of phosphine with alkyl halides yields alkylphos- phonium halides, their structures being dependent on the ratio of the reactants. Activated carbon or Pt, Pd and Au supported on Al2O3 or SiO2 are used as catalysts. When excess alkyl halide with respect to phosphine is used, the reaction (210 ± 280 8C, 11 atm, 85 h, activated carbon) gives tetraalkylphosphonium halides (in up to 83% yields).26, 27 [R4P+]X7 PH3+RX R=Alk(C1±C4); X=Cl, Br.The reactions of phosphine with alkyl chlorides (equimolar ratio, 280 8C, 5 days, activated carbon) afford mixtures of mono-, di- and trialkylphosphonium chlorides, monoalkylphosphonium chloride being the major product, which are converted into the corresponding phosphines on treatment with aqueous NaOH.28216 NaOH RPH2 . HCl +R2PH. HCl+R3P . HCl PH3+RCl RPH2+R2PH +R3P R=Alk, cyclo-Alk, PhCH2. Having been bound in a complex on heating (70 ± 80 8C) with an equimolar amount of AlCl3, phosphine reacts with alkyl halides,30 ± 31 cycloalkyl halides 30 and adamantyl bromide 32 to give, after the subsequent treatment of the reaction mixture with ice water and HCl, primary phosphines in 15%± 83% yields.When alkyl iodides are used, phosphorylation is complicated by side processes. Aryl halides do not enter into this reaction.30 1. RX 2. H2O 3. HCl RPH2 PH3 . AlCl3 PH3+AlCl3 R=Alk(C4±C6) (37% ± 64%), Alk(C8±C18) (62% ± 83%), cyclo-Alk (15% ± 28%); X=Cl, Br. It should be noted that even when the complex PH3 . AlCl3 reacts with excess alkyl halide, the reaction occurs as monoalky- lation; the formation of minor amounts of secondary phosphines was detected only for lower alkyl halides.30 The reactions of phosphine with alkyl halides under the Friedel ± Crafts conditions occur most likely by a carbocationic mechanism.This is indicated, in particular, by the fact that the reaction of dodecyl bromide with the complex PH3 . AlCl3 yields a mixture of primary phosphines, presumably,31 structural isomers of dodecylphosphine. The reaction of phosphine with chlorides of aromatic carbox- ylic acids in dry pyridine gives rise to tris(aroyl)phosph-ines.33 ± 35 (ArCO)3P PH3+ArCOCl Ar=Ph,33 3-MeC6H4, 4-MeC6H4, a-C10H7, b-C10H7.33 ± 35 b. Alkylation with alcohols, ethers and amines The synthesis of akylphosphines by high-temperature catalytic alkylation of phosphine with alcohols,36 ethers 36 and amines 37, 38 has been described in patents.36 ± 38 Thus aliphatic and cycloaliphatic primary and secondary phosphines are formed in good yields when phosphine reacts (200 ± 300 8C, atmospheric pressure) with alcohols and ethers in the presence of dehydrated natural and synthetic metal alumino- silicates or zeolites of various brands, the pores of which are permeable for mono- and diorganylphosphines but impermeable for triorganylphosphines.36 RPH2+R2PH+R0OH PH3+ROR0 R=Alk, cyclo-Alk; R0=H, Alk. A method for the preparation of primary, secondary and tertiary alkylphosphines by heating phosphine (150 ± 400 8C, pressure up to 2 atm) with amines in the presence of a catalyst (activated carbon, copper chromite, Group IB and VIIIB metals) has been proposed.37 RPH2+R2PH+R3P PH3+RnNH37n R=Me, Et, Pr; n=1±3.Under the same conditions, phosphine can also be alkylated by mixtures of amines with hydrogen halides and/or alkyl halides, i.e.by the corresponding ammonium salts.38 2. Reactions of phosphide ions with organic halides In the presence of strong bases, phosphine is converted into phosphide ions, which react with organyl halides by nucleophilic substitution to give primary and secondary phosphines. The role of bases in these reactions is played by the systems `alkali (or alkaline earth) metal ± organic solvent (or liquid ammonia),' B A Trofimov, S N Arbuzova, N K Gusarova organometallic compounds (triphenylmethylsodium, phenyl- lithium, butyllithium) or strong bases generated from alkali metal hydroxides in polar non-hydroxylic solvents or under conditions of phase transfer catalysis. a. Reactions of metal phosphides Phosphorylation of organyl halides by the `phosphine ± alkali (or alkaline earth) metal' systems yields predominantly primary phosphines.1, 2,39 ± 45 This reaction can be carried out for alkyl halides,39 ± 41 aryl halides,1, 42 aminoalkyl halides,43 sodium hal- ocarboxylates 44, 45 and dihaloalkanes.41, 46 ± 49 The process is carried out in an organic solvent or in liquid ammonia using stoichiometric amounts of reactants.Thus alkylphosphines and allylphosphines have been obtained in good yields (55% ± 78%) by a one-pot procedure which includes the reaction of sodium, dispersed preliminarily in hexamethylphosphotriamide (HMPA), with phosphine and the addition of alkyl halides to the resulting solution of sodium dihydrophosphide.40 RX HMPT RPH2 NaPH2 PH3+Na HMPT 7H2 R=Me, Et, CH2=CHCH2; X=Cl, Br. When calcium metal is used in this process instead of sodium and liquid ammonia is used instead of HMPA, phosphorylation becomes more efficient; for example, the reaction between chloro- methane and phosphine gives methylphosphine in 87% yield.41 MeCl NH3 MePH2 Ca(PH2)2 PH3+Ca NH3 7H2 It has been reported that aryl halides can be involved in the reaction with alkali metal phosphides.1, 42 Thus potassium phos- phide prepared from phosphine and potassium in liquid ammonia slowly reacts with bromo- and iodobenzene to give phenylphos- phine.1 A mixture of (5-isopropyl-2-methylphenyl)phosphine and 2-isopropyl-5-methylphenyl)phosphine is formed when 2-bromo- 4-isopropyl-1-methylbenzene reacts with sodium phosphide or lithium phosphide in boiling ether.42 Br MPH2+ Pri Me PH2 H2P + Me Me Pri Pri M=Li, Na.The `phosphine ± sodium ± liquid ammonia' system has been used successfully in phosphorylation of aminoalkyl halides 43 and halocarboxylic acids 44, 45 aimed at synthesising the corresponding functionalised primary phosphines. Thus (2-R,R0-amino- ethyl)phosphines have been obtained in 54%± 70% yields from 2-R,R0-aminoethyl chloride and phosphine.43 NH3 ClCH2CH2NRR0 NaPH2 PH3+Na NH3 7H2 H2PCH2CH2NRR0 R, R0=H, Et. When sodium halocarboxylates are treated with phosphine in the `sodium ± liquid ammonia' system and then the reaction mixture is treated with dilute sulfuric acid, 1- and 2-carboxy- alkylphosphines are formed in 70%± 85% yields.44, 45Phosphine in the synthesis of organophosphorus compounds NH3 XRCO2Na NaPH2 PH3+Na NH3 7H2 H2SO4 H2PRCO2H H2PRCO2Na R=CH2, CHMe, CHEt, CMe2, CH2CH2; X=Cl, Br.Under the same conditions, sodium 2,5-dibromoadipate was converted into 2,5-diphosphinoadipic acid formed as a mixture of racemic and meso forms in 45 : 55 ratio.44 H2SO4 NaPH2 + NaO2CCH(CH2)2CHCO2Na Br Br HO2CCH(CH2)2CHCO2H PH2 PH2 The synthesis of 3-carboxypropylphosphine from 4-chlorobu- tyric acid demonstrated that not only salts but also acids them- selves can efficiently react with phosphine and excess sodium in liquid ammonia.44 ClCH2(CH2)2CO2H NH3 NaPH2 PH3+Na 7PH3 7H2 H2SO4 H2PCH2(CH2)2CO2Na H2PCH2(CH2)2CO2H Thus, metallation of phosphine with an alkali or alkaline earth metal followed by treatment of the phosphide with an organyl halide results in the formation of primary phosphines of various structures in high yields.40, 41, 43 ± 45 However, this approach has scarcely been used for the synthesis of diorganylphosphines, apparently, due to the difficulty of formation of disubstituted metal derivatives upon metallation of phosphine.1 Only prepara- tion of dimethylphosphine in a relatively low yield (33%) by treatment of calcium hydrophosphide with chloromethane in liquid ammonia has been reported.41 NH3 50 8C Ca(PH2)2 .6NH3 PH3+Ca vacuum MeCl, NH3 Me2PH CaPH +PH3+6NH3 Dihaloalkanes can be phosphorylated by the `PH3 ±alkali metal ± liquid ammonia' system to give, depending on the length of the alkylene chain, either cyclic phosphines or their mixtures with primary alkylenediphosphines.The reaction of 1,2-dichloro- ethane with sodium dihydrophosphide in liquid ammonia yields phosphirane 1 as the main product (yield 74%).47 ± 49 NH3 ClCH2CH2Cl NaPH2 PH3+Na PH NH3 7H2 1 The cyclisation was suggested 47 to occur as follows: 7PH2 ClCH2CH2PH2 ClCH2CH2Cl+7PH2 7Cl7 1 . ClCH2CH2PH7 7Cl7 Methyl- and ethylphosphiranes have been prepared from the corresponding 1,2-dichloroalkanes under the same conditions (yields 30% and 25%, respectively).40 R NH3 RCHClCH2Cl NaPH2 PH3+Na PH NH3 7H2 R=Me, Et. 217 a,o-Dihaloalkanes with a number of methylene units n53 are phosphorylated by phosphine in the `sodium ± liquid ammonia' system yielding simultaneously cyclic secondary phosphines and alkylenediphosphines.48, 49 NH3 X(CH2)nX NaPH2 PH3+Na NH3 7H2 CH2(CH2)n71PH +H2P(CH2)nPH2 X=Cl, Br; n=3±7.The transformation of 1,4-dichlorobutane under these con- ditions gave a mixture of phospholane and 1,4-diphosphinobu- tane (each in 47% yield).48 Phosphine can be metallated with equal success by some organometallic compounds, for example, triphenylmethylso- dium,1 phenyllithium 1, 50, 51 and butyllithium.52 For example, when a fast stream of phosphine is passed through diethyl ether to which phenyllithium is being simulta- neously added, lithium dihydrophosphide is formed; its subse- quent treatment with organyl halide affords primary phosphines in 65% ±75% yields.50 RX RPH2 LiPH2 PH3+PhLi R=Et, Prn, But, PhCH2; X=Cl, Br.Depending on the reactant ratio, the reaction of butyllithium with phosphine gives rise to lithium phosphide, trilithium phos- phide or its mixture with dilithium phosphide. The reactions of these phosphides with chlorotrimethylsilane at 0 ± 10 8C resulted in the formation of trimethylsilylphosphine (yield 30%), a mixture of bis- and tris(trimethylsilyl)phosphines (yields 35% and 24%, respectively) or tris(trimethylsilyl)phosphine (yield 45%).52 Me3SiCl Me3SiPH2 LiPH2 Me3SiCl BuLi (Me3Si)2PH+(Me3Si)3P Li2PH+Li3P PH3 Me3SiCl (Me3Si)3P Li3P b. Reactions of phosphine in the presence of a strong base Methylation was the first example of alkylation of phosphine with an organyl halide in the presence of a strong base .53, 54 When methyl iodide is added to a DMSO suspension of KOH prelimi- narily saturated with phosphine, methylphosphine or dimethyl- phosphine is formed, depending on the initial ratio of reactants (yields 75%53 and 65%,54 respectively).2MeI Me2PH KOH, DMSO PH3 MeI MePH2 Later, other organyl halides have also been involved in this reaction; this gave monoorganylphosphines in 70% ±94% yields.12 The reaction was carried out in a mixture of a 56%± 64% aqueous solution of KOH with DMSO (depending on the nature of the halide used, the temperature and pressure varied in the ranges 0 ± 60 8C and 4 ± 7.5 atm). KOH, DMSO(H2O) RPH2 PH3+RX R=Me, Et, CH2=CHCH2, Bun, But, PhCH2; X=Br, Cl.Diallyl- and dibutylphosphines were obtained in this reaction (yields 53% and 23%, respectively) by using a two- or four-fold excess of potassium hydroxide with respect to the corresponding organyl bromide.12218 KOH, DMSO (H2O) R2PH PH3+RBr R=Bu, CH2=CHCH2. No products of the possible prototropic rearrangement � propen-1-yl- or di(propen-1-yl)phosphines�have been obtained under these conditions, although this rearrangement does occur during phosphorylation of allyl halides with red phosphorus in a highly basic aqueous-organic emulsion.5, 55, 56 Recently dibenzylphosphine has been prepared in 50% yield from phosphine and benzyl chloride.13, 57 The reaction occurs under mild conditions (atmospheric pressure, 40 8C). Benzyl chloride is slowly added to a suspension of KOH in DMSO in the presence of a slight amount of water and simultaneously, a phosphine ± hydrogen mixture, generated from red phosphorus and an alkali metal hydroxide, is vigorously passed through the suspension.KOH, DMSO (H2O) (PhCH2)2PH PH3±H2+PhCH2Cl This reaction gives as well a noticeable amount of dibenzyl ether (up to 20%) resulting from solvic transformations of benzyl chloride.13 KOH, DMSO(H2O) H2PCH2CH2CHPH2 PH3+BrCH2CH2CHBr R R R=H, Me. KOH, DMSO(H2O) PH3+BrCH2(CH2)2CHBr Me+H2PCH2(CH2)2CHPH2 Me H P Me Unlike reactions of metal phosphides with dihalopropane, which afford phosphorus-containing heterocycles 48, 49 (Section II.2.a), the reactions of phosphine with 1,3-dihalopropane or -butane in the KOH±DMSO(H2O) system give only acyclic products, 1,3-diphosphinopropane or -butane (yields 59% and 75%, respectively).12 Phosphorylation of 1,4-dibromopentane under similar con- ditions gives rise to 2-methylphospholane (yield 80%), only minor amounts of the corresponding acyclic product, 1,4-diphosphino- pentane, being formed.12 Alkylation of phosphine with organyl halides has also been carried out in the presence of bases generated under conditions of phase transfer catalysis, i.e.in the systems `aqueous potassium hydroxide ± organic solvent (toluene, pentane) ± tetraalkylammo- nium or tetraalkylphosphonium salt.'12, 58, 59 Depending on the reactant ratio and the reaction conditions (temperature, pressure), primary or secondary phosphines are formed in the 55% ±92% yields. RX RPH2 KOH, H2O PH3 R0X R02PH R=Alk(C1±C24), CH2=CHCH2,12, 58 PhCH2,58 CH2CH2,12 Ph2PCH2;59 R0=Me,12 Ph2PCH2;59 X=Cl, Br.N1,3-Dihaloalkanes react with phosphine under the conditions of phase transfer catalysis to give, as in the KOH±DMSO system,12 1,3-diphosphinoalkanes in yields of up to 89%.12, 58 B A Trofimov, S N Arbuzova, N K Gusarova KOH, H2O H2PCH2CH2CHPH2 PH3+XCH2CH2CHX R R R=H, Alk; X=Cl, Br. III. Phosphine in addition reactions 1. Addition to C=C bonds The reaction of phosphine with alkenes is a convenient method for the synthesis of organic phosphines. Phosphine can add to C=C bonds by both ionic and radical mechanisms.The reaction path- way is determined by its conditions and the nature of the alkene used. a. Nucleophilic addition Nucleophilic addition of phosphine to the C=C bond was first described by Rauhut et al.60, 61 for alkenes containing strong electron-withdrawing substituents at the sp2 carbon atom. In the presence of bases (a 10 M aqueous solution of KOH, hepta- methylbiguanide, a concentrated solution of ammonia, solid sodium hydroxide), phosphine reacts with acrylonitrile,60, 62 acryl- amide, nitroethylene, mesityl oxide and lauryl acrylate 61 to give a mixture of primary, secondary and tertiary phosphines. PH3+RCH CH2 RCH2CH2PH2+(RCH2CH2)2PH +(RCH2CH2)3P R=CN, CONH2, NO2, etc.The process selectivity can be increased by varying its con- ditions (the molar ratio and the rate of mixing of the reactants, temperature, heating duration or pressure).60, 61 For example, when a flow of phosphine is passed through the system `aqueous KOH± acetonitrile' heated to 30 ± 35 8C and acrylonitrile is simultaneously added to it, the addition rate being adjusted in such a way as to maintain a slight excess of acrylonitrile relative to phosphine, tris(2-cyanoethyl)phosphine is obtained in 80% yield. A decrease in the concentration and the rate of addition of acrylonitrile under the same conditions results in bis(2-cyano- ethyl)phosphine being formed predominantly (yield 63%). The primary phosphine is formed in 52% yield in the phosphorylation of acrylonitrile in an autoclave under an elevated pressure of phosphine (28 ± 32 atm).60 In the 1970s, a series of studies was published on the nucleophilic addition of phosphine to dialkyl vinylphospho- nates,63, 64 vinyldialkylphosphine sulfides,65, 66 and even to rela- tively weak electrophiles � vinyldiphenylphosphine 67 ±70 and vinylphosphonous diamides.71 The reactions occur in boiling THF in the presence of ButOK,63 ± 66, 70 or in benzene in the presence of PhLi at 100 8C (autoclave),67 ± 69 or in the `metallic potassium ± liquid ammonia' system 71 and result in the formation of functionalised tertiary phosphines 2a ± e, their yields ranging from 24% (2a) to 95% (2e).ButOK PH3+R2P(X)CH CH2 or PhLi [R2P(X)CH2CH2]3P 2a ± e R=Ph (a), Me2N (b), X is absent; R=Me2CHO (c), X=O; R=Me (d), Me3CCH2 (e), X=S. Recently 14 ± 21 it has been found that phosphine is capable of adding to weakly electrophilic C=C bonds in aryl and hetaryl- ethenes in theKOH±DMSOsystem, and preparative methods for the synthesis of bis- and tris(2-arylethyl)- and -(2-hetaryl- ethyl)phosphines have been developed.In the absence of KOH, all other factors being the same, phosphorylation does not occur, which confirms the nucleophilic mechanism of the reaction. Phosphine is generated as a mixture with hydrogen by the addition of an aqueous solution of KOH (or NaOH) to a suspension of red phosphorus in dioxane.14Phosphine in the synthesis of organophosphorus compounds Bis(2-arylethyl)- and bis(2-hetarylethyl)phosphines have been selectively synthesised in 60% ± 80% yields by slow addition of an alkene to a suspension of KOH in DMSO heated to 45 ± 60 8C with simultaneous vigorous passing of a phosphine stream through the suspension.14 ± 20 KOH, DMSO (H2O) (RR0CHCH2)2PH PH3+RR0C CH2 45± 60 8C ; R=H, R N 0=Ph, 4-FC6H4, , , ,Me O S N R=Me, R0=Ph.1-Methyl-2-vinylpyrrole could not be involved in the reaction with phosphine, apparently, because of the low electrophilicity of the double bond in this alkene (due to the electron-donating mesomeric effect of the 1-methyl-2-pyrrolyl group).14 Exhaustive and selective aryl(hetaryl)ethylation of phosphine by styrene and vinylpyridines occurs at 95 ± 98 8C and 65 ± 67 8C, respectively, in the KOH±DMSO system, giving rise to tris(2- phenylethyl)-, tris[2-(4-pyridyl)ethyl]- and tris[2-(2-methyl-5-pyr- idyl)ethyl]phosphines (yields 65%± 76%).18, 19 KOH, DMSO(H2O) (RCH2CH2)3P PH3+RCH CH2 67 ±98 8C , Me .R=Ph, N N When this reaction is conducted at a lower temperature (30 ± 40 8C), the corresponding primary phosphines can also be obtained in 20%±24% yields. However, bis(2-phenylethyl)- and bis(2-pyridylethyl)phosphines are the main reaction products under these conditions.19, 20 It has been noted that a base generated under the conditions of phase transfer catalysis (a 60% aqueous solution of KOH± dioxane ± benzyltrimethylammonium chloride) is not sufficiently strong to enable phosphorylation of arylalkenes and vinylpyr- idines with phosphine.19 An unsuccessful attempt to carry out the reaction of phos- phine with diphenylethene and fumaronitrile in the presence of a base has been reported.72 b.Electrophilic addition The acid-catalysed addition of phosphine to unsaturated com- pounds is relatively little studied. It has been reported 73, 74 that alkenes of various structures (linear and branched alkenes, cyclo- alkenes, polypropenes, polybutenes, styrene, limonene, etc.) react with phosphine under relatively rigorous conditions (60 ± 90 8C, 30 ± 47 atm, acid catalysis) according to the Markovnikov rule to give mostly primary phosphines. H+ PH3+RR0C CH2 MeCR(R0)PH2 R, R0=H, Alk(C1±C63), Ph, etc. Best results in this reaction are obtained when 1,1-disubsti- tuted alkenes are used, because they form the most stable intermediate tertiary carbocations and in addition, they are the least susceptible to cationic polymerisation. + + H+ PH3 H2PCR2Me H3PCR2Me R2C Me R2C CH2 7H+ Thus the highest yield (90%) of the primary phosphine was observed when phosphine was made to react with C12-polypro- pene.73 The reaction of phosphine with 2-methylprop-1-ene, 2-ethylhex-1-ene and 1-methylcyclopentene is less efficient (the yield of the corresponding primary phosphines is 41%± 75%), which is apparently due to the fact that these alkenes are more prone to undergo polymerisation than C12-polypropene.Phos- phorylation of linear alkenes, ethene, propene and dodec-1-ene, results in even lower yields (14% ± 20%) of primary phosphines. 