摘要:

Russian Chemical Reviews 68 (4) 253 ± 286 (1999) #1999 Russian Academy of Sciences and Turpion Ltd UDC 535.379:535.373.2:541.147.4:541.124:543.87:541.14:542.943 Dioxiranes: from oxidative transformations to chemiluminescence V P Kazakov, A I Voloshin, D V Kazakov Contents I. Introduction II. Synthesis and spectral characteristics of dioxiranes III. Thermal decomposition of dioxiranes IV. Dioxiranes as oxidants V. Chemluminescence and photochemistry of dioxiranes VI. Conclusion 253 254 257 262 274 280 centre of chemists' attention and the number of publications devoted to them has constantly increased. What is the reason for this interest? The main cause is the exceptionally high reactivity of these compounds, which is remarkably combined with high selectivity of oxidation.The most typical reactions of dioxiranes include oxidative functionalisation of alkanes, alkenes and their functionally substituted derivatives containing heteroatoms X C H C OH O C C R1 O C C C R2 O 1 R3X R3XO (or R3XO2) Abstract. Experimental data on the chemistry of a new class of highly effective oxidation reagents, dioxiranes, are summarised. The main methods used to generate dioxiranes and reactions in which dioxiranes have been proposed as intermediates are con- sidered. The full notion about an important property of dioxir- anes, i.e. the ability to oxidise rapidly, selectively and under mild conditions various classes of organic compounds (alkanes, alkenes, compounds containing heteroatoms, organometallic sub- strates, etc.) is given.Various aspects and mechanisms of these reactions are discussed. The attention is focused on the analysis of mechanisms of dioxirane decomposition in the absence of oxidis- able substrates. One of the most attractive aspects of the dioxirane chemistry, chemiluminescence, is considered (the mechanisms of the generation of excited products during both thermal and catalytic decomposition and upon photochemical activation are discussed). The bibliography includes 401 references. I. Introduction The chemistry of three-membered cyclic peroxides, dioxiranes 1, has swiftly developed during the last twelve years. R1 O It is this fact that attracts the attention of chemists engaged in organic synthesis to oxiranes.The most often used derivatives are dimethyldioxirane 1a and methyl(trifluoromethyl)dioxirane 1b; the oxidative properties of these compounds have been the subject of numerous publications including several excellent reviews,2 ±9 devoted mainly to synthetic aspects. C O R2 1 In 1985, when successful synthesis of a number of `isolated alkyldioxiranes' { had been reported,1 these compounds became available for wide employment. Since then, they have been in the However, this does not exhaust the properties of dioxiranes. Chemiluminescence (CL) is another, equally important feature of these compounds. A fairly attractive feature of dioxiranes, found recently, is that they are capable of forming products in electroni- cally excited states upon both thermal decomposition and photo- chemical activation.6, 10 ± 17 O* R1 O D or hn (1) C C O R2 R1 R2 O { From here on, the term `isolated dioxirane' implies a solution of dioxirane in the corresponding ketone or in a solvent isolated from the reaction mixture.This term, which is generally accepted in the literature and reflects features of the peroxide method for the synthesis of dioxiranes (see Section II), is used in order to distinguish the cases where isolated dioxiranes are used from those when dioxiranes are generated in situ and are not isolated from the reaction mixture. The research along this line started only recently, most of the studies being performed by the authors of this review. Even these few studies allow one to appreciate the great opportunities and prospects opened for researchers in the wonderful world of chemiluminescence of dioxiranes.Although it is difficult to predict the extent to which dioxiranes would be able to compete with their chemical relatives, 1,2-dioxetanes 2 18 ± 22 O O VP Kazakov,A I Voloshin,DVKazakov Institute of Organic Chemistry of Ufa Scientific Centre of the Russian Academy of Sciences, prosp. Oktyabrya 