219 Among the catalysts tested in the reaction of phosphine with alkenes (mineral and organic acids, sulfonic acids, Lewis acids), methanesulfonic acid is the most active.73 It should be noted that forhis reaction to go to completion, almost stoichiometric amounts of acid catalysts are needed, because the monoalkyl- phosphines, which are formed in the process, are stronger bases than phosphine; therefore, they react reversibly with the acid to give phosphonium ions.RP+H3 RPH2+H+ The reactions of phosphine with some alkenes (styrene, limonene) in an acid medium are accompanied by polymerisation giving rise to telomeric phosphines.74 Since the electrophilic addition of phosphine to alkenes is a carbocationic process, the reactions of linear alkenes with phos- phine under these conditions may be accompanied by isomer- isation of the hydrocarbon chain (as has been shown in relation to the interaction of phosphine with alkyl halides in the presence of AlCl3).31 However, in the study cited,73 this aspect is not consid- ered.kenes,75, 76, 78, 80, 81, 85, 90 c. Radical addition The addition of phosphine to alkenes under conditions of radical initiation [organic peroxides, azobisisobutyronitrile (AIBN), UV irradiation] has been studied fairly comprehensively. This method is used to prepare organic phosphines of various structures, because this reaction has been performed for a broad range of unsaturated organic compounds including functionally substi- tuted ones: linear unsubstituted alkenes with a terminal 74 ± 88 or (more rarely) internal 80, 81, 93, 94 double bond, cycloal- arylalkenes,75, 78, 80, 81, 90 dienes,78, 79, 90, 113 ± 118 trienes,119 fluorinated alkenes,103 ± 109 vinyl 75, 80, 81 and divinyl 111, 112 ethers and thioethers,80, 81 alco- hols,76, 80, 81, 85, 95 amines,76, 80, 81 ketones,80, 81 acrylic acid deriva- tives,75, 80, 81, 96 ± 98 and allyl 80, 81 and vinyl 99, 100 carboxylates and phosphonates.80, 81, 85 Radical addition of phosphine to alkenes normally results in the formation of mixtures of primary, secondary and tertiary phosphines, their ratio being dependent most of all on the ratio of the initial reactants.75, 77 PH3+RCH CH2 RCH2CH2PH2+(RCH2CH2)2PH+(RCH2CH2)3P R=Alk, Ph, H2NCH2, HOCH2, MeO, BuO, MeS, MeO2C, EtO2C, Me(CH2)3CH(Et)CH2O2C, etc.Primary phosphines are formed as the major products when a substantial excess of phosphine in relation to alkene is used.75, 78, 79 Octylphosphine is formed in 65% yield when a mixture of phosphine with oct-1-ene (molar ratio 3.6 : 1) is heated (78 ± 89 8C, AIBN) at a pressure of *33 atm. The yields of dioctyl- and trioctylphosphines under these conditions are 18% and 4%, respectively.75 An even higher yield (80%) of octylphos- phine was attained when the reaction was carried out at a phosphine pressure of 120 ± 180 atm,78 because at higher phos- phine pressures, its solubility in the liquid phase increases and, hence, the yield of primary phosphine also increases.75 A similar influence of high pressures of phosphine on the yield of the reaction product was observed 75 for 2-methylprop-1-ene.Tertiary phosphines are prepared in high yields (70% ± 96%) by using excess alkene with respect to phosphine.75, 76, 80 ± 85 For instance, phosphorylation of oct-1-ene by phosphine at a molar ratio of 3 : 1 (80 ± 100 8C, pressure 3.3 atm, AIBN) afforded trioctylphosphine in 83% yield.75 The synthesis of tributylphos- phine in a nearly quantitative yield (96%) from phosphine and but-1-ene under conditions of radical initiation is described in a patent.83220 However, the yield of secondary phosphines in the radical addition of phosphine to alkenes is, as a rule, relatively low (20%± 30%).75 Naturally, the structure of the alkene used also has an influence on the ratio of primary, secondary and tertriary phos- phines formed in the alkylation of phosphine with alkenes.Steri- cally hindered alkenes (2-methylpropene, but-2-ene,80, 81, 93, 94 cyclohexene 75, 76, 78, 80, 81, 85, 90) react less vigorously than, for example, oct-1-ene to give mostly primary and secondary phos- phines even when an excess of alkene with respect to PH3 is used. UV irradiation of an equimolar mixture of phosphine and styrene gives rise to phenethylphosphine.81 The same product is formed, together with bis(phenethyl)phosphine (yields 36% and 29%, respectively), when styrene is phosphorylated with a 1.5-fold molar excess of phosphine in the presence of AIBN (80 8C, *28 atm).75 Phosphorylation of fluorine-substituted alkenes with phos- phine is activated by heating (150 ± 160 8C)103 ± 105 or UV radia- tion.106 ± 109 This reaction gives mostly primary phosphines, the yields of which are higher (up to 74%± 91%) in the case of UV activation. The reactions of phosphine with alkyl vinyl ethers,75, 80, 81 alkyl vinyl sulfides,80, 81 allylamines 76, 80, 81 and allyl alco- hol 76, 80, 81 (a two-fold molar excess of the corresponding alkene was normally used) occurring on exposure toUVradiation 76, 80, 81 or in the presence of AIBN (80 8C, 31 atm)75 afford mostly primary and secondary phosphines (total yield 50%± 75%); the yields of tertiary phosphines do not exceed 10%.On exposure of an equimolar mixture of phosphine and vinyl methyl ketone to UV radiation, (2-acetylethyl)phosphine was formed as the major product.80, 81 A complex mixture of phosphines is formed when ethyl acrylate is made to react with phosphine (70 ± 100 8C, AIBN, 28 atm).75 The reaction products contain not only the expected primary, secondary and tertiary phosphines 3a ± c (yields 21%, 20% and 23%, respectively) but also bis(2-ethoxycarbonylethyl)- 2,4-diethoxycarbonylbutylphosphine 4 (yield 19%). PH3+EtOOCCH CH2 EtOOCCH2CH2PH2+ 3a +(EtOOCCH2CH2)2PH+(EtOOCCH2CH2)3P+ 3b 3c +(EtOOCCH2CH2)2PCH2CH(COOEt)CH2CH2COOEt 4 The phosphine 4 is formed apparently upon the addition of bisphosphine 3b to diethyl a-methyleneglutarate resulting from dimerisation of the initial ethyl acrylate.3b 4 EtOOCCH2CH2(EtOOC)C CH2 EtOOCCH CH2 The radical addition of phosphine (AIBN, 90 ± 120 8C, 15 atm) to acrylonitrile at a molar ratio of the reactants of 2.9 ± 3.2 : 1 occurs selectively to give tris(2-cyanoethyl)phosphine in 93% yield.97, 98 Nevertheless, the synthesis of this tertiary phosphine from acrylonitrile and phosphine under the conditions of base catalysis (Section III.1.a) is undoubtedly more convenient and practically feasible, because it readily occurs on moderate heating (25 ± 30 8C) under atmospheric pressure.60 A mixture of primary, secondary and tertiary phosphines 5a ± c is produced upon photochemical addition of phosphine to allyl 80, 81 and vinyl 99, 100 carboxylates (most often, to vinyl acetate).hn PH3+RCH CH2 5c 5b RCH2CH2PH2+(RCH2CH2)2PH +(RCH2CH2)3P 5a R=MeCO2, MeCO2CH2. B A Trofimov, S N Arbuzova, N K Gusarova Photoinitiated addition of phosphine to vinyl- 80, 85 and allyl- phosphonates 81 has been described. Thus UV irradiation of an equimolar mixture of phosphine and dibutyl allylphosphonate gave 3-(dibutoxyphosphoryl)propylphosphine.81 hn (BuO)2PCH2CH2CH2PH2 PH3+(BuO)2PCH2CH CH2 O O NMR analysis of the reaction mixture obtained upon UV irradiation of phosphine and diketene in the presence of AIBN showed the presence of 2-oxo-4-oxetanylmethyl- (6) and bis(2- oxo-4-oxetanylmethyl)phosphines 7; these products were not isolated because of their low stability.101 H2C O hn PH3+ AIBN O H2PH2C HP H2C O O + O O 2 7 6 The addition of phosphine to terpenes and their derivatives in the presence of AIBN has been patented.102 On exposure of a mixture of allene and phosphine to UV radiation, the first representative of primary vinylphosphines, propen-2-ylphosphine, was obtained in 3% yield.110 hn C(Me)PH2 CH2 C CH2 PH3+CH2 Under conditions of radical initiation (AIBN, 50 ± 70 8C, 10 ± 20 atm), phosphine reacts with penta-1,4-diene to give phosphor- inane.79 PH CHCH2CH CH2 PH3+CH2 The radical addition of phosphine to divinyl ether (AIBN or UV irradiation, 75 ± 80 8C, 10 atm) results in the formation of both a cyclic phosphine (4-oxaphosphorinane) and a linear primary diphosphine (the yield of each product is 7%± 10%).111, 112 O CHOCH CH2 PH3+CH2 PH+(H2PCH2CH2)2O According to patent data,113 the reaction between phosphine and dicyclopentadiene under conditions of radical initiation (AIBN or organic peroxides, 90 8C, 3 ± 20 atm) gives rise to a mixture of isomeric secondary phosphines with the composition C20H27P.It was proposed to use this mixture as a ligand for the preparation of metal-complex catalysts and also as a flotation reagent.113 Bicyclic secondary phosphines are formed upon homolytic addition of phosphine to 4-vinylcyclohex-1-ene 114 and to cyclic dienes.78, 90, 115±118 Thus heating (70 ± 180 8C) cycloocta-1,5-diene with phosphine under a pressure of 30 ± 40 atm in the presence of AIBN or organic peroxides affords a mixture of 9-phosphabicy- clo[3.3.1]nonane and 9-phosphabicyclo[4.2.1]nonane (in a total yield of up to 96%, ratio 1 : 0.8).115 + PH PH PH3+ Prolonged (79 h) g-irradiation (60Co) of a mixture of phos- phine and cyclododeca-1,5,9-triene has given rise to isomeric tricyclic phosphines 8 and 9 (overall yield 20%).119Phosphine in the synthesis of organophosphorus compounds + PH3+ P P 9 8 d.Addition in the presence of heterogeneous and metal-complex catalysts Data on the interaction of phosphine with branched and cyclic alkenes and with dienes in the presence of heterogeneous solid catalysts (zeolites, phosphates and metal oxides) at an elevated pressure (8 ± 190 atm) and at temperatures of 100 ± 200 8C have been reported.120 Thus heating of phosphine and 2-methylpro- pene in an autoclave (200 8C, 190 atm) in the presence of a borosilicate zeolite gave tert-butylphosphine in 70% yield.120 Me3CPH2 PH3+Me2C CH2 As noted above (Section III.1.b), this reaction can be carried out under milder conditions (60 8C, 33 atm) in the presence of methanesulfonic acid, tert-butylphosphine being formed in a comparable yield (61%).73 The addition of phosphine to acrylonitrile has been accom- plished in the presence of metal-complex catalysts [a mixture of P(CHR(OH))3, where R=H121, 122 or Alk (C1±C6),122 with reduced iron121 or chloroplatinic acid 122].The reaction occurs in the medium of a lower aliphatic alcohol at room temperature to give tris(2-cyanoethyl)phosphine.121, 122 However, this compound can be easily prepared without expensive metal-complex catalysts by cyanoethylation of phosphine with excess acrylonitrile in the presence of an aqueous solution of KOH60 (Section III.1.a). 2.Addition to C:C bonds Known examples of the addition of phosphine to triple carbon ± carbon bonds are limited to phosphorylation of aryl- and hetar- ylalkynes.21 ± 23 The reaction proceeds under mild conditions (55 ± 60 8C, atmospheric pressure) upon passing a phosphine ± hydro- gen mixture, generated from red phosphorus and potassium hydroxide in aqueous dioxane, through an alkyne ±KOH± HMPA (H2O) suspension. The reaction occurs stereoselectively to give tris(Z-2-organylvinyl)phosphines 10 in 60% ±80% yields. R R P PH3+RC CH 10 R ., R=Ph, 4-FC6H4, O S The kinetic control of this reaction was confirmed by the thermal transformation (160 ± 165 8C, 7 h) of tris[(Z)-styryl]- phosphine into the complete E-isomer via the intermediate for- mation of the corresponding mixed E,Z,Z- and E,E,Z-isomers.123 In the absence of KOH, all other factors being the same, phosphine does not react with alkynes, pointing to a nucleophilic mechanism of this process. Unlike the reactions of phosphine with aryl- and hetarylal- kenes (Section III.1.a), the addition of phosphine to alkynes in highly basic suspensions (KOH±HMPA) cannot be terminated at the stage of formation of mono- or diadducts;22 this has been explained 7 by the fact that vinylphosphines are more acidic than alkylphosphines.3. Addition to C=O bonds a. Reactions of phosphine with aldehydes Although the first data concerning the reactions of phosphine with aliphatic aldehydes in the presence of hydrogen halides to give tetrakis(1-hydroxyalkyl)phosphonium halides were reported back 221 in 1888 124 and in 1921,125 this reaction has not attracted attention of researchers for a long period. Only 35 years later, did a series of studies appear126 ± 134 in which tetrakis(hydroxymethyl)phosphonium salts were prepared in quantitative yields by passing a flow of phosphine through an aqueous or aqueous-organic solution of formaldehyde (710 to 40 8C, atmospheric pressure) in the presence of acids. + HnXn7 O [(HOCH2)4P] n Xn7 PH3+H2C H2O X=Cl7, F7, SO2¡ 4 , MeCOO7, 7OOC7COO7; n=1, 2.This reaction, which occurs presumably 2 via the intermediate formation of the H2C+OH cation, has also been carried out for non-branched aliphatic aldehydes.128, 135, 136 In the presence of heavy metals (Fe, Pt, Pd, Hg, Ag) or their salts (PtCl4, HgCl2, etc.), phosphine reacts with an aqueous solution of formaldehyde to give, depending on the ratio of the reactants 137 ± 139 and the nature 140 and the amount 130 of the catalyst, either tetrakis(hydroxymethyl)phosphonium hydroxide 11 128, 130, 134, 137, 138, 140 or tris(hydroxymethyl)phosphine 12.130, 139 ± 142 In the acid-catalysed reaction the latter product was not detected.126 ± 134 4H2C O + H2O PH3 3H2C O [(HOCH2)4P] 7OH 11 (HOCH2)3P 12 Since the phosphine 12 has also been obtained by treatment of the phosphonium hydroxide 11 with PH3 in the presence of heavy metals or heavy metal salts,11, 139 it can be suggested that the compound 12 is formed via the compound 11. Hydroxyalkylation of phosphine is a general reaction, which has been described for a broad range of aliphatic, unsaturated, aromatic and heteroaromatic aldehydes including acrolein, glyoxal, cinnamaldehyde and furfural.Tris(1-hydroxyalkyl)phos- phines can be readily prepared by this reaction in high yields (up to 92%).143 R PH3+3RCHO CH 3P HO R=Me, Et, CH=CH2, Ph, 2-FC6H4, Cl3C, etc. If phosphorylation of aldehydes with phosphine is carried out in the presence of a co-reagent, for example, an organyl halide or an alcohol, and a heavy metal or a heavy metal salt, non- symmetrical phosphonium compounds 13 can be obtained.144 ± 146 + PH3+3RCHO+R0X {R0P[CH(OH)R]3} X7 13 R=H, Alk, Ar; R0=Alk, CH2=CHCH2, PhCH2, HOCH2CH2, O O CH2 ; X=Hal, OH., CH2I, Benzaldehyde reacts with phosphine in methanol saturated with HCl 131, 147 to give tris[methoxy(phenyl)methyl]phosphine 14 in 85% yield. Phosphorylation of benzaldehyde with phosphine in the medium of C2±C4 alcohols gives the corresponding secondary phosphines 15 as the main products (yield 80%± 90%).147 MeOH HCl PH3+PhCHO ROH [PhCH(OMe)]3P 14 [PhCH(OR)]2PH 15 R=Et, Prn, Pri, Bun. In the absence of alcohol, benzaldehyde reacts with the PH3 ± HCl system to give, in addition to the tris[hydroxy(phenyl)-222 methyl]phosphine, 2,4,6-triphenyl-1,3,5-dioxaphosphorinane 16 (in a yield of up to 40%).147 Ph O PH3 ± HCl PH PhCHO [PhCH(OH)]3P+Ph 14 O 16 Ph 1,3,5-Dioxaphosphorinanes 17 are the main products of the reaction of phosphine with aliphatic aldehydes substituted at the a-carbon atom carried out in an acid medium.135, 148 ± 151 CH(R0)R O H+ PH R(R0)CH PH3+3 R(R0)CHCHO 7H2O O 17 CH(R0)R R=R0=Me (78%); R=Et, R0=Bu (90%). Apparently, the addition of the secondary phosphines [R(R0)CHCH(OH)]2PH, formed initially in this reaction, to a third aldehyde molecule involves the hydroxy group rather than the PH group and thus gives an acetal fragment.151 Unlike the hydroxyalkylation of phosphine with aldehydes in dilute acids, which gives phosphines,3, 131, 147 the reaction of PH3 with aromatic aldehydes in concentrated aqueous solutions of HCl, HBr and H2SO4 affords tertiary phosphine oxides 18 (yield 35%± 65%),152, 153 apparently as a result of transfer of the aldehyde oxygen atom to phosphorus (the mechanism of this process is described in Section III.3.b).H+ ArCH2P[CH(OH)Ar]2 PH3+ArCHO 18 O X0 Ar=X ; X=H, Alk(C1±C4), Cl; X0=H, Cl. Dialdehydes (glutaric, succinic,135, 151, 154 phthalic,154 etc.) are usually phosphorylated with phosphine in the presence of con- centrated aqueous HCl to give spirophosphonium salts 19 in up to 65% yields. OH OH HCl +PCl7 (CH2)n PH3+HOC(CH2)nCOH (H2C)n OH OH19 n=2, 3.a-Halo-containing aldehydes, for example, chloral,135, 155, 156 dichloroacetic,135, 156 trifluoroacetic, 2,2-dichlorobutyric and 2,2,3-trichlorobutyric 156 aldehydes react with phosphine in the presence of acids 135, 155, 156 or without acids in an organic solvent (ether) 155 to give secondary phosphines 20 in high yields (80% ± 90%). HCl PH3+RCHO [RCH(OH)]2PH 20 R=CCl3, CHCl2, CF3, EtCCl2, MeCHClCCl2. It has been reported 157 that tris(2,2,2-trichloro-1-hydroxye- thyl)phosphine is formed in 75% yield from chloral andPH3 in the presence of aqueous HCl. However, later it has been shown 158 that passing phosphine through the chloral hydrate ± HCl ±H2O system yields initially tris(2,2,2-trichloro-1-hydroxy- ethyl)phosphine, which then undergoes disproportionation with PH3 to give a secondary phosphine, bis(2,2,2-trichloro-1-hydr- oxyethyl)phosphine.HCl PH3 [Cl3CCH(OH)]2PH [Cl3CCH(OH)]3P PH3+Cl3CCHO B A Trofimov, S N Arbuzova, N K Gusarova The reaction of phosphine with chloral in the presence of concentrated HCl gave only tris(2,2,2-trichloro-1-hydroxy- ethyl)phosphine in 92% yield.158 Phosphorylation of fluorinated aldehydes with phosphine occurs under mild conditions (for example, in the case of trifluoro- acetic aldehyde, on cooling to 770 8C), requires no catalyst and affords tertiary phosphines 21 in 50%±94% yields.159 PH3+RCHO [RCH(OH)]3P 21 R=F3C, CF2CHF2, (CF2)4H. It should be noted that in the absence of a catalyst, phosphine reacts with formaldehyde only at elevated temperatures (80 ± 150 8C) and pressures (4 ± 40 atm) 160 ± 168 to give, depending on the ratio of the reactants, tris(hydroxymethyl)phosphine 160 ± 164 or tetrakis(hydroxymethyl)phosphonium hydroxide.165, 166 Phosphorylation of formaldehyde with phosphine in the presence of secondary amines follows the Mannich reaction pattern giving rise to tertiary aminomethylphosphines 22.169 ± 171 PH3+H2C O+3HNRR0 P(CH2NRR0)3+3H2O 22 R=Alk, cyclo-Alk, Ar; R0=H, Alk.b. Reactions with ketones Being weaker electrophiles than aldehydes, unsubstituted ali- phatic ketones do not react with phosphine in the absence of acids or catalysts even under relatively rigorous conditions (100 8C, elevated pressure);172 in the presence of hydrogen halides in anhydrous solvents 2, 11, 124 or in dilute aqueous solutions of acids 173 ± 175 the reaction does not occur either.However, in the presence of concentrated mineral acids, phosphine adds to ketones at 60 8C and 2 ± 3 atm to give a mixture of primary alkylphosphine oxides 23 and secondary alkyl(1-hydroxyalkyl)- phosphine oxides 24.173± 175 O R R R H+ RCOR0 PH3+RCOR0 CHPH2 R0 R0 CHPHCOHR0 23 24 O R=R0=Me, Et; R=Me: R0=Pr, Ph; R±R0=(CH2)4, (CH2)5. The primary phosphine oxides 23, which were first synthesised by this method, are formed, in the opinion of the researchers cited,173 upon the transfer of the oxygen atom from carbon to phosphorus according to the following scheme: OH + H+ RCPH2 RCPH2 PH3+RCOR0 7H+ 7H2O R0 R0 OH H2O 23 .RC PH RCHPH R0 R0 The second stage of the process, which gives rise to the phosphine oxides 24, occurs as the normal addition of the P ±H bond to the carbonyl group.173 The 23 : 24 ratio depends on the structure of the initial ketone and increases in the sequence cyclohexanones< cyclopentanone<acetone<pentan-2-one < heptan-2-one < pentan-3-one < acetophenone < heptan-4-one from 1 : 9 (for cyclohexanone) to 9 : 1 (for heptan-4-one).173, 174 Trifluoro- 176, 177 and hexafluoroacetone 172, 177 react with phosphine without a catalyst at an elevated temperature (60 ± 100 8C) and pressure (10 ± 30 atm) to give primary phosphines 25 in 85% and 62% yields, respectively.Phosphine in the synthesis of organophosphorus compounds OH PH3+RCOCF3 CF3CPH2 R 25 R=Me, CF3.It is believed 172, 176, 177 that the reaction stops at the stage of formation of the primary phosphines 25 because these products are less nucleophilic than PH3. However, recently the synthesis of a secondary phosphine, bis[(1-hydroxy-1-trifluoromethyl)-ethyl]- phosphine, from phosphine and trifluoroacetone has been reported.178 Phosphine and hexafluorocyclobutanone readily react at room temperature to give primary (26) and secondary (27) phosphines. When excess ketone is used, the yield of the phos- phine 27 amounts to 91%.179 F2 C FC2 CF2 PH3+F2C CF2 + F2C C C OH PH2 O 26 F2 C FC2 PH C C + F2C CF2 OH HO CF2 CF2 27 The reaction of 1,5-diketones 28 with phosphine occurs in the presence of HCl as addition ± cyclisation with simultaneous trans- fer of oxygen on the phosphorus atom and results in the formation of 2-hydroxyphosphorinane 1-oxides 29 (yield 30%± 80%).180 ± 182 R3 R2 R3 R4 R4 R2 HCl R1 PH3+R1CCHCHCHCR5 HO R5 P 28 O O O H 29 R1=R5=Ph, R2=R3=R4=H; R1±R2=(CH2)4, R3=R4=H, R5=Ph; R1±R2=R4±R5=(CH2)4, R3=Ph; R1±R2=(CH2)4, R3=R5=Ph, R4=H; R1±R2=CH2CMe2OCH2, R3=R5=Ph, R4=H.Unlike 1,5-diketones, 1,3-diketones 30 react with phosphine in the presence of concentrated HCl to give tricyclic phosphines 31.183 ± 185 The reaction occurs apparently via the intermediate secondary phosphine 32, which forms from two 1,3-diketone molecules; this intermediate undergoes intramolecular cyclisation involving the cross attack on the carbonyl carbon atoms by the hydroxy groups and elimination of water.O O R R HCl HO OH PH3+2RCCH2CR O R R O30 H P 32 OH O R R R R OH O O R P P 7H2O HO H O R R 31 R R=Me, CF3. 223 Tricyclic phosphine 33 with three lactone rings has been obtained from phosphine and pyruvic acid.153, 186 COOH HO OH C HCl PH3+3MeCCOOH P C COOH Me Me 73H2O C O Me HOOC OH O O Me Me P O O O O Me 33 The general character of this reaction was confirmed by involvement of some other oxo acids into the interaction with phosphine.186 4. Addition to C=N bonds The addition of phosphine to organyl isocyanates occurs in the presence of triethylamine (room temperature, 2 ± 3 atm, anhy- drous benzene), involves the C=N bond and gives rise to tricarbamoylphosphine derivatives 34, their yields being depend- ent on the nature of the substituent in the isocyanate and ranging from 13% (phosphorylation of phenyl isocyanate) to 100% (the reaction with nitrophenyl isocyanate).187 ± 189 O RNHC Et3N C O CNHR P PH3+3RN RNHC O 34 O R=Et, C8H17, Ph, 4-MeC6H4, 4-ClC6H4, 4-NO2C6H4.The fact that mono- or diadducts have not been detected during this reaction (even when the reactants were taken in equimolar amounts) suggests that the intermediate organic carba- moylphosphines are more active nucleophilic addends in this process than PH3.187 The addition of equimolar amounts of phosphine to the C=N bond in hexafluoroisopropylideneimine stops when pri- mary phosphine 35 has been produced (yield 96%).190 (CF3)2CPH2 PH3+(CF3)2C NH 35 NH2 5.Reactions of phosphine with oxiranes and thiiranes Cleavage of an oxirane or thiirane ring by phosphine occurs in the presence of various catalysts. Heating (50 ± 100 8C) phosphine with oxiranes 36 in the presence of inorganic or organic bases or acids has resulted in the synthesis of tertiary phosphines 37 with oligooxyalkylene oxide radicals.191 Complexes of tris(hydroxymethyl)phosphine with nickel(II) chloride 192 or with chloroplatinic acid 193 can also be used successfully as the catalysts in this reaction. R 507100 8C P{[CH2C(R)OH]nH}3 PH3+ Cat. 37 36 O R=H, Me, CH2Cl, Ph; n=3 ± 10.In the absence of a catalyst (heating a mixture of phosphine with an oxirane in an autoclave), the total yield of mono-, bis- and tris(2-hydroxyalkyl)phosphines does not exceed 17%.194224 R PH3+ O RCHCH2PH2+[RCHCH2(OH)]2PH+[RCHCH2(OH)]3P OH R=H, Me. A convenient and efficient method for the synthesis of 2-hydroxyethylphosphine (yield 70%) based on phosphorylation of oxirane by the `phosphine ± sodium metal ± liquid ammonia' system has been reported.194 O ,H2 O PH3+Na NH3 NaPH2 HOCH2CH2PH2 Later, organylethynyloxiranes 38 have also been involved in this reaction to give the corresponding primary hydroxyorganyl- phosphines 39 in yields of up to 73%.195 Me Me H2O C CR NaPH2+ RC CCCH2PH2 O 39 38 OH R=Me, Bu, CH2=CH.The attempt to carry out phosphorylation of 1-methyl-1- propyloxirane by the `phosphine ± sodium ± liquid ammonia' sys- tem failed.195 Thiirane and its alkyl- and dialkyl-substituted derivatives react with alkali metal dihydrophosphides to give primary 2-sul- fanylalkylphosphines.196 ± 198 SH R R0 H+ NaPH2+ RCHCHPH2 S R0 R=R0=H, Me; R=Me, R0=H. IV. Other reactions of phosphine with organic compounds 1. Synthesis of esters and amides of phosphorous and phosphoric acids According to patents,199 ± 201 phosphine reacts with sodium alk- oxides 199, 200 or with the alcohol ± alkali metal hydroxide sys- tems 201 in a halogenated hydrocarbon solvent to give triorganyl phosphites. Thus trimethyl phosphite was prepared in a quantita- tive yield from phosphine and sodium methoxide in CCl4 at 0 ± 20 8C.199 (MeO)3P+3CHCl3+3 NaCl PH3+3MeONa+3 CCl4 Apparently, the reaction starts with the formation of phos- phonium salt 40; the chloride ion in this salt is replaced by the methoxy ion to give the phosphonium salt 41.This is followed by elimination of chloroform, and the resulting methoxyphosphine 42 reacts again with CCl4 to give phosphonium salt 43. The latter is converted into salt 44 upon exchange with sodium methoxide and then into dimethoxyphosphine 45 upon elimination of a CHCl3 molecule. The last hydrogen atom in the compound 45 is substituted in a similar way. + MeONa PH3+CCl4 7NaCl [H3P CCl3] Cl7 40 + HCCl3+H2POMe 42 [H3P CCl3] 7OMe 41 B A Trofimov, S N Arbuzova, N K Gusarova + MeONa H2POMe 42+CCl4 Cl7 7NaCl CCl3 43 + H2POMe MeO7 HCCl3+HP(OMe)2 etc.45 CCl3 44 Heating (80 8C) a mixture of phosphine, sodium phenoxide and CCl4 in a propylene carbonate medium gives not only triphenyl phosphite but also chloromethylphosphonite 46 and dichloromethylphosphonite 47, the total yield of the products being 90% (30% of each compound).200 PH3+PhONa +CCl4 (PhO)3P+(PhO)2PCH2Cl+(PhO)2PCHCl2 47 46 Phosphine reacts with trifluoromethanesulfenyl chloride at 795 8C to give, depending on the ratio of the reactants, S,S,S- tris(trifluoromethyl) trithiophosphite or S,S-bis(trifluoromethyl) phosphonodithioite in 96% and 72% yields, respectively.3, 202 In recent years, studies have been published dealing with oxidative dehydrocondensation of phosphine with alco- hols,140, 203, 204 primary 205 and secondary 140 amines and pyri- dine;206 these reactions occur in the presence of copper and platinum compounds and give trialkyl phosphites,140 trialkyl phosphates,140, 203, 204 phosphorous triamides,205 alkylimidophos- phoric triamides 140 and tris(2-pyridyl)phosphine,206 respectively.Unfortunately, these publications 140, 203 ± 206 barely give any experimental details and, what is more important, they present no data confirming the structures of the compounds synthesised. 2. Synthesis of organophosphorus compounds with a mono- or dicoordinated phosphorus atom Synthesis of organophosphorus compounds with mono- or dicoordinated phosphorus atoms based on phosphine is a topical line of research in modern organic chemistry.However, to the best of our knowledge, the data on these reactions are limited to a few publications.207 ± 210 Thus the reaction of phosphine with O-nitrosobis(trifluoro- methyl)hydroxylamine at room temperature gave N-bis(trifluor- omethyl)nitroxyiminophosphine (yield 60%).207 (CF3)2NON PH PH3+(CF3)2NON O The reaction of phosphine with cyanogen bromide affords aminocarbophosphyl hydrobromide 48.208 The reaction occurs via the initial formation of cyanophosphine hydrobromide, which rearranges into the hydrobromide 48. PH3+BrC N H2PC N. HBr H2NC P . HBr 48 Phosphorus analogues of pyridine, phosphorines 49, have been prepared by treatment of the pyrylium salts 50 with phos- phine in butanol in the presence of mineral acids at 120 ± 130 8C (yields up to 61%).209, 210 Apparently, the reaction passes through the intermediate formation of primary phosphines 51 and 52.R PH2 R O+X7 PH3+Ph Ph O 7HX 50 Ph 51 PhPhosphine in the synthesis of organophosphorus compounds R PH2 R Ph P Ph O 7H2O 49 Ph Ph 52 R=Me, Ph; X=BF4. V. Conclusion The data considered in this review demonstrate that phosphine, which is the simplest available phosphorus compound, is a convenient reagent for the formation of a C± P bond in the synthesis of various organic, organoelement and functionally substituted phosphines, which are finding ever increasing use as ligands for the preparation of metal-complex catalysts.The ease and practical feasibility of the preparation of phosphine by direct hydrolysis of elemental phosphorus, which had been noted long ago by D I Mendeleev and V N Ipat'ev,211 and its high, although not adequately studied, reactivity are the objective prerequisites for more extensive involvement of phos- phine in organophosphorus synthesis. However, it should be noted that unlike its nitrogen ana- logue �ammonia�which has became the synthetic base for the whole chemistry of the organic compounds of nitrogen, phosphine has not found equally wide use in organophosphorus chemistry despite the numerous obvious advantages of phosphine over, for example, phosphorus chlorides. The authors hope that this review would be favourable for further development of the chemistry of phosphine and, first of all, development of new convenient methods for the synthesis of various organophosphorus compounds based on phosphine.The exceptionally simple method for the generation of a phosphine ± hydrogen mixture by alkaline hydrolysis of red phosphorus that we developed previously may stimulate further studies along this line.6, 7, 14, 22 The review was written with the financial support of the Russian Foundation for Basic Research (Project No. 98-03- 32925a). References 1. G M Kosolapoff, L Maier Organic Phosphorus Compounds Vol. 1 (New York: Wiley-Intersciense, 1972) 2. D Purdela, R Vylchanu Khimiya Organicheskikh Soedinenii Fosfora (The Chemistry of Organic Phosphorus Compounds) (Moscow: Khimiya, 1972) 3.J Hora'k Chem. Listy 55 1278 (1961) 4. I M Osadchenko, A P Tomilov Usp. Khim. 38 1089 (1969) [Russ. Chem. Rev. 38 495 (1969)] 5. B A Trofimov, T N Rakhmatulina, N K Gusarova, S F Malysheva Usp. Khim. 60 2619 (1991) [Russ. Chem. Rev. 60 1316 (1991)] 6. N K Gusarova, L Brandsma, S N Arbuzova, S F Malysheva, B A Trofimov Zh. Org. Khim. 32 269 (1996) a 7. B A Trofimov, L Brandsma, N K Gusarova Main Group Chem. News 4 18 (1996) 8. E Pignolett (Ed.) Homogeneous Catalysis with Metal Phosphine Complexes (Oxford: Pergamon Press, 1983) 9. O A Erastov, G N Nikonov Funktsional'nozameshchennye Fosfiny i Ikh Proizvodnye (Functional-Substituted Phosphines and Their Derivatives) (Moscow: Nauka, 1986) 10.O A Erastov, G N Nikonov Usp. Khim. 53 625 (1984) [Russ. Chem. Rev. 53 369 (1984)] 11. K A Petrov, V A Parshina Usp. Khim. 37 1218 (1968) [Russ. Chem. Rev. 37 532 (1968)] 12. K P Langhans, O Stelzer, J Svara, N Weferling Z. Naturforsch., B Chem Sci., 45 203 (1990) 13. S I Shaikhudinova, V I Dmitriev, K V Nepomnyashchikh, N K Gusarova, B A Trofimov Zh. Obshch. Khim. 67 155 (1997) b 14. B A Trofimov, L Brandsma, S N Arbuzova, S F Malysheva, N K Gusarova Tetrahedron Lett. 35 7647 (1994) 225 15. B A Trofimov, S N Arbuzova, S F Malysheva, L Brandsma, N K Gusarova Zh. Obshch. Khim. 64 1572 (1994) b 16. N K Gusarova, L Brandsma, S F Malysheva, S N Arbuzova, B A Trofimov, in The XIIIth International Conference on Phosphorus Chemistry (Abstracts of Reports), Jerusalem, 1995 p.157 17. N K Gusarova, L Brandsma, S F Malysheva, S N Arbuzova, B A Trofimov Phosphorus Sulfur Silicon Relat. Elem. 111 174 (1996) 18. B A Trofimov, L Brandsma, S N Arbuzova, S F Malysheva, N A Belogorlova, N K Gusarova Zh. Obshch. Khim. 67 695 (1997) b 19. N K Gusarova, B A Trofimov, S F Malysheva, S I Shaikhudinova, N A Belogorlova, S N Arbuzova, K V Nepomnyashchikh, 22. B A Trofimov, N K Gusarova, S N Arbuzova, S F Malysheva, V I Dmitriev Zh. Obshch. Khim. 67 70 (1997) b 20. N K Gusarova, S N Arbuzova, S F Malysheva, M Ya Khil'ko, A A Tatarinova, V G Gorokhov, B A Trofimov Izv. Akad. Nauk, Ser. Khim. 1597 (1995) c 21. Arbuzova, Candidate Thesis in Chemical Sciences, Irkutsk Institute of Organic Chemistry, Siberian Branch of Russian Academy of Sciences, Irkutsk, 1996 R den Besten, L Brandsma Synthesis 387 (1995) 23.N K Gusarova, S F Malysheva, S N Arbuzova, L Brandsma, B A Trofimov Zh. Obshch. Khim. 64 2062 (1994) b 24. H Harnisch Angew. Chem. 88 517 (1976) 25. E E Nifant'ev, T S Kukhareva Obzor Monografii i Obzorov po Khimii Fosfororganicheskikh Soedinenii (Review of Monographs and Reviews on the Chemistry of Organic Phosphorus Compounds) (Moscow: Nauka, 1989) 26. BRD Appl. 2 457 442; Ref. Zh. Khim. 10 N 93P (1977) 27. BRD Appl. 2 511 933; Ref. Zh. Khim. 19 N 72P (1977) 28. BRD Appl. 2 407 461; Ref. Zh. Khim. 15 N 139P (1976) 29. BRD P. 2 522 021; Chem. Abstr. 86 72 879 (1977) 30. F Pass, E Steininger, H Zorn Monatsh.Chem. 93 230 (1962) 31. H R Hays J. Org. Chem. 31 3817 (1966) 32. A P Khardin, O I Tuzhikov, V Yu Lomakin Zh. Vses. Khim. 33. E Plazek, R Tyka Rocz. Chem. 33 549 (1959); Chem. Abstr. 53 21 750 34. R Tyka, E Plazek Rocz. Chem. 35 183 (1961); Ref. Zh. Khim. O-va im. D I Mendeleeva 29 118 (1984) d (1959) 1 Zh 245 (1962) 35. R Tyka, E Plazek Bull. Acad. Pol. Sci., Ser. Sci. Chim. 9 577 (1961); Ref. Zh. Khim. 17 Zh 330 (1962) 36. US P. 3 352 925 SShA; Chem. Abstr. 68 49762 (1968) 37. BRD Appl. 2 636 558; Ref. Zh. Khim. 20 N 109P (1978) 38. BRD Appl. 2 727 390; Ref. Zh. Khim. 22 N 107P (1979) 39. K Issleib Pure Appl. Chem. 9 205 (1964) 40. S Chan, H Goldwhite, H Keyzer, D G Rowsell, R Tang Tetrahedron 25 1097 (1969) 41.R I Wagner, A B Burg J. Am. Chem. Soc. 75 3869 (1953) 42. W Strubell J. Prakt. Chem 18 113 (1962) 43. K Issleib, R KuÈ mmel, H Oehme, I Meissner Chem. Ber. 101 3612 (1968) 44. K Issleib, R KuÈ mmel Chem. Ber. 100 3331 (1967) 45. K Issleib, R KuÈ mmel, H Zimmermann Angew. Chem. 77 172 (1965) 46. A J Leffler, E G Teach, in The 133th National American Chemical Society Meeting (Abstracts of Reports), San Francisco, 1958 p. 29N 47. R I Wagner, L V D Freeman, H Goldwhite, D G Rowsell J. Am. Chem. Soc. 89 1102 (1967) 48. US P. 3 086 053; Chem. Abstr. 59 10 124 (1963) 49. US P. 3 086 056; Chem. Abstr. 60 559 (1964) 50. N Kreutzkamp Chem. Ber. 87 919 (1954) 51. K Issleib, A Tzschach Chem. Ber. 92 1118 (1959) 52. G W Parshall, R V Lindsey Jr J.Am. Chem. Soc. 81 6273 (1959) 53. W L Jolly Inorg. Synth. 11 124 (1968) 54. W L Jolly Inorg. Synth. 11 126 (1968) 55. B A Trofimov, N K Gusarova, S F Malysheva, T N Rakhmatulina, M G Voronkov, V I Dmitriev, S I Shaikhudinova Phosphorus Sulfur Silicon Relat. Elem. 55 271 (1991) 56. B A Trofimov, S F Malysheva, N K Gusarova, V I Dmitriev, S I Shaikhudinova, T N Rakhmatulina, V I Donskikh, M G Voronkov Zh. Obshch. Khim. 59 1894 (1989) b226 57. S I Shaikhudinova, V I Dmitriev, K V Nepomnyashchikh, Tack-Hyuck Lee, N K Gusarova, B A Trofimov, in The XIth International Conference on Chemistry of Phosphorus Compounds (Abstracts of Reports), Kazan, 1996 p. 130 58. Eur. P. 307 702; Chem. Abstr. 111 97 500 (1989) 59. K P Langhans, O Stelzer, N Weferling Chem.Ber. 123 995 (1990) 60. M M Rauhut, I Hechenbleikner, H A Currier, F C Schaefer, V P Wystrach J. Am. Chem. Soc. 81 1103 (1959) 61. US P. 2 822 376; Chem. Abstr. 52 10 147 (1958) 62. BRD P. 1 078 574; Chem. Abstr. 55 16 427 (1961) 63. R B King, J C Cloyd Z. Naturforsch., B Chem Sci. 27 1432 (1972) 64. R B King, J C Cloyd, P N Kapoor J. Chem. Soc., Perkin Trans. 1 2226 (1973) 65. R B King, J C Cloyd J. Am. Chem. Soc. 97 53 (1975) 66. R B King, J C Cloyd, R H Reimann J. Org. Chem. 41 972 (1976) 67. R B King, P N Kapoor J. Am. Chem. Soc. 91 5191 (1969) 68. R B King, P N Kapoor Angew. Chem. 83 766 (1971) 69. R B King, P N Kapoor J. Am. Chem. Soc. 93 4158 (1971) 70. R B King, R N Kapoor,M S Saran, P N Kapoor Inorg.Chem. 10 1851 (1971) 71. R B King, W F Masler J. Am. Chem. Soc. 99 4001 (1977) 72. D Semenzin, G Etemad-Moghadam, D Albouy,M Koenig Tetrahedron Lett. 35 3297 (1994) 73. M C Hoff, P Hill J. Org. Chem. 24 356 (1959) 74. US P. 2 584 112; Chem. Abstr. 46 9580 (1952) 75. M M Rauhut, H A Currier, A M Semsel, V P Wystrach J. Org. Chem. 26 5138 (1961) 76. A R Stiles, F F Rust, W E Vaughan J. Am. Chem. Soc. 74 3282 (1952) 77. N Weferling Phosphorus Sulfur Silicon Relat. Elem. 30 641 (1987) 78. BRD Appl. 2 703 802; Ref. Zh. Khim. 8 N 102P (1979) 79. H Song, C Xia, D Li Huaxue Xuebao 51 815 (1993); Chem. Abstr. 119 250 052 (1993) 80. US P. 2 803 597; Chem. Abstr. 52 2049 (1958) 81. Br. P. 67 3451; Chem. Abstr. 47 5426 (1953) 82. BRD Appl. 2 936 210; Ref.Zh. Khim. 2 N 115P (1982) 83. BRD P. 3 629 189 FRG; Chem. Abstr. 109 57 041 (1988) 84. Jpn. P. 58 222 097; Chem. Abstr. 100 175 071 (1984) 85. Eur. P. 528 167; Chem. Abstr. 119 95 830 (1993) 86. US P. 2 957 931; Chem. Abstr. 55 10 317 (1961) 87. Can. P. 1 057 296; Chem. Abstr. 91 140 999 (1979) 88. US P. 4 575 563; Chem. Abstr. 105 60 758 (1986) 89. Eur. P. 299 169; Chem. Abstr. 110 235 058 (1989) 90. Chin. P. 1 069 029; Chem. Abstr. 119 181 018 (1993) 91. Eur. P. 132 700; Chem. Abstr. 103 146 640 (1985) 92. Eur P. 134 482; Chem. Abstr. 103 23 329 (1985) 93. US P. 4 485 262; Ref. Zh. Khim. 17 N 104P (1985) 94. BRD P. 3 626 968; Chem. Abstr. 108 192 266 (1988) 95. Jpn. P. 81 120 760; Chem. Abstr. 96 53 230 (1982) 96.US P. 4 474 675; Chem. Abstr. 102 28 140 (1983) 97. Br. P. 2 092 590; Chem. Abstr. 98 16 846 (1983) 98. Can. P. 1 151 212; Chem. Abstr. 100 6852 (1984) 99. US P. 4 007 229; Ref. Zh. Khim. 21 N 85P (1977) 100. BRD P. 2 601 520; Chem. Abstr. 85 192 883 (1976) 101. J G Dingwall, B Tuck J. Chem. Soc., Perkin Trans. 1 2081 (1986) 102. US P. 4 613 699; Chem. Abstr. 106 34 029 (1987) 103. G W Parshall, D C England, R V Lindsey Jr J. Am. Chem. Soc. 81 4801 (1959) 104. H Goldwhite,R N Haszeldine,D G Rowsell J. Chem. Soc. 12 6875 (1965) 105. J E Bissey, H Goldwhite, D G Rowsell J. Org. Chem. 32 1542 (1967) 106. R Fields, R N Haszeldine, J Kirman J. Chem. Soc., C 197 (1970) 107. P Cooper, R Fields, R N Haszeldine J. Chem. Soc., Perkin Trans. 1 702 (1975) 108. G M Burch, H Goldwhite, R N Haszeldine J.Chem. Soc. 1083 (1963) 109. R Fields, H Goldwhite, R N Haszeldine, J Kirman J. Chem. Soc., C 2075 (1966) 110. H Goldwhite J. Chem. Soc. 3901 (1965) 111. BRD P. 1 900 706; Ref. Zh. Khim. 7 N 183P (1975) 112. P Tavs Angew. Chem. 81 742 (1969) 113. BRD Appl. 2 939 588; Ref. Zh. Khim. 6 N 97P (1982) 114. US P. 4 623 687; Chem. Abstr. 106 120 844 (1987) B A Trofimov, S N Arbuzova, N K Gusarova 115. Jpn. Appl. 55-122 790; Ref. Zh. Khim. 24 N 124P (1981) 116. T V Harris, W R Pretzer Inorg. Chem. 24 4437 (1985) 117. Neth. P. 7 312 880; Chem. Abstr. 80 146 299 (1974) 118. US P. 4 503 178; Chem. Abstr. 105 61 477 (1986) 119. US P. 3 435 076; Chem. Abstr. 71 22 187 (1969) 120. Eur.P. 30 0331; Chem. Abstr. 110 173 472 (1989) 121. USSR P. 941 382; Byull. Izobret. (25) 113 (1982) 122. USSR P. 941 381; Byull. Izobret. (25) 112 (1982) 123. N K Gusarova, S N Arbuzova, S I Shaikhudinova, S F Malysheva, T N Rakhmatulina, S V Zinchenko, V I Dmitriev, B A Trofimov Zh. Obshch. Khim. 63 1753 (1993) b 124. J Messinger, C Engels Berichte 21 326 (1888) 125. A Hoffman J. Am. Chem. Soc. 43 1684 (1921) 126. W A Reeves, F F Flynn, J D Guthrie J. Am. Chem. Soc. 77 3923 (1955) 127. US P. 2 743 299; Chem. Abstr. 51 458 (1957) 128. US P. 2 912 466; Chem. Abstr. 54 2169 (1960) 129. E V Kuznetsov, R7K7Valetdinov, Ts Ya Roitburd, L B Zakharova Tr. Kazansk. Khim.-Tekhnol. Inst. 29 20 (1960); Ref. Zh. Khim. 23 Zh 245 (1961) 130. R K Valetdinov, E V Kuznetsov, N P Kozin, A Sh Sharifullin, I N Kiselev Tr.Kazansk. Khim.-Tekhnol. Inst. 40 107 (1969); Ref. Zh. Khim. 16 S 343 (1970) 131. J Hora'k, V Ettel Collect. Czech. Chem. Commun. 26 2401 (1961); Ref. Zh. Khim. 16 Zh 22 (1962) 132. H Helmann, O Schumacher Angew. Chem. 72 211 (1960) 133. US P. 3 835 194; Chem. Abstr. 81 171 298 (1974) 134. Ind. P. 158 897; Chem. Abstr. 107 217 848 (1987) 135. S A Buckler, V P Wystrach J. Am. Chem. Soc. 83 168 (1961) 136. US P. 3 013 085; Ref. Zh. Khim. 11 N 317P (1963) 137. BRD P. 1 041 957; Ref. Zh. Khim. 7 L 101 (1961) 138. BRD P. 1 064 061; Ref. Zh. Khim. 8 L 543 (1961) 139. BRD P. 1 035 135; Chem. Abstr. 54 14 125 (1960) 140. Ya A Dorfman, M M Aleshkova, G S Polimbetova, L V Levina, T V Petrova, R R Abdreimova, D M Doroshkevich Usp.Khim. 62 928 (1993) [Russ. Chem. Rev. 62 877 (1993)] 141. K N Harrison, P A T Hoye, A G Orpen, P G Pringle,M B Smith J. Chem. Soc., Chem. Commun. 1096 (1989) 142. P A T Hoye, P G Pringle, M B Smith, K Worfoys J. Chem. Soc., Dalton Trans. 2 269 (1993) 143. BRD P. 1 075 610; Ref. Zh. Khim. 21 L 83 (1961) 144. BRD P. 1 197 450; Ref. Zh. Khim. 19 N 83P (1967) 145. Fr. P. 1 405 645; Chem. Abstr. 64 2127 (1966) 146. Belg. P. 651 851; Chem. Abstr. 64 9766 (1966) 147. V Ettel, J Hora'k Collect. Czech. Chem. Commun. 25 2191 (1960); Ref. Zh. Khim. 21 Zh 242 (1961) 148. US P. 2 984 683; Ref. Zh. Khim. 11 L 98 (1962) 149. US P. 3 079 427; Ref. Zh. Khim. 11 N 442P (1965) 150. US P. 3 238 248; Ref.Zh. Khim. 14 N 130P (1967) 151. S A Buckler, V P Wystrach J. Am. Chem. Soc. 80 6454 (1958) 152. US P. 2 927 945; Ref. Zh. Khim. 17 L 119 (1961) 153. S A Buckler J. Am. Chem. Soc. 82 4215 (1960) 154. US P. 2 969 398; Ref. Zh. Khim. 11 L 96 (1962) 155. V Ettel, J Hora'k Collect. Czech. Chem. Commun. 26 2087 (1961); Ref. Zh. Khim. 15 Zh 310 (1962) 156. US P. 2 999 882; Chem. Abstr. 56 2473 (1962) 157. US P. 3 054 718; Ref. Zh. Khim. 8 N 433P (1964) 158. E S Kozlov, A V Solov'ev, L N Markovskii Zh. Obshch. Khim. 48 2437 (1978) b 159. Yu G Shermolovich, E A Danchenko, A V Solov'ev, L N Markovskii Zh. Obshch. Khim. 55 2218 (1985) b 160. USSR P. 138 617; Ref. Zh. Khim. 6 L 114 (1962) 161. E I Grinshtein, A B Bruker, L Z Soborovskii Dokl. Akad.Nauk SSSR 139 1359 (1961) e 162. A B Bruker,M K Baranaev, E I Grinshtein, R I Novoselova, V V Prokhorova, L Z Soborovskii Zh. Obshch. Khim. 33 1919 (1963) b 163. BRD P. 2 158 823; Chem. Abstr. 78 43 702 (1973) 164. US P. 3 704 325; Chem. Abstr. 78 43 703 (1973) 165. USSR P. 143 395; Ref. Zh. Khim. 16 H 53 P (1964) 166. Kh R Raver, A B Bruker, L Z Soborovskii Zh. Obshch. Khim. 32 588 (1962) b 167. US P. 3 636 160; Ref. Zh. Khim. 20 N 99P (1972) 168. US P. 3 666 817; Ref. Zh. Khim. 7 N 133P (1973)227 Phosphine in the synthesis of organophosphorus compounds 169. Br. P. 854 182; Ref. Zh. Khim. 18 L 92 (1961) 170. K Kellner, A Tzschach Z. Chem. 24 365 (1984); Ref. Zh. Khim. 7 Zh 397 (1985) 171. Br. P. 919 267; Ref. Zh. Khim. 3 N 110P (1964) 172. A B Bruker, E I Grinshtein, L Z Soborovskii Zh. Obshch. Khim. 36 1133 (1966) b 173. S A Buckler, M Epstein Tetrahedron 18 1211 (1962) 174. S A Buckler, M Epstein J. Am. Chem. Soc. 82 2076 (1960) 175. US P. 3 005 029; Ref. Zh. Khim. 24 L 96 (1962) 176. E I Grinshtein, A B Bruker, L Z Soborovskii Zh. Obshch. Khim. 36 1138 (1966) b 177. USSR P. 170 499; Byull. Izobret. (9) 22 (1965) 178. R Francke,G V Roeschenthaler Chem.-Ztg. 113 320 (1989); Chem. Abstr. 113 24 018 (1990) 179. G W Parshall Inorg. Chem. 4 52 (1965) 180. USSR P. 445 670; Ref. Zh. Khim. 21 O 294P (1976) 181. V I Vysotskii, E V Pavlycheva,M N Tilichenko Zh. Obshch. Khim. 45 1466 (1975) b 182. V I Vysotskii, S M Kalinov,M N Tilichenko Zh. Obshch. Khim. 50 1707 (1980) b 183. US P. 3 142 685; Ref. Zh. Khim. 6 N 514P (1966) 184. M Epstein, S A Buckler J. Am. Chem. Soc. 83 3279 (1961) 185. US P. 3 050 531; Chem. Abstr. 57 16 659 (1962) 186. US P. 2 845 454 Chem. Abstr. 53 3061 (1959) 187. S A Buckler J. Org. Chem. 24 1460 (1961) 188. US P. 2 969 390; Chem. Abstr. 55 14 381 (1961) 189. W Wolfsberger Chem. Ztg. 109 317 (1985); Chem. Abstr. 105 172 529 (1986) 190. H Kischkel, G V RoÈ schenthaler Z. Naturforsch. B, Anorg. Chem., Org. Chem. 39 356 (1984) 191. Br. P. 970 815; Ref. Zh. Khim. 9 N 97P (1966) 192. USSR P. 891 684; Byull. Izobret. (47) 111 (1981) 193. USSR P. 859 370; Byull. Izobret. (32) 115 (1981) 194. I L Knunyants, R S Sterlin Dokl. Akad. Nauk SSSR 66 47 (1947) e 195. F Ya Perveev, K Rikhter Zh. Obshch. Khim. 30 784 (1960) b 196. Fr. P. 1 401 930; Chem. Abstr. 63 11 615 (1965) 197. Swiss. P. 420 145; Ref. Zh. Khim. 10 N 147P (1968) 198. K Issleib, P Thorausch,W Reyes Z. Chem. 16 276 (1976); Ref. Zh. Khim. 9 Zh 362 (1977) 199. BRD P. 2 643 282; Chem. Abstr. 87 184 678 (1977) 200. GDR P. 206 897; Chem. Abstr. 101 152 075 (1984) 201. GDR P. 231 074; Chem. Abstr. 105 209 205 (1986) 202. H J Emeleus, S N Nabi J. Chem. Soc. 1103 (1960) 203. Ya A Dorfman, L V Levina, T V Petrova, V S Emel'yanova, G S Polimbetova Zh. Obshch. Khim. 59 1454 (1989) b 204. Ya A Dorfman, L V Levina, T V Petrova,M M Aleshkova, R R Abdreimova, G S Polimbetova, V S Emel'yanova Zh. Obshch. Khim. 60 1275 (1990) b 205. Ya A Dorfman, L V Levina, A K Borangazieva Kinet. Katal. 34 470 (1993) f 206. Ya A Dorfman, L V Levina Khim. Geterotsikl. Soedin. 128 (1992) g 207. H G Ang, F K Lee Polyhedron 8 379 (1989); Chem. Abstr. 112 56 062 (1990) 208. I S Matveev Zh. Strukt. Khim. 15 145 (1974) h 209. G Mirkl, F Lieb, A Merz Angew. Chem. 79 947 (1967) 210. G Mirkl, D E Fischer, H Olbrich Tetrahedron Lett. 645 (1970) 211. D I Mendeleev Osnovy Khimii (Foundations of Chemistry) (Moscow; Leningrad: Goskhimtekhizdat, 1932) a�Russ. J. Org. Chem. (Engl. Transl.) b�Russ. J. Gen. Chem. (Engl. Transl.) c�Russ. Chem. Bull. (Engl. Transl.) d�Mendeleev Chem. J. (Engl. Transl.) e�Dokl. Chem. Technol., Dokl. Chem. (Engl. Transl.) f�Kinet. Catal. (Engl. Transl.) g�Chem. Heterocucl. Compd. (Engl. Transl.) h�Russ. J. Struct. Chem.

ISSN:0036-021X    

出版商:RSC    

年代:1999

数据来源: RSC

摘要:

Russian Chemical Reviews 68 (3) 229 ± 240 (1999) Synthesis of tritium-labelled biologically important diazines G V Sidorov, N F Myasoedov Contents I. Introduction II. Dehalogenation in solution III. Catalytic dehalogenation without a solvent IV. Reactions of isotope exchange V. Reduction and hydrogenation VI. Solid-state catalytic hydrogenation VII. Other methods of tritium labelling VIII. Conclusion Abstract. The methods for the introduction of tritium (by chem- ical synthesis and isotope exchange in both solution and solid state) into biologically active diazines, viz., nucleic acid compo- nents (heterocyclic bases, nucleosides, nucleotides), DNA syn- thesis terminators and cytokinins are considered. The bibliography includes 178 references. I.Introduction Recent progress in molecular biology, biochemistry, molecular genetics and experimental medicine are largely determined by the possibility of wide use of various radioactively labelled com- pounds. The application of such compounds has allowed direct studies of the mechanisms of chemical and biochemical reactions, as well as metabolic pathways in living organisms (in vivo) and in open systems (in vitro). Determination of quantitative character- istics of biochemical processes with the aid of labelled compounds is important for understanding of the essential features of proc- esses occurring in living organisms and elucidation of the regu- latory mechanisms underlying metabolism. For over three decades now, researchers have been showing unremitting interest in tritium-labelled compounds.This is due to the valuable physical properties of tritium: its half-life period is sufficiently long for conducting experiments of virtually any duration; the low energy of tritium b-particles (Emax=18.6 keV) determines low radiotoxicity of tritium-labelled compounds, which makes it possible to handle relatively large quantities of this isotope without special protective measures. Substitution of one tritium atom for hydrogen yields a compound with a molar radioactivity (Amol) of 29.12 Ci mmol71. The use of such prepa- rations and modern scintillation counters allows detection of<10714 mol of a labelled compound. A V Sidorov, N F Myasoedov Institute of Molecular Genetics, Russian Academy of Sciences, pl.I V Kurchatova 46, 123182 Moscow, Russian Federation. Fax (7-095) 196 02 21. Tel. (7-095) 196 02 13. E-mail: img@img.ras.ru (A V Sidorov). Tel. (7-095) 195 00 01 (N F Myasoedov) Received 2 July 1998 Uspekhi Khimii 68 (3) 254 ± 266 (1999); translated by V D Gorokhov Pyrimidine (1) is the most important compound among the diazines, since its derivatives, viz., uracil (2), thymine (3), and cytosine (4), form part of nucleic acids. Barbiturates (5), alloxan (6) and orotic acid (7) are also pyrimidine derivatives and contain no condensed rings. Among the polycyclic derivatives of pyrimi- dine, like pteridine (8), purine (9) deserves to be mentioned. Its derivatives, adenine (10) and guanine (11), also form part of ribo- and deoxyribo-nucleic acids.Other purine derivatives, such as hypoxanthine (12), xanthine (13), theobromine (14), theophylline (15), caffeine (16), and uric acid (17) are important natural compounds, which show biological activity. 20-Deoxyribose (18) and ribose are linked to nitrogen bases through the N-glycosidic bond. These compounds have been called deoxyribonucleosides (18a) and ribonucleosides (18b), respectively, and the phosphorus esters of nucleosides have been termed nucleotides (18c ± 18e). We have thus grouped the natural diazines under the common name of `components of nucleic acids'. The number of such compounds for the main bases (2 ± 4, 10, 11) of nucleic acids is more than 40. N N1 O HN O NH 5 N N 8 NH2 N N 10 #1999 Russian Academy of Sciences and Turpion Ltd UDC 547.466 : 543.544 229 230 232 233 235 236 237 238 O O NH2 CH3 HN HN N O O O NH 4 NH 3 NH 2 O O R O HN HN R COOH O O O O NH 6 N N NH 7 N NH N N N N NH N 9 O O N N N HN HN NH NH NH N N H2N 12 11230 O NH HN HN N O O NH 13 O CH3 H3C N N N O N 16 CH3 B R1O OR2 HO 18a ± e 18a: R1=H, R2=H; 18b: R1=H, R2=OH; 18c: R1=H2PO3, R2=H, OH; 18d: R1=H3P2O5, R2=H, OH; 18e: R1=H4P3O7, R2=H, OH.In recent years, considerable attention is being devoted to the so-called cytokinins, which are derivatives of 6-aminopur- ine, discovered in the 1950s. The cytokinins are natural substances that promote germination and blossoming of plants and retard their wilting.When used at concentrations 1073 ± 1075 mol litre7l, they stimulate cell division. The princi- pal cytokinins are kinetin (19), zeatin (20), benzylaminopurine (21) and a number of other compounds. O CH2 NH N N N NH N 19 O CH3 HN O N HO O 22 N3 H B RO P O P O O R 24a,b OH 25a: R=H; 25b: R=H2PO3 24a: R=H; 24b: R=Me Analogues of nucleosides with the modified glycoside ring often appear to be DNA synthesis terminators. Azidothymidine (22), acyclovir (23), nucleoside phosphinates 24a and nucleoside methylphosphinates 24b, 50-O-hydrohydroxyphosphoryl-20-de- oxynucleosides 25a and the corresponding nucleotides 25b may be cited as examples.They are potential inhibitors of retroviruses, including the HIV virus.1, 2 This review considers methods used for the preparation of the above-mentioned compounds labelled with tritium. The main attention is centred on the general methods allowing synthesis of the widest set of compounds with maximum molar radioactivity. O O CH3 II. Dehalogenation in solution H3C NH N N N N N O N 15 14 CH3 CH3 O NH HN O NH NH O 17 The reaction of catalytic hydrogen-for-halogen replacement (hydrogenolysis) has been known for a long time;3 however, its use for the synthesis of tritiated compounds has come into practice relatively recently.4, 5 Catalytic dehalogenation is usually carried out in air-tight vessels with vigorous stirring of a suspension of a catalyst in solution of a halogenated compound under gaseous tritium.In this type of reaction, both polar and nonpolar solvents are employed. The tritium halide formed in this reaction must be neutralised since it poisons the catalyst, which leads to deceler- ation of the reaction.6 The mechanism of tritium incorporation into the solvent under conditions of catalytic dehalogenation (catalysts PdO, Pd/BaSO4, Raney nickel) has been considered.7 Catalysts of hydrogenation (mainly, supported Pd) are used for dehalogenation. The conditions for catalytic dehalogenation for the synthesis of tritium-labelled compounds have been pub- lished.8, 9 Examples of precursors and target compounds obtained by dehalogenation are given in Table 1.Table 1. Results of halogen ± tritium replacement in purines and pyrimi- dines. Precursor H CH3 CH2Ph CH2 CH3 NH NH N N N NH NH N N 20 21 O N HN N N H2N CH2O(CH2)2OH 23 H B O CH2 O O 25a,b OH 5-Iodocytidine 8-Bromoadenine 2-Chloroadenine 2,8-Dichloroadenine 5-Iodoorotic acid 5-Iododeoxyuridine 5-Iodouracil 5-Iodouridine 5-Iodo-6-azauracil 5-Iodo-6-azauridine 8-Bromoadenosine 8-Bromoguanosine 8-Bromoinosine 8-Bromo-AMP 8-Bromo-GMP 5-Bromo-UMP 8-Bromo-cAMP 5,6-Dibromouracil 5-Bromouracil 6-Chlorouracil 5-Bromocytosine 8-Bromo-substituted purine nucleotides 5-Bromo-substituted pyrimidine nucleotides Notes. Abbreviations: AMP, adenosine 50-monophosphate; GMP, gua- nosine 50-monophosphate; UMP, uridine 50-monophosphate; cAMP, adenosine 30,50-cyclomonophosphate.a Dimension/ Ci mmol71. Synthesis of a tritium-labelled compound 10 has revealed 11 that dehalogenation in aprotic solvents (dimethylformamide, dimethyl sulfoxide, dioxane) in the presence of catalysts (Pd black, Pd on carbon and on BaSO4) has no advantages over the reaction in a protic solvent (aqueous ± ethanolic solution): in both cases the maximum radioactivity is not attained. In the introduc- tion of a tritium label into adenosine and guanosine, the rate of dehalogenation of the corresponding 8-bromo-compounds in 1 M KOH and 0.1 M HCl was higher than that in water; however, the G V Sidorov, N F Myasoedov Target compound [5-3H]cytidine [8-3H]adenine [2-3H]adenine [2,8-3H2]adenine [5-3H]orotic acid [5-3H]deoxyuridine [5-3H]uracil [5-3H]uridine [5-3H]6-azauracil [5-3H]6-azauridine [8-3H]adenosine [8-3H]guanosine [8-3H]inosine [8-3H]AMP [8-3H]GMP [5-3H]UMP [5-3H]cAMP [5,6-3H2]uracil [5-3H]uracil [6-3H]uracil [5-3H]cytosine [8-3H]purine nucleotides [5-3H]pyrimidine nucleotides Ref.Amol (see a) 10 11 12 13 13 17.4 15 ± 20 20 ± 25 25 ± 50 15.6 26.4 15 ± 20 15 ± 20 15 ± 20 15 ± 20 13 14 14 15 15 11.6 ± 19 16, 17 16, 17 17 18, 19 20 21 22 23, 24 25 25 25 25 5.4 ± 8 15 10 15 10 17 45 ± 50 20 ± 30 20 ± 30 20 ± 30 20 ± 30 25 20 ± 30Synthesis of tritium-labelled biologically important diazines yields of labelled compounds and their molar radioactivity were larger in alkaline solution.16 Table 1 presents data that character- ise the synthesis of specific compounds. This reaction was not investigated as a method for the synthesis of tritiated diazines.In particular, the isotope effects of hydrogen, the ratio of reactants, the nature of reagents and the activity of catalysts have not been found to influence the yield and the molar radioactivity of the target compounds. Hydrogenolysis has been investigated as a method for the incorporation of a tritium label into diazines.26 ± 31 Hydrogenolysis of various compounds was conducted in the same solvents and with the same parameters such as tritium pressure, solvent, temperature, concentration of halogenated compound and reaction time.The basic characteristics of hydrogenolysis with tritium of bromo-substituted purines 26 and pyrimidines 27 are presented in Table 2. Table 2. Basic characteristics of catalytic dehalogenation with tritium of 8-bromosubstituted purines and 5-bromo-substituted pyrimidines on supported Pd as the catalyst.26, 27 Labelled compound Tritium concen- Yield (%) tration (%) 19.5 49.0 28.0 26.7 61.0 45.4 46.2 4.1 55.0 29.0 79.0 21.0 65.0 96.0 80.0 92.0 43.0 61.0 34.0 89.0 74.0 74.0 54.0 85 85 98 95 75 98 80 98 70 98 80 90 70 90 98 85 75 95 70 70 98 95 95 [8-3H]Adenosine [8-3H]AMP [8-3H]AMP ±TOAa [8-3H]cAMP [8-3H]dAMP [8-3H]Guanosine [8-3H]GMP [8-3H]GMP±TOAa [8-3H]cGMP [8-3H]dGMP [5-3H]Uracil [5-3H]Uridine [5-3H]Uridine [5-3H]UMP [5-3H]UMP±TOAa [5-3H]20-Deoxyuridine [5-3H]dUMP [5-3H]cUMP [5-3H]CMP [5-3H]CMP±TOAa [5-3H]CMP±TOAa [5-3H]dCMP [5-3H]cCMP Notes.Abbreviations: dAMP, 20-deoxyadenosine 50-monophosphate; cGMP, guanosine 30,50-cyclomonophosphate; dGMP, 20-deoxyguanosine 50-monophosphate; dUMP, 20-deoxyuridine 50-monophosphate; cUMP, uridine 30,50-cyclomonophosphate; CMP, cytidine-50-monophosphate; dCMP, 20-deoxycytidine-50-monophosphate; cCMP, cytidine 30,50-cyclo- monophosphate. aTrioctylammonium salt (TOA). The processes occurring in the hydrogen ± palladium ± water system with participation of hydrogen isotopes (protium and tritium) and their influence on the molar radioactivity (Amol) of hydrogenolysis products have been investigated.27 It was pointed out that one of the major reasons for the decrease in Amol of the target compounds is the dilution of tritium with protium due to isotope exchange with the solvent protons and high values of protium ± tritium partition coefficients (aH±T reaches 12).The processes with different kinetics are analysed below. 1. The rate of the main reaction (dehalogenation, hydro- genation, isotope exchange) is much higher than that of tritium isotope exchange with the solvent (tritium is virtually undiluted with protium). Here, two extreme cases are possible: (a) if the contribution from the reaction of homomolecular isotope Amol / Ci mmol71 9.8 6.2 16.7 21.6 7.3 12.7 11.0 0.8 5.5 14.0 18.0 21.0 13.0 3.7 19.0 21.2 8.6 12.2 1.1 9.3 25.1 18.0 18.1 231 exchange may be disregarded, the molar radioactivity of the reaction product is equal to the Amol of the initial tritium with consideration of the isotope effects of hydrogen on dissolution and adsorption on palladium (for this process aH±T=2.5); (b) if an isotope equilibrium is established on palladium, it is necessary to take into account the reaction of monomolecular isotope exchange (aH±T=4.7 or 3.6 for 50% tritium).2. The rate of the main reaction is comparable or lower than the rate of isotope exchange of tritium with the solvent, i.e., continuous dilution of tritium with protium takes place.Exami- nation of this process requires consideration of the isotope equilibrium in the hydrogen ± palladium ± water system (aH±T=12). Table 3 presents data that illustrate the effect of tritium concentration on the molar radioactivity of labelled products obtained by the reaction in an aqueous solution for different protium ± tritium partition coefficients. The extreme values of Amol (2.2 and 28.3 Ci mmol71) were calculated for the extreme cases. Hence, the increase in the molar radioactivity of purine and pyrimidine compounds is related to minimisation of the effect of hydrogen isotope partition on palladium in the course of catalytic dehalogenation in solution.Table 3. Effect of isotopy on the molar radioactivity of labelled products of hydrogenolysis in aqueous solution. [3H] (%) Amol (Ci mmol71) for different aH±T values 12 4.7 3.6 2.5 26.0 17.8 12.5 9.3 7.3 5.8 4.7 3.2 2.2 27.8 23.3 19.1 15.9 13.4 7777 28.3 25.4 22.2 19.5 17.1 15.1 13.3 10.2 7.7 99 95 90 85 80 75 70 60 50 7777713.2 11.5 8.6 6.3 One of the ways of minimisation is enhancement of the rate of the main dehalogenation reaction, which can be achieved using more active palladium catalysts. The Amol can increase with the greater palladium/bromo-substituted compound ratio. This is characteristic mostly of purine compounds. Yet another method for the increase in molar radioactivity is the use of catalysts with a low (0.01% ± 0.05%) percentage of supported palladium.31 In such catalysts, virtually no dissolution of the hydrogen isotopes occurs, and the hydride form is absent.If the protium ± tritium partition coefficient is assumed to be equal to 2.5, the molar radioactivity of the dehalogenation product with 95% tritium must reach 25.4 Ci mmol71, which is consistent with the experimental data.31 In practice, low-percentage supported palladium catalysts are rarely employed, since satisfactory yields of the target products are obtained at definite precursor/catalyst ratios in the reaction mixture (approximately 1 g of a catalyst per 1 mg of a precursor). This requires a larger volume of the solvent and, consequently, leads to a greater volume of the reaction tube, increased uptake of gaseous tritium, more difficult stirring of the reaction mixture, etc.Gordeeva et al.32 have described the synthesis of nucleoside 50-triphosphates labelled with tritium in position 5 of the pyrimi- dine ring and in position 8 of the purine ring by catalytic dehalogenation of the corresponding bromo-substituted precur- sors.32 The Amol values of the compounds obtained are presented in Table 4. As a rule, the tritium-labelled nucleoside 50-triphos- phates have higher molar radioactivities than the nucleoside 50- monophosphates prepared under similar conditions. These results correlate with the suggested 30 interrelation of such parameters as the sorption degree of the initial compounds on the catalyst and232 Table 4.Results of catalytic dehalogenation of bromo-substituted nucleo- side 50-triphosphates with gaseous tritium.32 Catalyst Initial compound Amol / Ci mmol71 8-Bromo-ATP 8-Bromo-dATP 8-Bromo-GTP 8-Bromo-dGTP 5-Bromo-UTP 5-Bromo-dUTP 17 15 18 11 195 18 17 23 12 14 21 18 5-Bromo-CTP 5-Bromo-dCTP 5% Pd/BaSO4 5% Pd/BaSO4 a-Pd 5%Pd/BaSO4 a-Pd 5% Pd/BaSO4 a-Pd 5%Pd/BaSO4 a-Pd 5% Pd/BaSO4 a-Pd 5% Pd/BaSO4 5% Pd/BaSO4 Notes. Abbreviations: ATP, adenosine 50-triphosphate; dATP, 20-deoxy- adenosine 50-triphosphate; GTP, guanosine 50-triphosphate; dGTP, 20-deoxyguanosine 50-triphosphate; UTP, uridine 5 0-triphosphate; dUTP, 20-deoxyuridine 50-triphosphate; CTP, cytidine 50-triphosphate; dCTP, 20-deoxycytidine 50-triphosphate.the molar radioactivity, as well as the dependence of the latter on the ratio of the rates of dehalogenation and heterogeneous isotopic exchange of gaseous tritium with water. Catalytic dehalogenation of respective bromo-substituted precursors has been employed for the synthesis of the following compounds:33 ± 40 Compound Amol / Ci mmol71 [5-3H]20,30-Dideoxycytidine [8-3H]ATP [2-3H]ATP [5-3H]dCTP [6-3H]Thymine [2-3H]Adenine [2-3H]Adenosine [8-3H]9-[(2-Hydroxyethoxy)methyl]guanine [5-3H]1-b-D-Arabinofuranosylcytosine 1-([3-3H]Tetrahydrofuryl-2)-5-fluorouracil [8-3H]9-b-D-Arabinofuranosyladenine 5-Amino-7-(2[20,30,50-3H2]phenylethyl)-2-(2-fu- 68.6 7726.2 15.0 712.7 725.0 20.0 29.7 20.0 ryl)pyrazolo[4,3-e]-1,2,4-triazolo[1,5-c]pyrimi- dine Tritium-labelled purine and pyrimidine nucleoside phos- phates have been prepared by catalytic dehalogenation of respec- tive bromo-substituted precursors with gaseous tritium.41 Baraldi et al.42 have synthesised three tritiated inhibitors of reverse transcriptase by hydrogenolysis of bromobenzooxazole precursors.The molar radioactivity of the compounds obtained was 3 ± 10 Ci mmol71. In the process of dehalogenation, tritium can be incorporated not only into the heterocyclic base but also into the carbohydrate moiety of the molecule. Thus dehalogenation of the correspond- ing precursor has yielded [20,30-3H]20,30-dideoxythymidine 50-phosphate.43 The experimental procedure for the catalytic dehalogenation in solution is relatively simple and the products have rather high molar radioactivity.In these products, the tritium label is as a rule in a definite position determined by the replacement of the halogen atom by tritium. With a set of halogenated precursors at disposal, this reaction can be used for the synthesis of a series of the required tritium-labelled compounds. A disadvantage of this method is the necessity to synthesise special halogenated precur- G V Sidorov, N F Myasoedov sors. For example, in order to prepare [2-3H]ATP it was necessary to carry out a six-stage synthesis of 2-bromo-ATP from guano- sine.35 III.Catalytic dehalogenation without a solvent The solvent-free method of catalytic dehalogenation has been proposed for the synthesis of 3H-labelled uracil.44 For this purpose, 5-iodouracil applied onto a Pd catalyst was treated with gaseous tritium under the conditions of a high-voltage and high- frequency discharge. This resulted in the formation of [5-3H]uracil (Amol=16.1 Ci mmol71). Tritium-labelled thymine was pre- pared by the dehalogenation of 5-halogenomethyluracil with gaseous tritium over a Pd catalyst at 100 8C.45 This method has been studied in detail in the synthesis of tritium-labelled compo- nents of nucleic acids and was called solid-state catalytic reductive dehalogenation (SCRD).46 The SCRD reaction can be initiated in two ways, viz., by a high-voltage and high-frequency electric discharge 47 and heating from 50 to 150 8C.48 The kinetics of SCRD has been investigated and its mathematical model has been proposed in which the catalyst was regarded as a consumable component of the reaction.The proposed model explains well the dependence of the yield and Amol of the target compounds on the percentage of palladium on the support. Some kinetic character- istics of SCRD are presented in Table 5. The SCRD method was employed for the preparation of the following 3H-labelled com- pounds:46 Compound Compound Amol / Amol / Ci mmol71 Ci mmol71 16.4 16.1 3.1 12.4 16.3 6.7 10.6 11.5 18.5 [8-3H]20-deoxy- adenosine [8-3H]AMP [8-3H]GMP [5-3H]UMP [5-3H]CMP [8-3H]dAMP [8-3H]dGMP [8-3H]dCMP 4.9 5.2 2.8 5.9 2.1 1.6 1.7 33.0 [5-3H]Uracil [Methyl-3H]thymine [8-3H]Guanine [5-3H]Cytidine a [8-3H]Guanosine [8-3H]Adenosine a [5-3H]Uridine a [5-3H]20Deoxy- uridine a [5-3H]Deoxycy- tidine a a Degradation products of the corresponding nucleotides.If SCRD is carried out at elevated temperatures, some by- products are produced along with the target compounds due to the cleavage of the phosphoester and N-glycosidic bonds. The molar radioactivity of degradation products is higher than that of the target compound, which seems to be related to molecular excitation upon cleavage of these bonds. The results obtained indicate that the Amol of the compounds does not reach its theoretical value on substitution of one halogen atom by tritium (29.12 Ci mmol71). This is explained 46 by dilution of the initial gaseous tritium by the mobile hydrogen present in the substan- ce ± catalyst system (hydrogen is capable of rapid isotope Table 5.Kinetic parameters of SCRD of bromo-substituted components of RNA.46 E/ cal mol71 Initial compound Reaction rate constant (min71 mmol72) at different temperatures (8C) 23 35 56 78 100 33.25 16.15 10.29 8-Bromo-AMP 30.45 20.62 14.03 10.42 8.06 3380 8-Bromoguanosine 30.43 25.20 15.18 11.25 9.09 3670 5-Bromo-UMP 24.00 17.15 10.80 6.55 4.74 4760 5-Bromo-CMP 4.89 1.76 6470Synthesis of tritium-labelled biologically important diazines exchange). In the solid-state process, some labile hydrogen is present in the compound to be labelled and in the catalyst itself.46 It was found experimentally that 100 mg of 5% Pd/C catalyst contains 0.21 mmol of hydrogen capable of isotope exchange with tritium.The SCRD process has not found wide practical usage for the synthesis of tritium-labelled diazines, since the reactions in sol- ution are experimentally simpler and make it possible to obtain comparable, and often higher, Amol values of the products. Nonetheless, the appearance of the SCRD method may be regarded as an important stage in the development of solid-state reactions involving gaseous tritium. IV. Reactions of isotope exchange There is a certain distinction between reactions of isotope exchange with tritium-containing solvents (including tritiated water) and catalytic reactions involving gaseous tritium.The reactions of catalytic isotope exchange are most often carried out using heterogeneous palladium catalysts,49 homogeneous cata- lysts, such as trifluoromethanesulfonic acid,50 rhodium trichloride and ruthenium acetylacetonate,51 as well as catalysts composed of polymers 52, 53 and metals (Pt, Ni, Rh) applied to hydrophobic supports (Teflon, polyethylene, polystyrene).54 The isotope exchange of activated aromatic protons in the AcO3H± 3HCl solution has been investigated.55 The catalytic role of metals and hydrogen ions has been discussed in Ref. 56. 1. Reactions with tritium-containing solvents Reactions with a tritium-containing solvent, which is most often represented by tritiated water, are usually carried out in a strongly alkaline aqueous solution.57 Werstiuk and Ju 58 have proposed a preparative method for the specific introduction of hydrogen isotopes into fused benzoheterocycles. This method is based on the isotope exchange with deuterated or tritiated water at a temperature above 145 8C.The methods for the preparation of heterocyclic and heteroaromatic compounds containing hydrogen isotopes have been reviewed.59, 60 The nucleic acid components exchange most readily the proton bound to the C(8) atom of the purine bases. The hydrogen bound to the C(2) atom is exchanged with a much greater difficulty. For example, by employing 1H NMR spectroscopy (pD 6 ± 7, 100 8C), Wong and Keck 61 have shown that the rate of isotope exchange of hydrogen at the C(8) atom of adenine is *1000 times as high as that at the C(2) atom.Eidinhoff and Knoll 62 observed the exchange of the proton bound to the C(8) atom of adenine in the presence of a reduced platinum catalyst. The hydrogen isotope exchange has also been reported to occur on heating (>90 8C) of purine and adenosine in D2O.63, 64 Such an exchange leads to the disappearance of the peak corresponding to signals for the protons at the C(8) atom in the 1H NMR spectra of these compounds. IR spectroscopy of the isotope exchange in the purine base residues in the DNA macro- molecule has also pointed to the preferential exchange of the C(8) hydrogen.65 Shelton and Clark 66 have used the reaction of isotope exchange for the incorporation of tritium into purine compounds. This reaction was conducted in an alkaline medium with tritiated water on heating to 100 8C.It was established that the guanine compounds were labelled more rapidly than the adenine ones. The exchange rate is increased in both bases as the pH is increased from 2 to 11. The conditions for tritium labelling are rather mild. This allowed one to apply them for the preparation of tritium- labelled nucleosides (adenosine, deoxyadenosine, and nucleoti- des), adenosine 30,50-cyclomonophosphate 67 and ATP.68 The kinetics of isotope exchange with water and the depend- ence of the rate constant of isotope exchange in ATP and GTP on pH have been ivestigated.69 The kinetics of the incorporation of the tritium bound to the C(8) atom of purines of poly(A), poly(A)- poly(U) duplex, RNA, tRNA andDNAwas studied by Gamble et 233 al.70 The reaction of tritium ± hydrogen exchange has been used for the introduction of tritium into oligonucleotides,71 oligodeox- yribonucleotides,72 polyribonucleotides,73 DNA,74 ± 77 tRNAIleu and tRNATyr from yeast.78 Drutsa 79 has proposed optimal conditions for the introduction of tritium into oligodeoxyribonu- cleotides: 2 ± 4 h at 60 8C in tritiated water in an 0.3 M NaOH solution.Isotope exchange with tritiated water has been used for the preparation of an inhibitor of 5-lipoxygenation of arachidonic acid, which is an antiprostatic agent (Amol=19.8 Ci mmol71).80 Mackenzie et al.81 have investigated the isotope exchange of the hydrogen bound to the C(2) atom in ethyl 5-amino-1-(2,3-O- isopropylidene-b-D-ribofuranosyl)imidazole-4-carboxylate (pH 1.77 ± 12.0, 65 8C).The analysis of changes in the isotope exchange rate of protons at the C(8) atom of purine residues provided information about conformational changes in natural biopolymers such as polynucleotides 82 ± 85 and RNA.70, 86, 87 It has been established that the rate of hydrogen exchange at the C(8) atom in adenine, guanine and hypoxanthine in nucleic acids is comparable with the respective rates in nucleoside monophosphates.88 In DNA, the protium ± tritium exchange is approximately 2.4 ± 2.8 times as slow as that in deoxynucleoside monophosphates.89 The study of the mechanism of isotope exchange with water in the C(8)H groups of purines has shown 87, 90, 91 that the exchange proceeds by the so-called ylide mechanism, viz., not in neutral molecules, but in the protonated [at the N(7) atom] forms of purine derivatives and in zwitter-ions with a positive charge on the N(7) atom. Agranovich et al.92 have studied the kinetics of protium ± tritium exchange between water and the C(8)H group of purine bases, mono- and polynucleotides for different specific radioactivities of the medium over a wide temperature range (from 4 to 80 8C) and for different pH.It was shown that at high specific radioactivity of the medium, two non-competitive parallel exchange reactions occur simultaneously in the temperature interval studied: one follows the ylide mechanism and the other proceeds with participation of highly reactive radicals resulting from radiolysis of water under the action of b-radiation from tritium.The relative contribution from the radical exchange to the observed reaction rate decreases with higher temperature and lower specific radioactivity of the medium. In the case of poly- nucleotides and DNA, the isotope exchange follows basically the ylide mechanism at temperatures above 25 8C and in the case of nucleotide 18c � above 37 8C (at a specific radioactivity of the medium of 1 Ci ml71). The increase in the medium acidity to pH 1 accelerates appreciably the radical exchange reaction, while the presence of b-mercaptoethanol decelerates it sharply.Changes in the observed hydrogen exchange rate in the C(8)H group of purine allow the estimation of variation of the pKa of polynucleo- tides and nucleic acids caused by changes in the macromolecular conformation.93 The protons bound to the C(5) atom of pyrimidines are readily exchanged for tritium from the tritium-containing water in uracil photohydrates. The isotope exchange between 5,6-dihydro-6- hydroxyuridine 50-phosphate and tritiated water with heating yields 5-tritium-substituted uridine 50-phosphate.94 Boer and Johns 95 have reported a method for the preparation of tritium- labelled 5,6-dihydro-6-hydroxyuridine 50-phosphate on heating with tritiated water.Similar exchange was observed in the photo- hydrates of cytosine derivatives.95 The reaction of hydrogen isotope exchange between uracil and tritiated and deuterated water proceeds only in the presence of Pt and Pd catalysts.96, 97 In the absence of a catalyst, this reaction takes place only under very drastic conditions.98 ± 100 The exchange of C(5) hydrogen is markedly easier than that of the C(6) hydrogen. Wechter 101 has proposed conditions for isotope exchange allowing the selective deuteration of C(6) in pyrimidine nucleosides. This method consists in the synthesis of 5,6-dideuterio compounds and the reexchange of deuterium from position 6 under special conditions. An analogous method has been proposed by Rabi and Fox.102 Isotope exchange of the hydrogen bound to the C(5) in pyrimi-234 dines is accelerated in the presence of citrate buffer 103 and such compounds as 2-mercaptoethylamine, ethylamine, ethanolamine, sodium hydroxide,104 hydrogensulfite anion,105, 106 methyl-, dimethyl- and trimethyl-amine hydrogensulfites, ethyl- and diethyl-amine, and imidazole,107 cysteine and other sulfur-con- taining compounds, e.g., 2-mercaptoethanol.108, 109 Under spe- cific conditions, the reaction of nucleic acids with hydrogensulfite in the presence of tritiated water results in the transformation of the cytidine fragments into uridine fragments.106 In all cases, the isotope exchange proceeds under mild conditions.Tritium is incorporated into uracil and cytosine derivatives in alkaline and acidic medium, respectively. These reactions can be used for the synthesis of tritium-labelled pyrimidine derivatives.Hesk et al.51 have described a method for homogeneous hydrogen isotope exchange under the action of RhCl3 in dime- thylformamide at 110 8C, which allows high regioselective intro- duction of tritium in the ortho-position of various aromatic acids, amides, amines and heterocyclic compounds. This study has also shown that in addition to RhCl3, ruthenium acetylacetonate is another efficient catalyst of isotope exchange in the ortho-position of benzoic acids. The reaction with tritium-containing solvents is a versatile method for the preparation of tritium-labelled compounds, dia- zines in particular. This method does not require synthesis of special precursors, and the conditions of tritium labelling are sufficiently mild to allow its use for the incorporation of this label into compounds of rather complex structure, e.g., nucleic acids.When employing this reaction, the main attention should be paid to the choice of efficient homogenous or heterogeneous catalysts and solvents (tritium sources). A disadvantage of this method is a relatively low level of molar radioactivity of the target products. This is mainly determined by the specific radioactivity of the tritiated water used, which usually does not exceed 100 ± 200 Ci ml71 (3% ± 6% of its theoretical level). Tritiated water with higher specific radioactivity is unstable because of its autoradiolysis.Reactions of isotope exchange may be carried out with the tritiated water with very high specific radioactivity if it is mixed with an inert anhydrous organic solvent.110 The isotope exchange with steroids has demonstrated 110 that the maximum Amol is reached when a solution of 3H2O (2% ± 3%) in an inert solvent is used. This corresponds to a volume radioactivity of a solution of 65 ± 100 Ci ml71. Solutions of highly active tritiated water were prepared by the oxidation of gaseous tritium over palladium oxide in an anhydrous organic solvent. Tritium- labelled benzylaminopurine has been obtained using highly active 3H2O (Amol=24 Ci mmol71).111 The proposed method is labo- rious, while disadvantages such as relatively low levels of molar radioactivity (a few tens of Ci mmol71) and the necessity to use large volumes of tritiated water prevent its wide application for the synthesis of tritium-labelled components of nucleic acids.How- ever, this method proves to be virtually the only one ssible for compounds containing groups that can be readily reduced and/or hydrogenated (e.g., steroids and pharmaceutical preparations 112). 2. Catalytic liquid-phase heterogeneous isotope exchange with gaseous tritium In 1974, two reports 113, 114 were published simultaneously on the method of tritium labelling of organic compounds based on isotope exchange of gaseous tritium with hydrogen in the com- pound subject to labelling dissolved in an appropriate solvent in the presence of heterogeneous catalysts.Buchman et al.113 have proposed a method of non-specific labelling with gaseous tritium in the presence of an activated platinum catalyst. The catalyst PtO2 was more active than PdO in the isotope exchange reac- tion.115 Evans et al.114 conducted the isotope exchange reaction in a phosphate buffer in the presence of a PdO/BaSO4 catalyst. Tritium was incorporated into carbohydrates, aliphatic and aromatic amino acids and nucleic acid components. Table 6 shows the conditions of isotope exchange reactions for the introduction of tritium into purine and pyrimidine compounds Table 6. Purine and pyrimidine compounds prepared by catalytic hetero- geneous isotope exchange with gaseous tritium.114 Compound Arabinosyladenosine Adenosine cAMP AMP ATP 20-Deoxyadenosine 20-dATP N6,O20 -Dibutyryl-cAMP Guanosine cGMP GTP IMP Nicotinamide NAD Puromycin Puromycin aminonucleoside Thymidine Uracil Notes.Abbreviations: IMP, inosine 50-monophosphate; NAD, nicotin- amide adenine dinucleotide. with this method. This is of a high practical value for the synthesis of tritium-labelled components of nucleic acids. Presumably, the isotope exchange proceeds by the free-radical mechanism and is facilitated for mobile hydrogen atoms, such as aromatic protons and hydrogen bound to the C(8) atom of purines. One could hardly expect high levels of molar radioactivity for the compounds with aliphatic protons, and it seems for protons combined with C(5) and C(6) of pyrimidines.Hanus et al.116 have employed heterogeneous catalysts (PdO, PtO2 and Pd/BaSO4) in order to investigate the process of tritium incorporation into such com- pounds as dioxane, tetrahydrofuran, ethyl acetate, dimethylfor- mamide, dimethylacetamide and acetic anhydride. It was shown that the proportion of tritium incorporated by the direct inter- action with the solvent is negligibly small compared with that introduced in the presence of catalysts. The degree of tritium incorporation depends on the solvent purity. In extremely pure solvents, the tritium is present in the form of heavy water. The method of catalytic heterogeneous exchange with gaseous tritium has allowed synthesis of [3H]acyclovir 39 and the following tritium-labelled compounds:117 ± 120 Compound 5-Azacytidine 5-Aza-20-deoxycytidine N4-(5-Aminopentyl)cytidine 5-Methylcytidine 5-Methylcytosine Arabinosyl-5-azacytosine 5-Hydroxy[6-3H]uracil 5-Amino[6-3H]uracil 1-b-D-Arabinofuranosyl[5,6-3H]cytosine 9-[(2-Hydroxyethoxy)methyl][8-3H]guanine 9-b-D-Arabinofuranosyl[8-3H]adenine Kaminskii et al.38 have demonstrated that the use of AMP 1-N- oxide as the precursor facilitates significantly the tritium exchange G V Sidorov, N F Myasoedov Reaction conditions Amol / Ci mmol71 t/ min pH8.2 8.2 10.0 10.0 5.6 12.0 25.0 11.0 20.0 17.0 18.1 19.5 8.2 8.2 10.0 10.0 240 120 60 960 60 210 60 60 120 20 305 20 60 20 120 120 120 120 60 60 60 60 0.42 0.88 1.5 1.2 3.9 2.7 2.7 773.7 13.7 5.0 7.0 9.0 2.5 8.0 8.0 8.2 8.0 8.0 8.0 8.0 8.0 8.0 8.2 8.2 8.0 8.0 8.0 8.0 Amol / Ci mmol71 17.4 19.5 3.0 1.9 4.2 12.5 0.35 2.4 12.0 8.8 1.0Synthesis of tritium-labelled biologically important diazines at the C(2) atom of the adenine ring.Introduction of tritium into adenine dinucleoside phosphates 121 and the P7H group of 20-deoxyadenosine 50-H-phosphonate has been described.122 The rate constants for liquid-phase catalytic heterogeneous protium ± tritium exchange of [8-3H] nucleotides of the adenine series with hydrogen 123 have been measured (the experimental procedure is given in Ref. 124). It has been established 125 that the exchange rate decreases in the following sequence: cAMP>AT- P>ADP>AMP.An equation of the dependence of the rate constant for isotope exchange on pH has been deduced. At low concentrations of nucleotides, the reaction order with regard to nucleotide is 1, whereas at higher nucleotide levels it is close to 0. Lacey et al.126 have described a general method for specific introduction of tritium label into benzoimidazole carbamates (BIC), which includes catalytic isotope exchange in dioxane at 60 8C under gaseous tritium. The yield of labelled BIC was found to range from 8% to 70% with the molar radioactivity varying from 0.44 to 13.4 Ci mmol71. The use of gaseous tritium in the presence of a catalyst based on iridium complexes has made it possible to obtain high levels of molar radioactivity for benzo- phenones, quinolines, 2-aminopyridines, 2-aminobenzooxazole derivatives, benzoazepinone amides and complex benzamides.127 It is noteworthy that the reactions of catalytic dehalogenation and catalytic heterogeneous isotope exchange proceed under similar conditions.This fact should be taken into account in conducting catalytic reactions of hydrogenation, dehalogenation, etc. The tritium label can be introduced by both a chemical reaction and isotope exchange. For example, dehalogenation of monobromopapaverine on a palladium catalyst yielded a product with Amol=43 Ci mmol71 (see Ref. 128). In this case, the percentages of the label due to the tritium substitution for bromine and the exchange of the methylene group proton with tritium were 49% and 46%, respectively, with 5% of the tritium introduced in other positions.A similar process takes place on dehalogenation of 2-halogeno-purines: tritium substitutes hydrogen at the C(2) atom owing to dehalogenation reaction and at the C(8) atom owing to isotope exchange.38 This reaction underlies the most versatile method used for the preparation of tritium-labelled compounds. As regards its general character, the method described is comparable to the isotope exchange with a tritium-containing solvent. The main advantage of this method consists in high levels of molar radioactivity of the compounds obtained. This is due to the fact that the isotope source is a high-percentage (>95%) gaseous tritium whose molar radioactivity is higher than that of any tritium-containing solvent.A disadvantage of this method is that processes of dehalogena- tion, hydrogenation and reduction of various functional groups can take place under given reaction conditions. V. Reduction and hydrogenation Processes of reduction and hydrogenation are used mostly for the introduction of tritium into the methyl group of thymine and its derivatives, and also into the carbohydrate moiety of nucleosides. Reduction is usually performed by means of catalytic reactions using gaseous tritium and tritium-labelled NaBH4 and LiAlH4. Coates et al.129 have proposed to use lithium triethylborotritide (super-tritide) obtained by the reaction of LiT with Et3B for the incorporation of tritium into various compounds by the reduction of certain functional groups.Tritium-labelled thymidine (Amol=27.5 Ci mmol71) was prepared by the reduction of 5-hydroxymethyl-20-deoxyuridine in the presence of rhodium on alumina as a catalyst.130 Tritium- labelled 5-hydroxymethyl-20-deoxyuridine was synthesised by the reduction of 5-formyl-20-deoxyuridine in a phosphate buffer.131 Hydrogenation of 5-hydroxymethyl- and 5-formyluracil in the presence of a palladium catalyst yielded 132, 133 thymine with up to 2 tritium atoms in the methyl group. Successful application of Raney nickel for the reduction of 5-formyluracil to 5-hydroxyme- thyluracil has been reported.134 Hydrogenation of 5-formyluracil in water with gaseous tritium over 1.5% Pd/BaSO4 produced 5- hydroxymethyl[hydroxymethyl-3H]uracil (Amol= 64.8 Ci m- mol71).135 Further reduction of the latter with tritium over palladium in dry dioxane yielded [methyl-3H]thymine.136 In order to prepare thymine with the complete substitution of hydrogen by tritium in its methyl group, Yakovleva et al.137 carried out catalytic reduction of 5-cyanouracil to aldimine followed by its hydrolysis to 5-formyluracil with subsequent catalytic reduction with gaseous tritium.Reduction of 5-formy- luracil ethylene dithioacetal with tritium in dioxane over Raney nickel also led to the formation 138 of [methyl-3H]thymine (Amol= 11.6 Ci mmol71). Catalytic reduction of 5-formyluracil with gaseous tritium is described in Ref. 139.One-stage methods for the preparation of tritium-labelled thymidine 50-monophosphate (TMP, 27) have been reviewed.140 The precursors of TMP were 5-hydroxymethyl-dUMP (26) and 5-formyl-dUMP. It was established that under specific conditions (depending on the nature of catalyst employed and the reaction medium) hydrogenation can affect the 5,6-double bond of the pyrimidine ring and lead to the formation of 5-hydroxy- methyl-5,6-dihydro-dUMP (28), 5,6-dihydroTMP (29), 20-hydroxy-3-(N1-20-deoxy-50-phospho-b-D-ribofuranosyl)ureido- isobutyric acid (30), and 3-(N1-20deoxy-50-phospho-b-D-ribofur- anosyl)ureidoisobutyric acid (31). H2, Cat O CH3 HN O NdRP 27 H2, Cat O CH3 HN O NdRP 29 H2O H2N The general method used for the synthesis of nucleosides labelled with tritium at the 50-atom of the carbohydrate residue is based on the reduction of b-D-ribopentodialdo-1,4-furanosides of respective nucleic bases with gaseous tritium or sodium boro[3H]hydride. This method was used for the preparation of compounds labelled at the 50-position, such as 9-b-arabino- furanosyladenine,141 thymidine,138 20,30-O-isopropylideneadeno- sine.142 In order to prepare adenosine, guanosine and uridine labelled with tritium at C(50), Akulov et al.143 conducted the reduction reaction using gaseous tritium in the presence of a catalyst as well as sodium boro[3H]hydride.Synthesis of [50-3H]30- azido-30-deoxythymidine (Amol=14 Ci mmol71) was carried out 235 O CH2OH HN O NdRP 26 H2, CatO CH2OH HN O NdRP 28 H2O dRP CH2OHO N H2N OH O 30 H2, Cat dRP CH3 O N 31 OH O236 by the oxidation of its precursor to 50-aldehyde and subsequent reduction with NaB3H4.144 Introduction of deuterium and tritium in the positions 50 and 40 of 20-deoxynucleosides is described in Ref.145. For this purpose, the corresponding 50-aldehydes were prepared from deoxyguanosine, deoxycytidine and thymidine by the Moffatt method and then reduced with NaBD4 to form 50-deuterionucleosides. Heating of 50-aldehydes in a D2O7Py mixture (1 : 1) with subsequent reduction yielded 40-deuteronu- cleosides. It is pointed out that the use of a similar procedure for the tritiation yields labelled compounds with low molar radio- activity.A recent US patent 146 describes a method of tritium introduction into oligodeoxyribonucleotides in which an immo- bilised oligonucleotide with a free 50-hydroxy group is oxidised with an appropriate agent to aldehyde and then reduced, e.g., with NaB3H4, to give a tritium-labelled 50-hydroxymethyl group. Riboflavin (vitamin B2) selectively labelled with tritium in the position 50 was prepared 147 by the reduction of the 50-aldehyde group with sodium boro[3H]hydride. Synthesis of [ribose- 2,3-3H]20,30-dideoxycytidine phosphonate,43 [ribose-2,3-3H]20,30- dideoxyadenosine and [ribose-2,3-3H]20,30-dideoxyinosine 33 was carried out by catalytic hydrogenation of the corresponding unsaturated analogues with gaseous tritium.The key compound in the synthesis of tritium-labelled nucleo- tides and nucleosides is D-ribose. The use of tritium-labelled D- ribose and heterocyclic bases in enzymic reactions 12, 24, 148, 149 allows synthesis of nucleosides and nucleotides containing tritium in the ribose and heterocyclic moieties of the nucleoside and nucleotide molecules. We have proposed the following scheme for the synthesis of tritium-labelled D-ribose: reduction of 1,2:5,6- di-O-isopropylidene-a-D-ribohexofuranos-3-ulose (32) by tritium to 1,2:5,6-di-O-isopropylidene-a-D-allofuranose (33), oxidation of 1,2-O-isopropylidene-a-D-allofuranose (34) to 1,2-O-iso- propylidene-a-D-ribopentodialdofuranose (35) and reduction of the latter to 1,2-O-isopropylidene-a-D-ribofuranose (36) com- bined with the hydrogen isotope exchange at the C(1) atom.OCH2 HOCH2 OCH2 OCHO HOCHO OCHO T2, Pd AcOH NaIO4 * * O O O HO O 33 HO O 34 O O 32 O HOCHTO HOCHTO CHO HCl T2, Pd * * * * * OH O O HO O 35 HO OH 37 HO O 36 (The asterisks indicate the sites of tritium incorporation). These consecutive reactions make it possible to synthesise the tritium-labelled D-ribose (37) with up to 3 tritium atoms. VI. Solid-state catalytic hydrogenation The method of solid-state catalytic hydrogenation (SCH) was proposed in 1967. Dehalogenation of 5-iodouracil may be regarded as an example of SCH reaction. Subsequent studies have shown that hydrogenation 150 and isotope exchange 151 occur under similar conditions.This method consists in the treatment of a solid mixture of the initial compound and catalyst with gaseous tritium. In order to intensify the process, an external supply of energy was provided. The optimum version of the initiation of this reaction proved to be heating of the reaction system. The solid- state reactions of isotope exchange have been further developed in the studies of Meshi and Takahashi.152 The use of catalysts increases appreciably the extent of tritium incorporation and its G V Sidorov, N F Myasoedov selectivity. Zolotarev et al.,150, 151 who investigated SCH in the reactions of hydrogenation, reduction and isotope exchange, have concluded that a new process took place in all cases.It has been demonstrated 153, 154 that the SCH is based on the spillover of hydrogen activated on the catalyst and its diffusion into the layer of organic compound. A diffusion model of this process has been proposed.155 The applicability of this model was exemplified with solid-state isotope exchange in thymine accompanied by the hydrogenation of the 5,6-double bond.156 The extent of isotopic substitution in the SCH reaction depends on the nature of the metal used as the catalyst (Pd, Pt, Rh, Ru) and support (BaSO4, CaCO3, Al2O3, SiO2, C), the catalyst ± compound ratio and the reaction temperature. The application of the SCH method for the synthesis of biologically important diazines labelled with tritium gave good results.Solid-state catalytic hydrogenation of 5-formyluracil afforded thymine with the molar activity corresponding to the incorporation of three tritium atoms into the methyl group.132, 133 Investigation of the hydrogenation kinetics of 5-formyluracil has shown 157 that starting from a definite temperature, the incorpo- ration of tritium into thymine exceeds the stoichiometry corre- sponding to the reduction of the formyl group. This is explained by the fact that under given conditions, the reduction is accom- panied by a parallel reaction of isotope exchange of the formyl group hydrogen with tritium. This leads to thymine with a virtually complete substitution of hydrogen by tritium in its methyl group (Amol^87 Ci mmol71).The use of another pre- cursor, viz., 5-hydroxymethyluracil, a specially selected catalyst and more drastic reaction conditions have permitted synthesis of thymine 157 in which all tritium was substituted for hydrogen over all the C7H bonds (Amol>100 Ci mmol71), and the use of 5-hydroxymethyldeoxyuridine as the precursor has yielded tritium-labelled thymidine (Amol=76 Ci mmol71).158 Let us consider the basic regularities of the introduction of tritium label by the SCH method with synthesis of specific compounds as an example. It has been shown 157 that in the SCH reaction of tritium with purine bases the rate of isotope exchange is sharply increased in the temperature range 150 ± 170 8C. This leads to a virtually complete substitution of hydrogen by tritium.The results of synthesis of 11 alkylxanthines labelled with tritium using the SCH reaction are presented in Ref. 159. Analysis of the labelled compounds by 3H NMRspectroscopy has revealed that the tritium label was incorporated not only in the C(8) position but also in the alkyl groups. The dependences of the yield of compound 22 prepared by SCH with tritium and of its molar radioactivity on temperature and the catalyst/compound ratio have been investigated.160 The same dependences for com- pounds 19 and 21 were studied by Lushkina et al.161 It has been found that for virtually all the compounds studied the higher temperature and the greater catalyst/compound ratio the lower the yield of specific products but the higher its molar radioactivity.Thus, the variation of reaction conditions [temperature, catalyst, catalyst/compound mass ratio and reaction time] opens wide possibilities for the synthesis of labelled compounds. The main side reaction of SCH is degradation (thermolysis) of the initial compound. The products of the synthesis of tritium- labelled 20,50-oligoadenylate were found to include an isomer- isation product, viz., 30,50-isomer, which was separated by chro- matography.162 In the case of SCH of pyrimidines, hydrogenation of the 5,6-double bond of the heterocyclic ring may occur in parallel leading to the formation of compounds 28 ± 31. The SCH method was employed for the introduction of a tritium label into compounds of a more complex structure such as polynucleotides and natural polymers,162 e.g., 15S RNA.The liquid- and solid-state catalytic isotope exchange with gaseous tritium in thymidine 50-H-phosphonates, 20-deoxyadenosine, and 20-deoxy-5-hydroxymethyluridine has been investigated.163 Anal- ysis by 3H NMR spectroscopy has revealed that tritium is incorporated into the P7H group. The solid-state method for the preparation of tritium-labelled DNA synthesis terminatorsSynthesis of tritium-labelled biologically important diazines (22, 23, azidothymidine phosphonate, acyclovir phosphonate, 30-deoxythymidine) is described in Ref. 43. The tritium-labelled 50-O-phosphonylmethylthymidine (Amol=71 Ci mmol71) was obtained by the solid-state reaction of isotope exchange at 150 8C.164 Table 7 lists the Amol values of tritium-labelled purine and pyrimidine compounds prepared by the SCH method.The values presented are higher than those for these and analogous com- pounds labelled by other methods. For compounds of relatively simple structure, such as 2, 3, 10 ± 13, a virtually complete isotope substitution of hydrogen by tritium has been attained. Variation of the solid phase composition and temperature permits the directed modification of the yield and the molar radioactivity of specific compounds. The SCH method does not require synthesis of special precursors and offers the possibility of a greater degree of hydrogen substitution by tritium than do other methods. Degradation of thermally labile compounds, the occurrence of parallel reactions of hydrogenation, dehalogenation and reduc- tion of various functional groups may be regarded as disadvan- tages of the SCH method.However, in many cases these disadvantages are not critical since a careful choice of reaction conditions makes it possible to minimise (as far as possible) the influence of side reactions and to synthesise compounds contain- ing the groups (the 5,6-double bond of pyrimidines) susceptible to hydrogenation and even some thermally unstable compounds (oligo- and poly-nucleotides, RNAs). Thus, the SCH method may be regarded as one of the most promising methods for the synthesis of tritium-labelled natural diazines, in particular, of the components of biologically impor- tant substances. Table 7.Molar radioactivities of diazines obtained by SCH reactions. Compound 170 210 180 200 140 170 170 170 170 190 160 160 210 190 210 200 160 120 210 120 120 120 200 110 110 110 180 180 180 a From 5-formyluracil; bfrom 5-hydroxymethyluracil; cfrom thymine; dfrom 5-hydroxymethyl-20-deoxyuridine. e Specific radioactivity/ Ci g71. Adenine Guanine Xanthine Hypoxanthine Thyminea Thymine b Thymine c Alkylxanthines (11 compounds) Uracil Benzyladenine Theophylline Furfuryladenine Adenosine 20-Deoxyadenosine Guanosine 20-Deoxyguanosine Thymidine d 30-Azidothymidine Acyclovir 20,30-Dideoxythymidine 30-Azidothymidine phosphonate Acyclovir phosphonate 20,50-ApApAp 30,50-ApA 30,50-ApApA 30,50-pApApAp Poly-A (7 ± 8 S) Poly-U (12 S) 15 S RNA Amol / Ci mmol71 T/ 8C 54.2 24.9 25.1 51.1 85.0 110.0 115.0 17 ± 203 49.0 180.0 24.8 160.0 120.0 84.0 69.0 35.0 76.0 30.0 125.0 66.0 63.0 56.0 58.0 9.2 50.0 27.0 10.2 e 12.0 e 12.1 e 237 Table 8.Characteristics of different methods used for the synthesis of biologically active diazines labelled with tritium. Reaction condition Reaction Amol / Ci mmol71 Tritium incorporation by chemical synthesis Dehalogenation 15 ± 45 5 ± 20 in solution in solid state Hydrogenation, reduction 15 ± 40 40 ± 90 in solution in solid state Tritium incorporation by isotope synthesis 3 5 ± 10 up to 25 in solution " Isotope exchange with: H-solvent highly radioactive water gaseous tritium 5 ± 25 20 ± 120, up to 250 "in solid state Comparative characteristics of different methods used for the synthesis of tritium-labelled biologically important diazines are presented in Table 8.VII. Other methods of tritium labelling A number of methods exist that did not find wide application for the synthesis of tritium-labelled natural diazines. Some pyrimidine derivatives labelled with tritium in the position 5 were prepared by heating (to 160 8C) the respective iodo-substituted compounds in DMSO with tritiated water.165 The molar radioactivity of uracil, uridine, cytosine, cytidine and orotic acid thus obtained made up 30% of the Amol level of [3H]H2O.166 Electrolytic reduction of 5-bromouracil in tritiated water (mercury cathode, platinum anode) yielded [5-3H]uracil.167 Decarboxylation of 5-substituted derivatives of orotic acid labelled with tritium in the carboxyl group produced [6-3H]thy- mine 168 from 5-methylorotic acid, 5-fluoro[6-3H]uracil 169 and 5- bromouracil 170 from the corresponding 5-halogeno-derivatives of orotic acid.The molar radioactivity of these products did not exceed 1 Ci mmol71. Heating of orotic acid supported on a Cu/ BaSO4 catalyst, which was partially oxidised in air, in the tritium atmosphere yielded [6-3H]uracil (23 Ci mmol71).171 b-D-Arabi- nofuranosyladenosine (Amol=0.43 Ci mmol71) was prepared by isotope exchange with UV-activated gaseous tritium.172 Alkyla- tion of [2,8-3H2]adenosine with 4-bromo-2-methylbut-2-ene in dimethylformamide gave N6-(2-isopentyl)[2,8-3H]adenosine, which was transformed into trans-[2,8-3H]zeatin riboside (Amol=22 Ci mmol71) by allylic oxidation.173 Heating (60 8C, 2 h) of N6-(3-iodobenzyl)-N9-[methyl(2,3-di-O-acetyl-b-D-ribo- furanosyl)uronate]-2-chloroadenosine with tritium-labelled methylamine in methanol provided N6-(3-iodobenzyl)-N9-[N- methyl-(b-D-ribofuranosyl)uronamide] (Amol=29 Ci m- mol71).174 Azidothymidine was synthesised using tritium-labelled thymidine.175 Deamination of [5-3H]1-b-D-arabinofuranosylcyto- sine led to the formation of [5-3H]1-b-D-arabinofuranosyluracil (Amol=20 Ci mmol71).39 [8-3H]9-b-D-Arabinofuranosylade- nine (Amol=10 Ci mmol71),39 [2-3H]ade-nine and [2-3H]adeno- sine 38 are the products of catalytic reductive desulfurisation of the corresponding SH-derivatives with gaseous tritium. The processes of tritium incorporation from the gas phase into thymidine and deoxyuridine in an aqueous solution have been considered.176 Incorporation of tritium into these compounds resulted mainly from the attack by the 3HeT+ species rather than the radiolysis induced by b-particles.238 VIII. Conclusion Nowadays, synthesis of tritium-labelled physiologically signifi- cant compounds may be regarded as an independent field of applied radiochemistry that makes use of the approaches and methods of bioorganic chemistry, biochemistry and enzymology.This is characterised by both the development of efficient techni- ques for tritium incorporation and organisation of the production of labelled substances.The above considerations suggest a num- ber of inferences on the state-of-the-art of the synthesis of tritium- labelled diazines. In the 1970s, rapid progress of molecular biology and molec- ular genetics increased dramatically the demand for tritium- labelled components of nucleic acids. This has stimulated the development of new methods and the improvement of existing techniques of their synthesis. Tritium-labelled compounds have played an important role in the studies of the structure and functions of nucleic acids. Catalytic dehalogenation in solution may be regarded as the general method for the synthesis of the tritium-labelled components of nucleic acids.The development of this method has allowed synthesis of compounds with a definite position of the tritium label and relatively high molar radio- activities (20 ± 30 Ci mmol71). The need for the components of nucleic acids possessing high and superhigh molar radioactivity has stimulated the development of techniques for the preparation of purine and pyrimidine bases multiply labelled with tritium. These include reactions of catalytic dehalogenation (e.g., of 2,8- dichloroadenine, 5-bromouracil and 6-chlorouracil) and solid- state catalytic hydrogenation (e.g., synthesis of [2,8-3H]adenine and [methyl-6-3H]thymine from the respective unlabelled precur- sors).The use of the enzymes of purine and pyrimidine metabo- lism has opened a simple and reliable pathway for the preparation of a virtually complete set of nucleic acid components multiply labelled with tritium. The recent years witness an ever-increasing interest in the tritium-labelled pharmaceutical preparations of rather complex structures. As regards diazines, these are mainly various DNA synthesis terminators, medicinal drugs in the stage of pharma- ceutical assays and coenzymes. These and similar tritium-labelled compounds are most often synthesised by catalytic reactions of isotope exchange, in particular the isotope exchange with gaseous tritium in solution and in solid state. Such reactions may be considered as express-methods that do not require synthesis of special precursors.For example, tritium-labelled nicotinamide adenine dinucleotide (111 Ci mmol71) and coenzyme A (3.9 Ci mmol71) were prepared by the solid-state reactions of isotope exchange with gaseous tritium.177 The application of the reactions of isotope exchange involving gaseous tritium is limited by the requirement that the initial compounds contain groups capable of easy reduction or hydrogenation and are thus suscep- tible to modification or substitution by tritium. In this case, the reaction of isotope exchange with highly active tritiated water is a promising method. The possibilities of the application of this method for the synthesis of tritium-labelled biologically active substances, including diazines, have been discussed.178 References 1.A A Kraevskii, R Sh Bibilashvili, in Immunologiya. SPID (Itogi Nauki i Tekhniki) [Immunology. AIDS (Advances in Science and Engineering Series)] (Moscow: Izd. VINITI, 1992) Vol. 29, p. 123 2. M K Kukhanova, A A Kraevskii, in Immunologiya. SPID (Itogi Nauki i Tekhniki) [Immunology. AIDS (Advances in Science and Engineering Series)] (Moscow: Izd. VINITI, 1992) Vol. 29, p. 163 3. K W Rosenmund Berichte 51 585 (1918) 4. T Andre, S Ulberg J. Am. Chem. Soc. 79 494 (1957) 5. M Gut,M Uskokovic Naturwissenschaften 40 40 (1960) 6. E A Evans Tritium and Its Compounds (London: Butterworths, 1974) 7. B Cerny, J Hanus J. Labelled Compd. Radiopharm. 28 947 (1990) 8. J Filip Radioisotopy 11 61 (1970) G V Sidorov, N F Myasoedov 9.J Filip Radioisotopy 19 225 (1978) 10. W Vaalburg, B van Zanten, C Buijze Recl. Trav. Chim. Pays-Bas. 87 827 (1968) 11. J Roemer, M Kiessling Isotopenpraxis 11 150 (1975) 12. N F Myasoedov, G V Sidorov, O B Kuznetsova, V M Minov, E K Ivan'kova,M D Frank-Kamenetskaya, T Yu Lazurkina, V A Orlova Radiokhimiya 23 607 (1981) a 13. J Filip Radioisotopy 11 203 (1970) 14. J Filip, J Havlicek Yad. Energ. 15 388 (1969) 15. J Filip, H Skoda, H Hradec J. Labelled Compd. 10 59 (1974) 16. J Filip, L Bohacek Radioisotopy 12 949 (1971) 17. V M Vdovenko, V N Bobrova, E G Airapetyants, A V Zharkov, in Proizvodstvo Izotopov (Production of Isotopes) (Moscow: Atomizdat, 1973) p. 180 18. V M Vdovenko, V N Bobrova, L S Gordeeva, V K Dedova Radiokhimiya 14 457 (1972) a 19.L Bohacek, J Filip Radioisotopy 14 783 (1973) 20. V M Vdovenko, V N Bobrova, E G Airapetyants, L S Gordeeva, V K Dedova, N A Patokina Radiokhimiya 15 726 (1973) a 21. W H Sheng, Y S Hsuech, W L Wu, P Hsuech Acta Biochim. Biophys. Sin. 9 201 (1977); Chem. Abstr. 88 191 316 (1978) 22. J Filip, H Hradec Radioisotopy 29 52 (1988) 23. I Filip, L Bogachek, in Organicheskie Soedineniya, Mechennye Radioaktivnymi Izotopami (Materialy II Simp. Stran-Chlenov SEV) [Organic Compounds Labelled by Radioactive Isotopes (Proceedings of the IInd Symposium of the Country-Members of the Council for Mutual Economic Aid)] (Moscow: TsNIIatominform, 1982) Part 1, p. 102 24. N F Myasoedov, G V Sidorov, O B Kuznetsova, M D Frank- Kamenetskaya, T Yu Lazurkina, V A Orlova Radiokhimiya 26 341 (1984) a 25.N M Anikeev, V V Ivanov, V N Kramerov, F V Tatarkina, L B Kudryavtseva, V I Mishin, N A Ignat'eva, L N Kaklyushkina, in Organicheskie Soedineniya, Mechennye Radioaktivnymi Izotopami (Materialy II Simp. Stran-Chlenov SEV) [Organic Compounds Labelled by Radioactive Isotopes (Proceedings of the IInd Symposium of the Country-Members of the Council for Mutual Economic Aid)] (Moscow: TsNIIatominform, 1982) Part 1, p. 137 26. N F Myasoedov, G V Sidorov Radiokhimiya 22 574 (1980) a 27. N F Myasoedov, G V Sidorov Radiokhimiya 22 579 (1980) a 28. N F Myasoedov, G V Sidorov Radiokhimiya 22 911 (1980) a 29. N F Myasoedov, Yu G Kvyatkovskii, G V Sidorov Radiokhimiya 23 122 (1981) a 30.N F Myasoedov, G V Sidorov Radiokhimiya 23 281 (1981) a 31. N F Myasoedov, G V Sidorov Radiokhimiya 23 288 (1981) a 32. L S Gordeeva, N A Patokina, N A Korsakova, L N Rumyantseva, V K Dedova, L F Chernyshova, A G Neopikhanova, Yu L Ka- minskii, in Organicheskie Soedineniya, Mechennye Radioaktivnymi Izotopami (Materialy II Simp. Stran-Chlenov SEV) [Organic Com- pounds Labelled by Radioactive Isotopes (Proceedings of the IInd Symposium of the Country-Members of the Council for Mutual Economic Aid)] (Moscow: TsNIIatominform, 1982) Part 1, p. 127 33. G F Taylor, J A Kepler J. Labelled Compd. Radiopharm. 27 683 (1989) 34. L S Gordeeva, Yu L Kaminskii, L N Rumyantseva, N A Patokina, N A Korsakova, L F Chernysheva, V K Dedova, V L Efimova, A G Neopikhanova Khim.Prir. Soedin. 6 771 (1984) b 35. D K Jaiswal, H Morimoto, E L Trump, P G Williams, D E Wemmer J. Labelled Compd. Radiopharm. 38 743 (1996) 36. F Lin, D Shen Shengwu Huaxue Yu Shengwu Wuli Jinzhan 52 79 (1983); Chem. Abstr. 99 172 150 (1983) 37. Czech. P. 255 180; Chem. Abstr. 111 174 116 (1989) 38. Yu L Kaminskii, L S Gordeeva, G P Akulov, N A Patokina, L L Shcherbakova Radiokhimiya 29 670 (1987) a 39. L A Yakovleva, G P Akulov, A I Nagorskii, N A Patokina, Yu L Kaminskii, R A Zhuk Khim. Geterotsikl. Soedin. 1 95 (1988) c 40. GDR P. 159 547; Chem. Abstr. 99 195 357 (1983) 41. T G Hamil, N J Brenner,W Eng, H D Burns J. Labelled Compd. Radiopharm. 41 319 (1998) 42. P G Baraldi, B Cacciari, S Dionisotti, J Egan, G Spalluto, C Zocchi J. Labelled Compd.Radiopharm. 38 725 (1996) 43. G V Sidorov, N F Myasoedov Bioorg. Khim. 19 1215 (1993) d 44. USSR P. 243 621; ByulL. Izobret. (39) 159 (1976) 45. USSR P. 498 823 SSSR; Byull. Izobret. (39) 159 (1976)Synthesis of tritium-labelled biologically important diazines 46. N F Myasoedov, N S Marchenkov, K S Mikhailov, in Organi- cheskie Soedineniya, Mechennye Radioaktivnymi Izotopami (Sbornik Dokl.) [Isotopically Labelled Organic Compounds (Abstracts of Reports)] (Prague: Czechoslovakian Commission on Atomic Energy, 1977) p. 275 47. USSR P. 404 348; Byull. Izobret. (39) 159 (1976) 48. USSR P. 462 467; Byull. Izobret. (39) 159 (1976) 49. N F Myasoedov J. Labelled Compd. Radiopharm. 33 391 (1993) 50.J R Brewer, J R Jones, K W M Lawrie, D Saunders, A Simmonds J. Chem. Soc., Chem. Commun. 1566 (1990) 51. D Hesk, J R Jones,W J S Lockley J. Labelled Compd. Radiopharm. 28 1427 (1990) 52. J R Brewer, J R Jones, K W M Lawrie J. Labelled Compd. Radiopharm. 34 391 (1994) 53. J R Brewer, J R Jones, K W M Lawrie J. Labelled Compd. Radiopharm. 34 787 (1994) 54. T Cato Shokubai Catalyst 18 92 (1976); Ref. Zh. Khim. 4 B 1275 (1977) 55. R R Muccino, L Serio J. Labelled Compd. Radiopharm. 15 529 (1978) 56. E Buncel, J R Jones, H A Joly, I Onyido, in Proceedings of the Third International Symposium on Synthesis and Applications of Isotopically Labelled Compounds (Eds TABaillie, JRJones) (New York: Elsevier, 1989) p. 219 57. J R Jones J.Labelled Compd. 4 197 (1968) 58. N H Werstiuk, C Ju Can. J. Chem. 67 812 (1989) 59. G E Calf, J L Garnet Adv. Heterocycl. Chem. 15 137 (1973) 60. N N Zatsepina, I F Tupitsyn Khim. Geterotsikl. Soedin. 12 1587 (1974) c 61. J L Wong, J H Keck Jr J. Chem. Soc., Chem. Commun. 125 (1975) 62. M L Eidinoff, J E Knoll J. Am. Chem. Soc. 75 1992 (1953) 63. F J Bullock, O Jardetzky J. Org. Chem. 29 1988 (1964) 64. M P Schweizer, S I Chan, G K Helmkamp, P O P Ts'o J. Am. Chem. Soc. 86 696 (1964) 65. H Fritzche Biochem. Biphys. Acta 149 173 (1967) 66. K R Shelton, J M Clark Biochemistry 6 2735 (1967) 67. N A Fedorov,N N Kotov, E F Tikhonova Vopr. Med. Khim. 16 441 (1970) 68. L A Osterman, V V Adler, R Sh Bibilashvili Vopr. Med. Khim. 13 200 (1967) 69.G V Sidorov, N F Myasoedov Radiokhimiya 16 922 (1974) a 70. R C Gamble, H J P Schoemaker, E Jekowsky, P R Schimmel Biochemistry 15 2791 (1976) 71. M J Graham, E A Lesnik, S M Freier, R M Crooke, D J Ecker, R N Maslova Nucl. Acids Res. 21 3737 (1993) 72. V L Drutsa, N I Sokolova, Z A Shabarova Mol. Biol. 8 921 (1974) e 73. V Lauschke, E Lodemann, A Wacker J. Labelled Compd. 7 441 (1971) 74. L A Osterman, V V Adler, R Sh Bibilashvili, L P Savochkina, Ya M Varshavskii Biokhimiya 31 398 (1966) a 75. F Doppler-Bernardi, G Felsenfeld Biopolymers 8 733 (1969) 76. K R Shelton, J M Clark Biochem. Biophys. Res. Commun. 33 850 (1968) 77. K A Patillon, A M Michelson Biochimie 58 743 (1976) 78. H J P Schoemaker, R C Gamble, G P Budzik, P R Schimmel Biochemistry 15 2800 (1976) 79.V L Drutsa Nucl. Acids Symp. Ser. 9 259 (1981); Chem. Abstr. 96 35 683 (1982) 80. D Hesk, T Duelfert, S Hickey, D Hochman, D Koharski J. Labelled Compd. Radiopharm. 34 681 (1994) 81. G Mackenzie, A E Platt,H A Wilson,G Shaw J. Chem. Soc., Perkin Trans. 2 2055 (1985) 82. R N Maslova, E A Lesnik, Ya M Varshavskii Biochem. Biophys. Res. Commun. 34 260 (1969) 83. R N Maslova, E A Lesnik, F A Safin, Ya M Varshavskii, in 7-oi Mezhdunarodnyi Simpozium po Khimii Prirodnykh Soedinenii (The Seventh International Symposium on the Chemistry of Natural Compounds) (Riga: Zinatne, 1970) p. 736 84. E A Lesnik, R N Maslova, Ya M Varshavskii Mol. Biol. 10 144 (1976) e 85. R N Maslova, E A Lesnik, Ya M Varshavskii FEBS Lett.3 211 (1969) 86. E A Lesnik, R N Maslova, T G Samsonidze, Ya M Varshavskii FEBS Lett. 33 7 (1973) 239 87. J J Englander, N R Kallenbach, S W Englander J. Mol. Biol. 63 153 (1972) 88. J M Benevides, G J Thomas Jr Biopolymers 24 667 (1985) 89. G N Lapiashvili, E A Lesnik, R N Maslova, Ya M Varshavskii Nucl. Acids Res. 4 2181 (1977) 90. M Tomasz, J Olson, C M Mercado Biochemistry 11 1235 (1972) 91. R N Maslova, E A Lesnik, Ya M Varshavskii Mol. Biol. 9 310 (1975) e 92. I M Agranovich, E A Lesnik, R N Maslova Mol. Biol. 20 200 (1986) e 93. R N Maslova, E A Lesnik, Ya M Varshavskii FEBS Lett. 49 181 (1974) 94. R W Chambers J. Am. Chem. Soc. 90 2192 (1968) 95. G De Boer, H E Johns Biochim. Biophys. Acta 204 18 (1970) 96. T Ido,M Tatora, V Kasida Int.J. Appl. Radiat. Isotop. 24 81 (1973) 97. L Cheong,M A Rich,M L Eidinoff J. Biol. Chem. 235 1441 (1960) 98. R M Fink, K Fink J. Biol. Chem. 237 2889 (1962) 99. R M Fink J. Biol. Chem. 238 1764 (1963) 100. R M Fink Arch. Biochem. Biophys. 107 493 (1964) 101. W J Wechter Collect. Czech. Chem. Commun. 35 2003 (1970) 102. J A Rabi, J J Fox J. Am. Chem. Soc. 95 1628 (1973) 103. R Shapiro, R S Klein Biochemistry 6 3576 (1967) 104. S R Heller Biochem. Biophys. Res. Commun. 32 998 (1968) 105. K Kai, Y Wataya, H Hayatsu J. Am. Chem. Soc. 93 2089 (1971) 106. V Sh Scheiker Nucl. Acids Res. 3 809 (1976) 107. Y Wataya, H Hayatsu Biochemistry 11 3583 (1972) 108. Y Wataya, H Hayatsu, Y Kawazoe J. Am. Chem. Soc. 94 8927 (1972) 109. Y Wataya, H Hayatsu, Y Kawazoe J.Biochem. 73 871 (1973) 110. G V Sidorov, O V Lushkina, N F Myasoedov, V N Kramerov, V I Mishin, in Proceedings of the Fourth International Symposium on Synthesis and Applications of Isotopically Labelled Compounds (Eds E Buncel, GWKabalka) (Amsterdam: Elsevier, 1992) p. 456 111. Kh K Avlyanov, O N Veshkrova, A A Takanaev, Sh I Salikhov Khim. Prir. Soedin. 5 684 (1988) b 112. V P Shevchenko, I Yu Nagaev, N F Myasoedov Radiokhimiya 40 70 (1998) a 113. O Buchman, I Pri-Bar,M Shimoni, L Smoskowitz J. Labelled Compd. 10 345 (1974) 114. E A Evans, H C Sheppart, J C Turner, D C Warrell J. Labelled Compd. 10 569 (1974) 115. O Buchman, I Pri-Bar,M Shimoni J. Labelled Compd. Radio- pharm. 14 155 (1978) 116.J Hanus, B Cerny, J Benes J. Labelled Compd. 10 523 (1974) 117. B Cerny, J Hanus, J Benes Radiochem. Radioanal. Lett. 35 211 (1978) 118. B Cerny, J Hanus, J Machej Radiochem. Radioanal. Lett. 37 281 (1979) 119. G F Taylor, K Zamani, J A Kepler J. Labelled Compd. 25 1073 (1988) 120. M Kiessling, K H Heise Isotopenpraxis 13 324 (1977) 121. G P Akulov, N A Patokina Radiokhimiya 31 132 (1989) a 122. Yu L Kaminskii, O I Kozyreva, L A Yakovleva, N B Tarusova,M V Yas'ko Zh. Obshch. Khim. 61 1037 (1991) f 123. G P Akulov, Yu L Kaminskii, N A Patokina Zh. Obshch. Khim. 59 2555 (1989) f 124. Yu L Kaminskii, G P Akulov, V G Kayumov, E A Gutina Zh. Obshch. Khim. 59 2401 (1989) f 125. G P Akulov, Yu L Kaminskii, N A Patokina Radioisotopy 29 119 (1988) 126. E Lacey,M Dawson,M A Long, C Than J.Labelled Compd. Radiopharm. 27 1415 (1989) 127. W Chen, K T Garnes, S H Levinson, D Saunders, S G Senderoff, A Y L Shu, A J Villani, J R Heys J. Labelled Compd. Radiopharm. 39 291 (1997) 128. J Devillers, M Winnand, B Bettens J. Labelled Compd. Radio- pharm. 12 219 (1976) 129. R M Coates, S Hegle, C J Pearce, in Proceedings of the Interna- tional Symposium on Synthesis and Applications of Isotopically Labelled Compounds (EdsWP Duncan, A B Susan) (New York: Elsevier, 1983) p. 429 130. K V Viswanathan, A U Garana, R Lakshmy, B R Sarkar Proc. Chem. Symp. Aligarh 1 85 (1972); Chem. Abstr. 81 120919 (1974)G V Sidorov, N F Myasoedov 240 175. S K Aggarwal, D R Shalinsky, K C Aggarwal J.Labelled Compd. Radiopharm. 25 1055 (1988) 176. F Cacae, G Stocklin Curr. Top. Radiat. Res. Q. 12 103 (1978) 177. G V Sidorov, Yu B Zverkov, N F Myasoedov Radiokhimiya (1999) (in the press) a 178. N F Myasoedov, G V Sidorov, V N Kramerov, V I Mishin J. Labelled Compd. Radiopharm. (1999) (in the press) 131. J S Park, C F Bigge,M E Hassan, L Maggiora,M P Merter J. Chem. Soc., Chem. Commun. 8 553 (1984) 132. E K Ivan'kova, G V Sidorov, N F Myasoedov Radiokhimiya 23 296 (1981) a 133. G V Sidorov, N F Myasoedov J. Radioanal. Nucl. Chem. 121 461 (1988) 134. U Pleiss, in Proceedings of the Third International Symposium on Synthesis and Application of Isotopically Labelled Compounds (Eds T A Bailie, J R Jones) (New York: Elsevier, 1989) p.521 135. E Mittag, S Noll Isotopenpraxis 26 138 (1990) 136. U Pleiss, J Roemer J. Labelled Compd. Radiopharm. 20 1355 (1983) 137. L A Yakovleva, Yu L Kaminskii, O I Kozyreva, L P Sosnova Radioisotopy 29 110 (1988) 138. U Pleiss Radiochem. Radioanal. Lett. 51 363 (1982) 139. H-C Chang, S-K Chiang, Y-F Yeh Nucl. Tech. (1) 59 (1981); Chem. a�Radiochemistry (Engl. Transl.) b�Chem. Nat. Compd. (Engl. Transl.) c�Chem. Heterocycl. Compd. (Engl. Transl.) d�Russ. J. Bioorg. Chem. (Engl. Transl.) e�Russ. J. Mol. Biol. (Engl. Transl) f� Russ. J. Gen. Chem. (Engl. Transl.) Abstr. 95 151 091 (1981) 140. G V Sidorov, N F Myasoedov Bioorg. Khim. 22 291 (1996) d 141. D C Baker, T H Haskell J. Med. Chem. 18 1041 (1975) 142. G Guillerm, M C Galas, F Le Goffic J. Labelled Compd. Radiopharm. 23 845 (1986) 143. G P Akulov, Yu L Kaminskii, A D Shestakov, V G Kayumov, L F Chernyshova, N A Patokina Bioorg. Khim. 14 37 (1988) d 144. J A Hill, G A Freeman J. Labelled Compd. Radiopharm. 25 277 (1988) 145. M Berger, A Shaw, J Cadet, J R Jones Nucleosides Nucleotides 6 395 (1987) 146. US P. 485 112; Chem. Abstr. 126 104 369 (1996) 147. T N Kekelidze, D E Edmondson, D B McCormick J. Labelled Compd. Radiopharm. 36 953 (1995) 148. P Pumpen, E Gren J. Labelled Compd. 8 193 (1972) 149. P P Puurin', E Ya Gren Biokhimiya 39 504 (1974) a 150. Yu A Zolotarev, V S Kozic, E M Dorokhova, N F Myasoedov J. Labelled Compd. Radiopharm. 29 997 (1991) 151. Yu A Zolotarev, V S Kozic, E M Dorokhova, D A Zaitsev, N F Myasoedov, S G Rosenberg J. Radioanal. Nucl. Chem. Articles 162 3 (1992) 152. T Meshi, T Takahashi Bull. Chem. Soc. Jpn. 35 1510 (1962) 153. A V Filikov, N F Myasoedov J. Radioanal. Nucl. Chem. Lett. 85 373 (1984) 154. A V Filikov, N F Myasoedov J. Catal. 130 355 (1991) 155. A V Filikov, N F Myasoedov J. Phys. Chem. 90 4915 (1986) 156. A V Filikov, N F Myasoedov J. Catal. 130 569 (1991) 157. G V Sidorov, N F Myasoedov J. Labelled Compd. Radiopharm. 34 353 (1994) 158. N F Myasoedov, G V Sidorov, O V Lushkina, in Proceedings of the Fourth International Symposium on Synthesis and Applications of Isotopically Labelled Compounds (Amsterdam: Elsevier, 1992) 159. Yu L Kaminskii, G P Akulov, N A Patokina, S G Rosenberg 160. G V Sidorov, N F Myasoedov,M V Yasko J. Labelled Compd. p. 460 J. Labelled Compd. Radiopharm. 31 759 (1992) Radiopharm. 34 339 (1994) 161. O V Lushkina, G V Sidorov, N F Myasoedov Bioorg. Khim. 19 113 (1993) d 162. G V Sidorov, N F Myasoedov Radiokhimiya 37 270 (1995) a 163. Yu L Kaminskii, L A Yakovleva, O I Kozyreva, V A Babain, N B Tarusova,M V Yas'ko, S G Rozenberg Bioorg. Khim. 17 1510 (1991) d 164. M V Yas'ko, G V Sidorov, R V Kondratov, V S Prasolov, N F Myasoedov, A A Kraevskii Bioorg. Khim. 24 21 (1998) d 165. J J Kopecky, B Pavlu Radioisotopy 12 967 (1971) 166. J J Kopecky, B Pavlu Collect. Czech. Chem. Commun. 37 2039 (1972) 167. C Bratu J. Labelled Compd. 7 161 (1971) 168. C Parkanyi, F Sorm Collect. Czech. Chem. Commun. 28 2491 (1963) 169. J Filip, F Vysata J. Labelled Compd. 5 295 (1969) 170. J Moravek, J Filip Collect. Czech. Chem. Commun. 25 2697 (1960) 171. USSR P. 899 552; Byull. Izobret. (3) 48 (1982) 172. R Luo, J Wang, Z Lin, Z Fang, G Huang Fenxi Ceshi Tongbao 8 40 (1989); Chem. Abstr. 112 198 954 (1990) 173. M Laloue, J E Fox Phytochemistry 4 987 (1987) 174. H O Kim, C Hawes, P Towers, K A Jacobson J. Labelled Compd. Radiopharm. 38 547 (1996)

ISSN:0036-021X    

出版商:RSC    

年代:1999

数据来源: RSC

摘要:

Russian Chemical Reviews 68 (3) 241 ¡À 251 (1999) Dialdehyde-containing nucleic acids and their components: synthesis, properties and affinity modification of proteins OMGritsenko, E S Gromova Contents I. Introduction II. Introduction of aldehyde groups into the sugar residue of nucleic acids III. Affinity modification of proteins and polypeptides with periodate-oxidised derivatives of nucleic acids IV. Conclusion Abstract. Synthesis, structure and chemical properties of nucleo- side dialdehyde derivatives are described. The introduction of aldehyde groups into oligonucleotides is discussed. The methods of affinity modification of proteins with periodate-oxidised nucleic acid derivatives are considered. The bibliography includes 48 references. I.Introduction The study of the nature of specific interactions of proteins with nucleic acids (NA) is an important problem of modern molecular biology. Relatively few methods allowing the identification of functional groups of proteins involved in protein ¡ÀNA recogni- tion are known. Covalent binding of proteins to NA is an efficient approach.1 It consists in specific covalent attachment of a protein to NA by modification of one of the components of the proteinD NA complex or by addition of a cross-linking reagent. The covalently bound protein is subjected to hydrolysis with proteases and then the amino acid composition of the peptide attached to NA, which is the region of the active site or a recognition domain of the protein, is determined. The method of covalent `cross- linking' also makes it possible to study the topography of the protein ¡ÀNA complexes and to establish their stoichiometry. Elaboration of optimal conditions for protein ¡ÀNA recogni- tion is an essential feature required for this method.In this case, the modification must not induce significant distortions in the structure of the components of the complex and not interfere with the recognition of NA analogues by specific proteins. Affinity modification of non-modified proteins with NA upon UV irradi- ation is a way to perform covalent addition of proteins to NA.1 Another approach consists in the introduction of chemically or photo-activated groups into a protein or NA followed by their activation. Reactive groups are introduced into heterocyclic bases of NA, into phosphate groups or into sugar residues.The first two types of NA activation and the formation of covalently bound products based on these derivatives have been described in several reviews.1 ¡À3 In the present work, we shall consider NA derivatives OMGritsenko, E S GromovaMV Lomonosov Moscow State University, Department of Chemistry, Leninskie Gory, 119899 Moscow, Russian Federation. Fax (7-095) 939 31 81. Tel. (7-095) 939 31 44. E-mail:gromova@dnaenzym.genebee.msu.su (E S Gromova) Received 26 October 1998 Uspekhi Khimii 68 (3) 267 ¡À 278 (1999); translated by R L Birnova #1999 Russian Academy of Sciences and Turpion Ltd UDC 577.113.4 241 241 246 250 containing two aldehyde groups in the sugar residue with regard to their synthesis, properties and affinity modification of proteins.Earlier, dialdehyde derivatives of NA were extensively used for establishing the structure of monomeric components of nucleic acids and for the analysis and separation of oligonucleotide mixtures.4 The nucleotide sequences adjacent to the 30-end of RNA were determined using oxidation of the 30-terminal nucleo- tide unit of RNA with subsequent cleavage of the adjacent phosphodiester bond and identification of a heterocyclic base.4 At present, dialdehyde derivatives of NA are most often used for introduction of various functional groups into NA and affinity modification of proteins. II. Introduction of aldehyde groups into the sugar residue of nucleic acids The methods used for the introduction of two aldehyde groups into nucleosides and mononucleotides as well as into 30- and 50-terminal residues of oligonucleotides are well known.A proce- dure for introduction of aldehyde groups into any position of the oligonucleotide chain has been developed recently. 1. Synthesis and structure of dialdehyde derivatives of nucleosides and nucleotides The synthesis of dialdehyde derivatives of nucleosides is based on periodate oxidation of ribonucleosides and their derivatives:4 50 HO B O HO B IO¡¦4 O 10 40 HC CH 20 30 HO OH O O Hereinafter B is a heterocyclic base. The reaction of adenosine 50-triphosphate (1) with sodium periodate is of the second order (the rate constant k2 is equal to 1.066103 litre min71 mol71).5 The oxidation was carried out with an equimolar amount or a small excess of sodium periodate for 1 h at 4 8C.5 In another study,6 mono- and dinucleotides were oxidised with a 20-fold excess of sodium periodate for 1 h at 0 8C.The excess of sodium periodate was removed with ethylene glycol,6 a small excess of rhamnose 6 or a 4-fold molar excess of NaAsO2.7 The resulting solutions of oxidised nucleoside deriva- tives were used as such; the products could be purified by gel chromatography. The aldehyde groups in various periodate-oxidised ribonu- cleotides are hydrated;8¡À 10 thus the oxidation product of adeno-242 sine 50-triphosphate (oATP) exists as an equilibrium mixture of dialdehyde hydrates (structures 3 and 4, Scheme 1).5, 9 Scheme 1 Ade Ade pppOH2C pppOH2C O O H2O NaIO4 HC CH O O 2 HO OH 1 50 10 40 Ade Ade O O pppOH2C pppOH2C 20 30 H2O OH HO OH HO OH HO 4 O3 The 1H and 13C NMR spectra of oATP do not contain resonance signals typical of free aldehyde groups; the polymeric form of oATP was not detected in solution.The cyclic hemiacetal 3 may exist as a mixture of four diastereomers 3a ± d. OH H CH2Oppp O CH2Oppp O HO H OH H H H Ade Ade O O H H H OH3b 3a H OH CH2Oppp O CH2Oppp O HO H OH H H H Ade Ade O O H H H OH3c 3d These conformers are preferred, since the adenine moieties and CH2Oppp groups are equatorial.9 The coupling constants correspond to the structures 3b ± d (Table 1).Because of steric constrains due to the axial position of two hydroxy groups, the structure 3a is probably not realised. The structures 3c and 3d are more preferable, since the hemiacetal hydroxy groups in 1,4- dioxanes and sugars tend to occupy the axial position (the so- called anomeric effect).11 The 1H and 13C NMR spectra also contained signals corresponding to the dialdehyde dihydrate 4. Thus, oATP exists in solution as a mixture of four compounds, viz., three diastereomers of the cyclic hemiacetal 3b ± d and the dihydrate 4, which are in equilibrium with one another, and a small amount of the free dialdehyde 2. In aqueous solution at pH 7.0, the UV spectrum of oATP is similar to that of ATP.5 The circular dichroism (CD) spectra of dialdehyde derivatives of adenosine, uridine and cytidine revealed strongly reduced Table 1.Conformational analysis of hydrated forms of oATP (predicted and experimental values of coupling constants).9 Com- pound Experimental coupl- ing constants (J/ Hz) Position of Predicted coupling the OH-groups a constants (J/ Hz) J30,40 J10,20 J30,40 20-OH 30-OH J10,20 not detected 7.5 8.0 1.8 4.1 <4 >6 <4 >6 3 ± 6 a a <4 e e >6 e a >6 a e <4 7 7 3 ± 6 8.0 1.7 8.1 5.0 3a 3b 3c 3d 4a a�Axial, e�equatorial. O MGritsenko, E S Gromova Cotton effects in comparison with those observed for the corre- sponding nucleosides.12 This points to enhanced free rotation of the heterocyclic base around the glycosidic bond.On the contrary, in the case of the dialdehyde derivative of guanosine the amplitude of the CD maximum increased, which was ascribed 12 to the self- assembly resulting in the formation of oligomers. In the solid state, the dialdehyde derivatives of adenosine, guanosine, cytidine and uridine are totally polymerised.12 B B O O ROH2C ROH2C O O O O O 2. Some chemical properties of periodate-oxidised nucleoside derivatives The chemical properties of periodate-oxidised nucleoside deriva- tives (e.g., interaction with hydrazines and amines, degradation in alkaline media and reduction of aldehyde groups) are well known.4, 13 Here, onsider only some model reactions which present interest from the standpoint of affinity modification of proteins.Dialdehyde derivatives of nucleosides and nucleotides readily react with hydrazides, the structure of the reaction products being dependent on the nature of the starting reagents and reaction conditions. The reaction of a nucleoside dialdehyde derivative with isonicotinohydrazide results in the addition of one hydrazide molecule to the nucleoside to give a morpholine derivative.4 B O HO OH HO N N NH CO An analogous product was obtained in the reaction of the above nucleoside derivatives with thiosemicarbazide.4 Dialdehyde derivatives of nucleosides and nucleotides 5 react with phenylhydrazine 13, 14 to give bisphenylhydrazones. Addition of an excess of phenylhydrazine results in the degradation of dialdehyde derivatives of ribonucleosides or ribonucleotides (Scheme 2).14 Scheme 2 O O B B XOH2C XOH2C PhHN NH2 HC CH HC CH NaOAc N N O O 5 PhHN NHPh 6 PhHN NH2 AcOH CH N NHPh PhHN NH2 AcOH CH N NHPh C N NHPh + B+ CH N NHPh CH2OH X is the phosphate or H.In the same way derivatives 5 react with semicarbazide.4 The products of periodate oxidation of ribonucleosides and ribonucleotides react readily with amines. The reaction of oxi- dised adenosine 50-phosphate with methylamine yields a morpho- line derivative of adenosine 50-phosphate.4 Ade O H2O3PO OH HO NMeDialdehyde-containing nucleic acids and their components: synthesis, properties and affinity modification of proteins Ade O H2O3PO CH CH +RNH2 O O Ade O H2O3PO CH CHO7 O NH2R + Ade O H2O3POHO OH N 7 R Ade O 7 7H2O H2O3PO + O7 NR O H2C NaIO4, H2O 7OH +NR 8 O H3C H2O +N H R Ade O H O CH3CCH I OO O7 H O O + C CH RN CH3 R=Alk.without reduction Ade O HOH2C N NCH2CO2H CH2CO2H Ade O HOH2C NH HN OH HO CH2CO2H CH2CO2H Ade O HOH2C OH N HO CH2CO2H H2O3PO CH CH OO H2C +NR HAde7 O O I O O O HAde OH HO7 H +NRCHO+AdeCHO+IO¡ HOH2C HOH2C Scheme 3 Ade O +H2O NR Ade+H2PO¡4 O7 8 IO¡4 3 H2O Ade+HCOOH Ade HOH2C O HC CH O O Ade O OH NCH2CO2H Ade ONCH2CO2H 243 Combined treatment of ribonucleotide dialdehyde derivative with primary amines and an excess of sodium periodate results in its degradation with elimination of the free base (Scheme 3).15 The products of the reaction of periodate-oxidised adenosine with glycine in the presence and absence of sodium cyanoborohy- dride (NaBH3CN) were identified by spectral methods.16 Putative condensation products are shown in Scheme 4.It was found that 2-adeninyl-4-carboxymethyl-6-hydroxymethylmorpholine (9) is the main reaction product. The hydrolytic stability of the condensation products of oxidised adenosine or oATP with diaminohexane following reduction with NaBH3CN has been studied.16 It was found that stable reaction products are formed only after reduction with NaBH3CN. An 125I-containing reagent, viz., 3-(3-iodo-4-hydroxyphenyl)- propionylcarbohydrazide, has been devised for identification and quantitative determination of periodate-oxidised ribonucleosides and RNA.7 Reaction of ribonucleoside-derived dialdehydes with this reagent gives the morpholine derivative 10, which is stable in neutral and weakly acidic media, but is subjected to rapid degradation in alkaline media and in the presence of ammonia or primary amines.125I B O HOH2C O O OH CH CH+NH2NHC(NH)2CCH2CH2 O O 5 125 OH HOH2C I O O OH O N NHC(NH)2CCH2CH2 10 B OH 4 Dialdehydes from nucleoside 50-phosphates and their deriva- tives are readily cleaved in alkaline media (pH>7) with simulta- neous scission of the glycosidic bond and b-elimination of the RPO27 residue (Scheme 5).4, 13 Primary amines also efficiently catalyse this reaction. The aldehyde groups of nucleoside and nucleotide dialdehyde derivatives can be completely or partially reduced depending on Scheme 4 +NH2CH2CO2H partial reduction complete reduction Ade O Ade O HOH2C HOH2C N NH HN HO CH2CO2H CH2CO2H CH2CO2H Ade O O HOH2C Ade HOH2C N N CH2CO2H CH2CO2H 9244 O B RO P OH2C O OH HO OH O RO P O7 + O7 R=H or an oligoribonucleotide.pH.14 This results in the formation of the corresponding triols or dihydroxy aldehydes.B O HOH2C CH CH O O 5 Periodate oxidation of pseudouridine gives the corresponding dialdehyde and two unidentified products.4 Treatment of the dialdehyde with sodium borohydride and alkali results in 5-(a,b- dihydroxyethyl)uracil (Scheme 6).O NH HN IO¡4O HOH2C O HO OH O HO7 HN NHO HOH2C O H2C CH2 OH HO 3. Introduction of the dialdehyde fragment into oligonucleotides a. Introduction of the aldehyde groups into terminal nucleotide residues The introduction of the dialdehyde fragment into 30-terminus of RNA or oligoribonucleotides is effected by periodate oxidation. To introduce such a fragment into 30-terminus of oligodeoxyribo- nucleotides or 50-terminus of oligoribo- or oligodeoxyribo-nucleo- tides, one should first elongate them by attaching a ribonucleotide residue and then subject it to periodate oxidation. The conditions for oxidation of RNA do not practically differ from those for ribonucleosides and their derivatives.17 Thus the introduction of a dialdehyde fragment into the 30-terminus of an oligodeoxyribonucleotide was preceded by attachment of a ribonucleotide.18 To this end, the oligodeoxy- ribonucleotide was incubated with ribonucleoside 50-triphosphate in the presence of terminal deoxyribonucleotidyl transferase.In another study,19 cytidine 30,50-diphosphate (pCp) was attached to Scheme 5 O RO B P OH2C O OH7 NaIO4 OH HC CH O O O OH H2C +BH CH HC O O B O HOH2C NaBH4 CH2 CH2 OH7 OH OHB O HOH2C NaBH4 CH2 CH H+ OH O Scheme 6 O NH HN NaBH4 O HOH2C O CH HCO O O O NH NH N HN H2O O O CHOH CH CH2OH CH2OH O MGritsenko, E S Gromova an oligodeoxyribonucleotide using T4 RNA-ligase. Then the 30-terminal phosphate group of the resulting 50-(oligo- deoxyribonucleotide)-pCp30 was eliminated with alkaline phos- phatase after which the 20,30-cis-diol group was oxidised with periodate.The reaction was carried out with oligodeoxyribonuc- leotides having cytidine 18 ± 20 or uridine18 residues at the 30-end. Ura Ura XOH2C XOH2C O O NaIO4 HC CH HO OH O O X is 50-(oligodeoxyribonucleotide)-30. An equimolar amount or a small excess of sodium periodate was used for the oxidation. The reaction was completed within 30 min at room temperature 18 or within 2 h at 0 ± 4 8C.19 The excess of sodium periodate was destroyed with ethylene glycol.18 The dialdehyde fragment was also introduced into the 50-end of an oligodeoxyribonucleotide.21 The uridine residue was attached to the oligodeoxyribonucleotide by automated solid- phase, phosphoramidite synthesis using a derivative with pro- tected 20-OH and 30-OH groups.O HN N P Pri2N O O OH2C OMe Px is 9-phenylxanthen-9-yl (pixyl). PxO OPx In this case, the 50-end of the ribonucleoside was attached to the 50-end of the oligodeoxyribonucleotide. After deprotection, the ribose residue was oxidised with periodate to give a dialdehyde derivative. Oligodeoxy- and oligoribo-nucleotides containing oxidised ribose residues have found practical applications. Modified oli- godeoxyribonucleotides with a 30-terminal dialdehyde fragment were used for the introduction of the phosphate group into the 30- end of the oligodeoxyribonucleotide. To this aim, the oligodeox- yribonucleotide with an oxidised 30-terminal ribonucleoside resi- due was treated with a primary amine to give oligonucleotide 30- phosphate, a dialdehyde derivative of ribose and a heterocyclic base.18, 20 Radioactive labelling of the 30-terminal nucleoside residue of RNA was based on the reaction of the aldehyde groups with [35S]-thiosemicarbazide, [14C]-semicarbazide, [3H]-isonicoti- nohydrazide or [3H]-sodium borohydride.4 B ...OH2C B ...OH2C O O NaIO4 HC CH HO OH O O NH214CONHNH2 NH2C35SNHNH2 NaB3H4 B B O B O ...OH2C ...OH2C ...OH2C O 3 OH HO N OH HO N HHC CH3H HO OH NH14CONH2 NHC35SNH2 Dialdehyde derivatives of oligodeoxyribo- or oligoribo- nucleotides can be used for the introduction of a non-radioactive label by treating oligonucleotides with a compound containing an amino group and a non-radioactive label (e.g., with biotin hydrazide, LNH2) (Scheme 7 a) 21 or by preliminary introductionDialdehyde-containing nucleic acids and their components: synthesis, properties and affinity modification of proteins of a primary amino group into the oligonucleotide with subse- quent addition of a non-radioactive label (Scheme 7 b).22Scheme 7 50 30 HO(oligonucleotide) Ura OH2C O IO¡4 (a) HO OH Ura OH2C Ura O OH2C O LNH2 NaBH4 CH HC N O O L O HN NH L= (CH2)4CNH7 S O O Ura P O OH2C 50GTAAAACGACGGCCAGT O NaIO4 O7 HO OH (b) Ura Ura O OH2C OH2C O H2N(CH2)6NH2 NaBH4 N CH HC (CH2)6NH2 O O Ribonucleic acids (and oligoribonucleotides) can be cleaved at the internucleotide bond from the 30-end of the polyribonucleotide chain by combined treatment with periodate and primary amines or by treatment with sodium periodate in an alkaline medium (see Scheme 5).4, 13 Such a treatment yields an oligo- or a poly- nucleotide `shortened' by one nucleotide unit from the 30-end.The whole cycle of conversions can be repeated. A base identified by conventional analytical methods is split off from the product of conversion of the original terminal nucleotide unit by treatment with an acid (pH<3) or an alkali (pH>11). This property of dialdehyde derivatives of RNA is the basis for a method for determination of nucleotide sequences in short oligoribonucleo- tides. Stepwise degradation from the 30-end was used for the analysis of terminal sequences in various tRNA and tobacco mozaic virus RNA.4 The effects of several basic amino acids and primary amines, pH and temperature on the rate of hydrolysis of the phosphodi- ester bond in the dialdehyde derivatives of some oligoribonucleo- tides have been studied.4 It was found that the cleavage of the required phosphodiester bond in the presence of lysine, cyclo- hexylamine or methylamine occurs most efficiently at elevated temperature (45 8C), while that in the presence of aniline is the most efficient at 24 8C (at pH 6 ± 9).4 No side reactions were observed at room temperature.A rise in temperature may favour side reactions, such as cleavage of cUunits and heterocyclic nuclei of other nucleosides.4 b.Introduction of the aldehyde groups into any position of the oligonucleotide strand It is not until very recently that the methods for the introduction of aldehyde groups into any position of the oligodeoxyribonucleo- tide have been developed. Two types of oligonucleotides were used: (1) oligonucleotides containing a hexopyranosyl residue in the oligonucleotide strand 23 ± 25 instead of a deoxyribose residue and (2) oligonucleotides with an additional ribose residue in the 20- position of ribose.26 The simplest approach is based on the introduction of galactose residues into the oligonucleotide 245 strand.23 Prior to the oligonucleotide synthesis, the hydroxy groups designed for subsequent oxidation are protected with appropriate protective groups.It was suggested 24 to introduce both the cis-glycol group as a D-galactose residue and the trans- glycol group (as a D-glucose residue) into the oligonucleotide. Preparative syntheses of 1-(3,4-O-isopropylidene-b-D- galactopyranosyl)thymine 23 and 1-(2,3-di-O-acyl-b-D-glucopyr- anosyl)thymine 24 from D-galactose and D-glucose, respectively, have been carried out. Then, 14 ± 21-membered oligodeoxyribo- nucleotides containing a 1-(b-D-glucopyranosyl)thymine (11) 23, 25 or a 1-(b-D-galactopyranosyl)thymine (12) 24 residue at a definite position of the oligonucleotide strand were obtained using stand- ard phosphoramidite procedures.7OH2C 7OH2C HO O Thy O Thy OH OH 7O 12 OH 11 O7 The 1-(b-D-galactopyranosyl)thymine residue was introduced into the oligonucleotide strand through the 20- and 60-OH groups, while the 1-(b-D-glucopyranosyl)thymine residue, through the 40- and 60-OH groups. The model dinucleoside phosphates, viz., 1-(b- D-glucopyranosyl)thymine-40-O-phosphoryl-(40-50)-20-deoxyade- nosine (13) 24 and 1-(b-D-galactopyranosyl)thymine-20-O-phos- phoryl-(20-50)-20-deoxyadenosine (14) 23 were synthesised for detailed studies of periodate oxidation. HOH2C HOH2C HO Thy O Thy O OH OH O O OH Ade P O O P Ade OH2C OH2C O O OH OH OH 13 14 OH The oxidation of the trans-diol group in compound 13 with a 10-fold excess of sodium periodate at 20 8C proceeded very slowly; the half-reaction time was 9 ± 10 h.24 The oxidation of compound 14 containing a cis-diol group was completed within 1.5 h under these conditions.23 This circumstance determined the use of oligonucleotides containing a galactopyranose residue for the synthesis of reagents carrying dialdehyde fragments and designed for affinity modification of proteins. The oxidation of 14-membered galactose-containing oligonu- cleotides was carried out in 20 ± 200 mM NaIO4 (1.5 ± 2.5 h, 25 ± 37 8C).25 The yields of the oxidation products (65% ± 75%) were determined by cleavage of the phosphodiester bond from the 50-end at the oxidised galactose residue, which was carried out in 10% piperidine (25 min, 95 8C).Under these conditions, oligo- nucleotides containing a non-oxidised galactose residue remained intact. The structure of oligonucleotides containing an oxidised galactose residue was confirmed by selective cleavage of the phosphodiester bond of the oxidised galactose residue (Fig.1). This was carried out under conditions of b-elimination analogous to those used for chemical sequencing of RNA.27 The reaction was conducted in 1 M aniline ± acetate buffer (pH 4.5) for 15 min at 95 8C.25 In contrast with the oligonucleotides 15 ± 17 containing a galactose residue, the 14-membered oligonucleotides containing an oxidised galactose residue (15* ± 17*) in different positions of the oligonucleotide chain were cleaved. Their cleavage gave a 32P- labelled tetranucleotide (from 15*), a heptanucleotide (from 16*) and an undecanucleotide (from 17*) containing a 30-phosphate group (see Fig.1). In control experiments, insignificant degrada- tion of periodate-oxidised oligonucleotides during gel electro- phoresis took place.25246 Another approach to regiospecific introduction of additional cis-diol groups into oligonucleotides is based on the use of nucleoside disaccharide derivatives 18.26, 28, 29 Cyt HOH2C O HO O HOH2C O OH HO18 In these compounds, the cis-diol groups are converted into aldehyde groups upon oxidation. Disaccharide nucleosides have been identified in tRNAs as minor components; some antibiotics also involve disaccharide fragments. Synthesis of 20-O-ribofura- nosylnucleosides 18 was carried out in three steps by condensation of 30,50-O-blocked N-acylribonucleoside (19) and a small excess of 1-O-acetyl-2,3,5-tri-O-benzoyl-b-D-ribofuranose (20) in the pres- ence of tin tetrachloride 28, 29 followed by a two-step deprotection. The glycosylation reaction was stereospecific and resulted in the formation of a b-D-glycosidic bond (Scheme 8).Scheme 8 OAc BzO O B0 O O a Pri2Si + O BzO OBz O OH Si Pri2 20 19 O B0 O HO B0 Pri2Si O O O O Si Pri2 HO O c b BzO BzO O O OBz BzO OBz BzO B HO O HO O HO O HO OH B0 =AdeBz, CytBz, Ura, Thy, GuaBui ; B=Ade, Cyt, Ura, Thy, Gua; (a) SnCl4, C2H4Cl2; (b) Bu4NF, THF; (c) NH3 , MeOH. The periodate oxidation has been studied using a model dinucleoside phosphate 21 containing the disaccharide residue.29 HOH2C Ura O B HOH2C O O O CH2OH NCCH2CH2O O P OH O O P Pri2N OH HO O O BzO O CH2 Ade O OBz 21 BzO22 OH O MGritsenko, E S Gromova b a 1 2 3 4 5 6 1 2 3 Figure 1.Gel-electrophoretic analysis of stability of the oligonucleotides 50GCCAXCCTGGCTCT30 (15, 15*), 50GCCAACCXGGCTCT30 (16, 16*) and 50GCCAACCTGGCXCT30 (17, 17*) containing a nonoxidised (15 ± 17) or oxidised (15* ± 17*) 1-(b-D-galactopyranosyl)thymine residue (X). (a) Incubation of the oligonucleotides containing a galactose residue: (1, 3, 5) � in aniline ± acetate buffer, pH 4.5, 95 8C, 15 min; (2, 4, 6) � in 40 mM Tris-HCl buffer, pH 7.9, 5 mM dithiothreitol, 50 mM NaCl, 15 mMMgCl2, 95 8C, 25 min; (1, 2) oligonucleotide 15; (3, 4) oligonucleo- tide 16; (5, 6) oligonucleotide 17.(b) Incubation of the oligonucleotides containing an oxidised galactose residue in aniline ± acetate buffer, pH 4.5, 95 8C, 15 min; (1) oligonuc- leotide 15*; (2) oligonucleotide 16*; (3)gonucleotide 17*. The model dinucleoside phosphate was oxidised with sodium periodate within 10 min at 20 8C. 14 ± 22-Membered oligonucleo- tides containing 20-O-ribofuranosylcytidine residues were synthes- ised using the phosphoramidite method with modified phosphoroamidite (compound 22).26 DNA duplexes used for affinity modification of some DNA- binding proteins have been formed on the basis of oligonucleo- tides containing dialdehyde fragments at definite positions of the nucleotide strand. III.Affinity modification of proteins and polypeptides with periodate-oxidised derivatives of nucleic acids Periodate-oxidised derivatives of nucleotides containing dialde- hyde fragments were used for affinity modification of enzymes that use nucleoside triphosphates as cofactors or substrates and transcription factors. In addition, conjugates of 13- and 15- membered oligodeoxyribonucleotides containing 30-terminal aldehyde groups with poly(L-Lys) have been synthesised to study the regulation of gene expression.19 14- and 22-Membered DNA- duplexes with internal dialdehyde fragments were used for cova- lent cross-linking with restriction endonucleases and methylases (EcoRII and MvaI 25) and RNA polymerase of bacteriophage T7.30 1.Covalent binding of proteins with nucleotide dialdehyde derivatives The fundamental process that satisfies the bioenergetic require- ments of living organisms is versatile for practically all the objects of the living nature. It consists in the hydrolysis of one of pyrophosphate bonds in adenosine 50-triphosphate (ATP) or, less often, guanosine 50-triphosphate (GTP). Numerous biochem- ical processes occur by virtue of energy released upon hydrolysis of nucleoside triphosphates. 20,30-Dialdehyde derivatives of ATP, ADP, GTP and GDP (oATP, oADP, oGTP and oGDP, respectively) were used for affinity modification of some enzymes, mainly for the study of their cofactor-binding or active sites.The ATP dialdehyde derivative was cross-linked to mitochon- drial ATPase and histone kinase in order to study the active sites of these enzymes.31, 32 Pyruvate carboxylase, acetyl-CoA carbox-Dialdehyde-containing nucleic acids and their components: synthesis, properties and affinity modification of proteins ylase and NAD-dependent isocitrate dehydrogenase require ATP for their cofactor function (the catalytic reaction utilises the energy of ATP hydrolysis). These enzymes have several substrates and cofactors. oATP and oADP were used for covalent binding of these enzymes with the allosteric site as well as for the analysis of interaction of this allosteric site with other sites.8, 33, 34 The phosphate group of ATP is added to the 5-ribulose phosphate fragment by phosphoribulokinase to give ribulose-1,5-diphos- phate.oATP was used for affinity modification of the binding site in one of phosphoribulokinase substrates.35 Binding of aminoacyl-tRNA with ribosomes requires the elongation factor EF-Tu. This reaction is accompanied by hydrol- ysis of GTP. GTP 20,30-dialdehyde derivative was covalently linked to the elongation factor EF-Tu in order to identify the binding site for the cofactor.36 Functioning of a human protein c-H-ras p21 also is accompanied by GTP hydrolysis. This protein, which is localised in the cytoplasmic membrane, accepts external signals stimulating cell growth and transmits them to target proteins localised inside the cell, thus promoting its growth and division. In order to investigate the interaction of GTP and GDP with this protein in more detail the latter was subjected to affinity modification with periodate-oxidised GTP and GDP deriva- tives.37 A periodate-oxidised derivative of 1,N6-ethenoadeno- sine-50-monophosphate (oeAMP) was used for covalent addition to alkaline phosphatase from human placenta.38 Depending on the object of investigation, proteins and period- ate-oxidised components of NA are used for cross-linking in various ratios (Table 2).The time of incubation of proteins with the monomeric analogues of NA containing aldehyde groups varied, on the average, from 5 min to 2 h. In kinetic studies of the oADP interaction with isocitrate dehydrogenase, the incuba- tion time varied from 1 to 8 h.34 The kinetic curve of inactivation of the tetrameric enzyme was biphasic: the fast phase is coupled with covalent binding of oADP with one enzyme subunit, and subsequent slow phase consists in covalent binding of oADP with the remaining three subunits of the enzyme and results in its complete inactivation.Traditionally, NA components that contain a radioactive label (14C, 3Hor 32P) were used for covalent binding with proteins. The degree of affinity modification was estimated from the radio- activity after electrophoresis in 8%± 10% polyacrylamide gel Table 2. Conditions for the preparation of covalent complexes of proteins with periodate-oxidised derivatives of mononucleotides and for specific cleavage of cross-linked proteins.Reducing agent Amount of the reducing agent Modified analogue of NA (concentration) Protein or poly- peptide (concentration) 7 7 (9.4 or 2.5 mmol) Mitochondrial adenosine Mg-oATP triphosphatase (100 mg ml71) NAD-dependent iso- citrate dehydrogenase (0.4 ± 0.5 mg ml71) oADP in the presence7 7 of MnSO4 (0.2 mmol litre71) NaBH4 Mg-oATP (2 mmol litre71) Pyruvate carboxylase (10 ± 20 un ml71 or 13.3 un mg71) 10-fold excess with respect to oATP Histone kinase NaBH4 20-fold excess of oATP relative to the enzyme 20-fold excess with respect to oATP 20 mmol litre71 NaBH3CN ATPa (10 mmol litre71) Elongation factor from T.thermophilus (20 mmol litre71) a The oxidation with sodium periodate was carried out after incubation of the elongation factor EF-Tu and ATP (incubation time 10 min, oxidation time 1 min).containing 0.1% SDS,31 gel filtration 19, 32 or washing of filters containing reaction mixtures.36 The degree of affinity modifica- tion of pyruvate carboxylase with various concentrations of oATP was determined from the residual activity of the enzyme.8 The conditions for the preparation of the covalent complexes and subsequent specific cleavage of the covalently bound proteins are listed in Table 2. Let us consider the mechanism of reaction of the NH2 groups of proteins with dialdehyde derivatives of monomeric components of NA proposed by Gregory and Kaiser 39 (Scheme 9). As can be seen from Scheme 9, the reaction of the NH2 group of a protein with a periodate-oxidised nucleotide derivative yields either a dihydroxymorpholine derivative 23 or a Schiff's base 24.B O pppOH2C CH CH N O Enz 24 Enz B O pppOH2C Enz CH CH O O B O pppOH2C OH NEnz Enz is enzyme. It was pointed out 31, 33 ± 35 that stable morpholine derivatives of enzymes with oATP or oADP are formed without reduction. Following addition of an oxidised derivative of a nucleotide to the enzyme, splitting of the tri- or di-phosphate anion upon b-elimi- nation occurs faster than in the absence of the enzyme due to the involvement of the electron pair of the nitrogen atom of the Enzymes or chemical reagents for specific cleavage of the protein fragment Duration of reduction / min7 7 7 pronase, carboxypeptidase A, carboxypeptidase B, aminopeptidase 35 trypsin, chymotrypsin, pronase, a-aminopeptidase trypsin 60 BrCN 1 247 Scheme 9 B O pppOH2C 7H2O OH N HO23 Enz B O H2C +pppO7 + OH NEnz Ref. 31 348 32 36248 morpholine derivative in the splitting of the tri(di)phosphate anion (see Scheme 9).According to other reports,8, 32, 36 the reduction of intermedi- ate products (a dihydroxymorpholine derivative or a Schiff's base) with borohydrides (NaBH4 or NaBH3CN) is necessary for stable covalent binding of the enzyme with the nucleotide. So what is the information that one may derive from cross- linking of proteins with periodate-oxidised mononucleotides? In the first place, specific cleavage of a protein covalently bound with a nucleotide by enzymes or by chemical reagents provides infor- mation about the location of amino acids or a protein fragment that form the active or cofactor-binding site of the enzyme.Enzymic hydrolysis is conventionally carried out with trypsin or other specific proteases, while chemical cleavage of proteins at the methionine residues is performed with BrCN (see Table 2). Enzymic hydrolysis of a modified and reduced conjugate yields a small peptide covalently bound with the nucleotide and then the amino acid sequence of the peptide is determined. To this end, the peptide cross-linked to a radiolabelled oATP is subjected to acid hydrolysis, dansylation and separation by two-dimen- sional gel electrophoresis followed by identification of dansyl amino acids.32 The mobility of the radiolabelled dansylated derivative coincided with that of the synthetic dansylated deriva- tive of the covalent adduct of lysine with oATP.The amino acid sequence of the peptide cross-linked with oGDP or oGTP was determined using the Edman degradation.37 The lysine residues involved in the covalent binding with periodate-oxidised nucleotide derivatives were identified after proteolysis of products of cross-linking of oATP to histone kinase 32 and pyruvate carboxylase 8 as well as of oGDP and oGTP to the protein c-H-ras p21.37 It was suggested that the lysine residues present in the active or cofactor-binding sites of enzymes are responsible for the binding of the phosphate groups of ATP due to the basic properties of the e-amino group of lysine.As it has been noted above, treatment of the protein ± nucleo- tide conjugate with BrCN results in the cleavage of the covalently bound protein at the methionine residues (Met). Since these residues are rare in occurrence, large protein fragments are usually formed. This method allowed one to demonstrate that the GTP- binding domain of the elongation factor Tu is localised in the N- terminal part of the protein.36 Affinity modification of active or cofactor-binding sites of pyruvate carboxylase,8 mitochondrial ATPase,31 isocitrate dehy- drogenase,34 phosphoribulokinase 35 and alkaline phosphatase from human placenta 38 with ATP, ADP or eAMP 20,30-dialde- hyde derivatives led to the inhibition of these enzymes.There are several nucleotide analogues that contain a reactive group and can be used for covalent linking to nucleotide-binding sites of pro- teins. However, only some of them are inhibitors that can specifically bind with the active site. Site-directed modification should meet two criteria. Let us consider these criteria with oATP as an example. First, ATP must protect the protein from inacti- vation with oATP. Second, oATP must serve as a substrate for this enzyme. Wherever these two criteria were met, it was demonstrated that oATP is a site-directed inhibitor of mitochon- drial ATPase 31 and phosphoribulokinase,34 whereas oeAMP is a site-directed inhibitor of alkaline phosphatase from human pla- centa.38 The dependence of inactivation of multisubunit proteins, e.g., pyruvate carboxylase 8 and NAD-dependent isocitrate dehy- drogenase,35 on the concentration of oATP or oADP and the effects of other cofactors and substrates of enzymes (multisubunit proteins have several substrates and cofactors) on the affinity modification of these proteins with oATP or oADP have been studied in a number of papers.The affinity modification of these proteins with dialdehyde derivatives of nucleotides allowed one to suggest the relative arrangement of the active and cofactor-bind- ing sites of the enzymes.8, 35 Thus, in some cases affinity modification of proteins with periodate-oxidised derivatives of nucleotides has made it possible to establish the active and cofactor-binding sites of enzymes that O MGritsenko, E S Gromova are covalently bound with periodate-oxidised derivatives of mononucleotides and to suggest the location of the oATP- (cofactor-) binding sites in multisubunit proteins.2. Affinity modification of proteins and polypeptides with oligonucleotides containing dialdehyde fragments Methods for cross-linking of histones to DNA containing ran- domly introduced aldehyde groups were developed in the 1980's by Mirzabekov et al. in structural studies of chromatin.40 ± 45 The aldehyde groups could be introduced into DNA in several ways. One of them is based on acid treatment of DNA, which results in its depurination and concomitant liberation of the aldehyde group in the sugar moiety.However, this approach can hardly be applied to covalent cross-linking of DNA to proteins, because low pH values prevent the formation of DNA± protein complexes. Yet another method for the random introduction of the aldehyde groups into DNA strands is based on methylation of DNA purines with dimethyl sulfate and subsequent depurination.40 In order to identify contacts of DNA with histones, cell nuclei were treated with dimethyl sulfate, then depurination was carried out in a neutral medium followed by reduction with sodium borohy- dride.41 ± 43 Such a treatment resulted in the covalent binding of the aldehyde groups of DNA with the histone amino acid residues interacting with DNA.The same approach was used to establish DNA± protein contacts in complexes of RNA polymerase with the promoter lacUV5,46 of lac repressor with DNA47 and in the cowpox virus.48 The interaction of DNA duplexes and oligonucleotides con- taining dialdehyde fragments with proteins and polypeptides has been studied recently.19, 25, 30 The aldehyde groups were intro- duced regiospecifically both into terminal and nonterminal posi- tions of the oligonucleotide strand. The possibility to introduce aldehyde groups into any position of the oligonucleotide strand has made it possible to investigate template-driven enzymes (RNA polymerases) and enzymes recognising specific sequences in DNA (DNA restriction ± modification enzymes). The obvious advant- age of dialdehyde reagents is their specificity with respect to adjacent lysine e-amino groups. Special mention should be also made of the ability of these reagents to form stable covalent complexes with the protein after their reduction.The proximity of definite sugar residues of DNA to the lysine residues of the active or DNA-binding sites of proteins can be established by means of introduction of the aldehyde groups into a definite sugar residue of the DNA duplex and subsequent cross-linking of the modified duplex to the proteins. The specificity of the dialdehyde fragment with respect to the lysine amino group was used for efficient covalent binding of poly(L-Lys) with two aldehyde groups l in the 30-terminus of an oligonucleotide.19 Probing of the functional sites of the DNA restriction- modification enzymes EcoRII and MvaI which recognise the sequence 50 ...CCAGG ... 30 30 ... GGTCC ... 50 in DNA, was carried out.25 The restriction endonuclease EcoRII (R.EcoRII) cleaves the phosphodiester bonds at the positions indicated by the arrows. The DNA-methyltransferases EcoRII (M.EcoRII) and MvaI (M.MvaI) methylate the inner cytosine residues at C(5) (M.EcoRII) or at N(4) (M.MvaI). The cross- linking of these enzymes to DNA duplexes (substrate analogues) that contain an oxidised 1-(b-D-galactopyranosyl)thymine residue was carried out.25 The modified sugar residue was introduced either into the recognition site (duplex 25*) or into the flanking nucleotide sequences (duplexes 26* and 27*).Dialdehyde-containing nucleic acids and their components: synthesis, properties and affinity modification of proteins 50 GCCAACCXGGCTCT 25 (X=Tgal), 25* (X=Tgal*) 30 CGGTTGGACCGAGA 50 GCCAXCCTGGCTCT 26 (X=Tgal), 26* (X=Tgal*) 30 CGGTAGGACCGAGA 50 GCCAACCTGGCXCT 27 (X=Tgal), 27* (X=Tgal*) 30 CGGTTGGACCGAGA O Me NH N O; Tgal*= Tgal=7O HO O OHO The dialdehyde fragment present in the oxidised 20-O-ribofur- anosylcytidine was introduced into DNA duplexes at definite positions (711,+1,+2) of the coding strandof the T7-consensus promoter in order to investigate the active and DNA-binding sites of RNApolymerase of bacteriophage T7.30 50 TAATACGACTCACTATAGGACT30 30 ATTATGCTGAGTGATATCCTGA50�coding strand 711 +1 +2 This was followed by cross-linking of these duplexes to T7 RNA polymerase and to its mutant form in which one amino acid residue (Tyr639) apparently located in close proximity to the initiation site was replaced by lysine.Based on the mechanism of binding of aldehyde groups of modified monomeric coonents of NA with the lysine residues of proteins, the following scheme has been proposed for the interaction of DNA duplexes (substrate analogues) with DNA restriction-modification enzymes (Scheme 10).25 OH2C Thy O HCHC O O O a OH2C Thy O HO N Enz HO ONaBH4 OH2C Thy O N Enz O O Me NH [O] O N 7O Tgal*). (Tgal O O O HCHC O Scheme 10 +EnzNH2 b OH2C Thy O HC HC XY O (X,Y=O, NEnz) NaBH4 OH2C Thy O X0 Y0 H2C H2C O (X0, Y0 =OH, NHEnz) 249 The formation of a cyclic derivative (route a) or a Schiff's base (route b) is possible in the first stage.The formation of a 7-membered cyclic derivative is less likely. The next step is the reduction of the DNA± protein conjugate with NaBH4 to give a stable complex. The conditions for cross-linking of DNAduplexes and oligo- nucleotides to DNA-binding proteins and a polypeptide are given in Table 3. Covalent binding of poly(L-Lys) with the 30-end of an oligodeoxyribonucleotide with an attached oxidised cytidine was performed with a 2-fold excess of the polypeptide. An excess (*100-fold) of the reducing agent (NaBH3CN) was introduced simultaneously with poly(L-Lys).19 Affinity modification of the restriction-modification enzymes EcoRII and MvaI was carried out with an excess of the protein with respect to the DNAduplex.The endonuclease EcoRII and the methylases EcoRII and MvaI were incubated with the modified reagents for 5 min at room temperature and then for 15 min at0 8C. This was followed by the reduction with a 1000-fold excess of NaBH4 with respect to the protein(40 min,0 8C).25 The reductionof the covalent complex of T7 RNA polymerase with a DNA duplex containing an oxidised 20-O-ribofuranosylcytidine residue was carried out witha 100-fold excess of NaBH4 for 1 h at roomtemperature.30 What are the results of cross-linking of dialdehyde-containing oligonucleotides to poly(L-Lys) and dialdehyde-containing DNA duplexes to various enzymes? What is the practical significance of these results? Cross-linking of 13 ±15-membered synthetic oligodeoxyribo- nucleotides, containing two 30-terminal aldehyde groups, comple- mentary to the site of initiation of translation of mRNA of the vesicular stomatitis virus protein to poly(L-Lys) has made it possible to increase considerably the efficiency of their incorpo- ration into cells.19 Such conjugates possess antiviral activity.No inhibitory effect on viral protein synthesis was found after incubation of cells containing the vesicular stomatitis virus with an oligodeoxyribonucleotide ± poly(L-Lys) mixture, i.e., the cross- linking of a modified oligonucleotide to the polypeptide is a prerequisite for the manifestation of antiviral activity.19 DNAduplexes containing an oxidised galactose residue in the recognition site of the EcoRII (or MvaI) restriction-modification enzymes (duplex 25*) or in the flanking nucleotide sequence (duplex 27*) were cross-linkedtothe EcoRII andMvaI methylases in high yields (see Table 3).25 The efficiency of cross-linking depended on the location of the reactive group and the nature of the enzyme and correlated with the efficiency of binding of these enzymes with the corresponding reagents.The specificity of covalent binding of the DNA duplexes 25* and 27* with M.EcoRII was investigated by examining competitive inhibition of affinity modification of the enzymes with the DNA duplexes containing and devoid of a canonical recognition site.Thus the substrate containing a recognition site and used in a 20-fold excess caused practically complete inhibition of the cross-linking of DNAduplexes containing aldehyde groups to EcoRII methylase. The duplex devoid of the recognition site and used in a 10-fold excess did not influence the ability of the DNA duplexes 25* and 27* for cross-linking to M.EcoRII. The data obtained confirmthe specificity of cross-linking of M.EcoRII to DNA duplexes con- taining aldehyde groups. Partial cleavage of protein fragments of conjugates of the MvaI methylase and DNA duplexes 25* and 27* with chemical reagents specific for methionine, cysteine or tryptophan residues has been carried out.{ Preliminary results of partial cleavage have made it possible to localise the site of cross-linking of the DNA duplexes 25* and 27* containing aldehyde groups to M.MvaI.It was found that this region is identical for both complexes and is localised in the C-terminus of the enzyme. Affinity modification of the EcoRII restriction endonuclease was carried out only with a reagent containing aldehyde groups in the flanking nucleotide sequence (duplex 27*).25 The yield of the { OMGritsenko, E S Gromova, unpublished results.250 Table 3. Conditions for the preparation of covalent complexes of DNA-binding proteins with oligonucleotides containing dialdehyde fragments. Protein or polypeptide (concentration) Poly(L-Lys) (80 nmol) EcoRII or MvaI methylases (M.EcoRII� 3.16 mmol litre71; M.MvaI�3.3 mmol litre71) Restriction endonuclease EcoRII (3.16 mmol litre71) RNA polymerase of bac- teriophage T7 (0.1 ± 0.5 mmol litre71) cross-linked product did not depend on the presence of the cofactor (Mg2+ ions).This led the authors 25 to assume that cross-linking of DNA duplexes containing aldehyde groups to R.EcoRII occurs not at the active site. None of the DNA duplexes containing an oxidised 20-O- ribofuranosylcytidine unit was able to cause affinity modification of T7 RNA polymerase.30 However, covalent cross-linking of the DNA duplex containing an oxidised 20-O-ribofuranosylcytidine residue at position +2 of the consensus promoter to the mutant form of T7 RNA polymerase (Tyr639? Lys) did take place.In wild type enzyme, Tyr639 is apparently involved in the NTP binding and should be located in close proximity to the initiation site, which suggests that Lys639 is the residue that was subjected to modification.30 The first results of affinity modification of DNA-binding proteins are important for determining specific DNA± proteins contacts and for studying the structure of active centres of enzymes as well as for elucidating the mechanisms of catalysis by restriction-modification enzymes and RNA polymerases. IV. Conclusion Introduction of reactive aldehyde groups into NA makes it possible to use them for attachment of fluorescent or any other label. In addition, oligonucleotides containing dialdehyde frag- ments are convenient for the synthesis of antisense oligonucleo- tides.Affinity modification of proteins with DNA duplexes containing regiospecifically introduced aldehyde groups proceeds with sufficiently high yields and results in stable covalent bonds. The results of cross-linking of this type of reagents to proteins allow one to recommend them as an efficient and flexible tool in the study of a broad range of DNA± protein interactions. This work was carried out with the financial support of the Howard Hughes Medical Institute (Grant HHMI 75195-545501) and the Russian Foundation for Basic Research (Project No. 98- 04-49108). References 1. G Ya Sheflyan, E A Kubareva, E S Gromova Usp. Khim. 65 765 (1996) [Russ.Chem. Rev. 65 709 (1996)] 2. K M Meisenheimer, T H Koch Crit. Rev. Biochem. Mol. Biol. 32 101 (1997) Reducing agent Modified analogue of NA (concentration) NaBH3CN 10 mmol oligodeoxyribonucleotides: 50CATTTTGATTACTGTC*30, 50AACGAGGCACATTC*30 (40 nmol), where C* is the oxidised cytidine residue NaBH4 14-membered DNA duplex con- taining an oxidised galactose residue (0.23 mmol litre71) (duplexes 25* and 27*) NaBH4 14-membered DNA duplex con- taining an oxidised galactose residue (0.23 mmol litre71) (duplex 27*) NaBH4 22-membered DNA duplex con- taining an oxidised 20-O-ribo- furanosylcytidine residue (0.1 ± 0.5 mmol litre71) O MGritsenko, E S Gromova Ref. Yield of cross-linked products (%) Duration of reduction / min Amount of the reducing agent 19 25 ± 30 120 25 9 ± 20 3.75 mmol litre71 40 25 4 3.75 mmol litre71 40 30 7 0.05 mmol litre71 60 3.D G Knorre, T S Godovikova FEBS Lett. 433 9 (1998) 4. N K Kochetkov, E I Budovskii, E D Sverdlov, N A Simukova, M F Turchinskii, V N Shibaev Organicheskaya Khimiya Nukleino- vykh Kislot (Organic Chemistry of Nucleic Acids) (Moscow: Khimiya, ) 5. P N Lowe, R B Beechey Bioorg. Chem. 11 55 (1982) 6. G Keith, A-L Glasser, J Desgres, K C Kuo, C W Genrke Nucl. Acids Res. 18 5989 (1990) 7. K Randerath Anal. Biochem. 115 391 (1981) 8. S B Easterbook-Smith, J C Wallace, D B Keech Eur. J. Biochem. 62 125 (1976) 9. P N Lowe, H Baum, R B Beechey Biochem. Soc. Trans. 7 1131 (1979) 10. O Howarth, A S Jones, R T Walker, P G Wyatt J.Chem. Soc., Perkin Trans. 2 261 (1984) 11. H R Greenberg, A S Perlin Carbohydr. Res. 35 195 (1974) 12. F Hansske, F Cramer Carbohydr. Res. 54 75 (1977) 13. Z A Shabarova, A A Bogdanov Khimiya Nukleinovykh Kislot i Ikh Komponentov (The Chemistry of Nucleic Acids and Their Compo- nents) (Moscow: Khimiya, 1978) 14. J X Khym,W E Cohn J. Am. Chem. Soc. 82 6380 (1960) 15. M Uziel Biochemistry 12 938 (1973) 16. R Rayford, D D Anthony, R E O Neil,W C Merrick J. Biol. Chem. 260 15708 (1985) 17. G Keith, P T Gilham Biochemistry 13 3601 (1974) 18. N F Krynetskaya, G V Zayakina, T S Oretskaya, E M Volkov, Z A Shabarova Nucleosides Nucleotides 5 33 (1986) 19. M Lemaitre, B Bayard, B Lebleu Proc. Natl. Acad.Sci. USA 84 648 (1987) 20. G R Gough, M J Brunden, P T Gilham Tetrahedron Lett. 24 5317 (1983) 21. A V Korshun, Yu V Berlin Bioorg. Khim. 20 565 (1994) a 22. S Agrawal, in Methods in Molecular Biology. Protocols for Oligo- nucleotide Conjugates. Synthesis and Analytical Techniques Vol. 26 (Totowa, NJ: Humana Press, 1994) p. 105 23. S N Mikhailov, E V Efimtseva, B S Ermolinsky,M V Fomicheva, O M Gritsenko, M G Brevnov, E S Gromova, G Schepers, A van Aerschot, P Herdewijn Collect. Czech. Chem. Commun., Spe- cial Issue 61 210 (1996) 24. B S Ermolinsky, M V Fomicheva, E V Efimtseva, S V Meshkov, S N Mikhailov, D S Esipov, E F Boldyreva, V G Korobko Nucleosides Nucleotides 15 1619 (1996) 25. M G Brevnov, O M Gritsenko, S N Mikhailov, E V Efimtseva, B S Ermolinsky, A van Aerschot, P Herdewijn, A V Repyk, E S Gromova Nucl.Acids Res. 25 3302 (1997)251 Dialdehyde-containing nucleic acids and their components: synthesis, properties and affinity modification of proteins 26. E V Efimtseva, B S Ermolinsky,M V Fomicheva, S V Meshkov, N S Padyukova, S N Mikhailov, A van Aerschot, J Rozenski, P Herdewijn Collect. Czech. Chem. Commun., Special Issue 61 206 (1996) 27. Z A Shabarova, A A Bogdanov, A S Zolotukhin Khimicheskie Osnovy Geneticheskoi Inzhenerii (Chemical Foundations of Genetic Engineering) (Moscow: Moscow State University, 1994) 28. S N Mikhailov, A DeBruyn, P Herdewijn Nucleosides Nucleotides 14 481 (1995) 29. S N Mikhailov, E V Efimtseva, G V Gurskaya,M V Fomicheva, S V Meshkov J. Carbohydr. Chem. 16 (1) 75 (1997) 30. S N Kochetkov, S O Gudima, E E Rusakova, D A Kostyuk, S N Mikhailov, V L Tunitskaya, in The Meeting of International Research Scholars from the Baltic, Central Europe and the Former Soviet Union (Abstracts of Reports), Budapest, 1998 p. 68 31. P N Lowe, R B Beechey Biochemistry 21 4073 (1982) 32. S N Kochetkov, T V Bulargina, L P Sashchenko, E S Severin Eur. J. Biochem. 81 111 (1977) 33. A G Rabinkov, S V Amontov Biochem. Biophys. Acta 1037 216 (1990) 34. M M King, R F Colman Biochemistry 22 1656 (1983) 35. H M Miziorko, C A Brodt, T J Krieger J. Biol. Chem. 265 3642 (1990) 36. L Seidler, M Peter, F Meissner, M Sprinzl Nucl. Acids Res. 15 9263 (1987) 37. A Low,M Sprinzl, H G Faulhammer Eur. J. Biochem. 215 473 (1993) 38. G G Chang,M S Shiao,K R Lee, J J WuBiochem. J. 272 683 (1990) 39. M R Gregory, E T Kaiser Arch. Biochem. Biophys. 196 199 (1979) 40. A D Mirzabekov, S G Bavykin, V L Karpov, O V Preobrazhenskaya, K K Ebralidse, V M Tuneev, A F Melnikova, E G Goguadze, A A Chenchick, R S Beabealashvili Cold Spring Harbor Symp. Quant. Biol. 47 503 41. K K Ebralidse, S A Grachev, A D Mirzabekov Nature (London) 42. A D Mirzabekov, D V Pruss, K K Ebralidze J. Mol. Biol. 211 479 43. K K Ebralidse, T R Hebbes, A L Clayton, A W Thorne, 44. A D Mirzabekov, S G Bavykin, A V Belyavsky, V L Karpov, (1982) 331 365 (1988) (1990) C Crane-Robinson Nucl. Acids Res. 21 4734 (1993) O V Preobrazhenskaya, V V Shick, K K Ebralidse Methods Enzymol. 170 386 (1989) 45. G A Nacheva, D Y Guschin, O V Preobrazhenskaya, V L Karpov, K K Ebralidse, A D Mirzabekov Cell 58 27 (1989) 46. A A Chenchick, R S Beabealashvili, A D Mirzabekov FEBS Lett. 128 46 (1981) 47. D E Kamashev, N G Esipova, K K Ebralidse, A D Mirzabekov FEBS Lett. 375 27 (1995) 48. A N Chkheidze, G G Prikhodko, V L Karpov, S K Vassilenko, A D Mirzabekov FEBS Lett. 336 340 (1993) a�Russ. J. Bioorg. Chem. (Engl. Transl

ISSN:0036-021X    

出版商:RSC    

年代:1999

数据来源: RSC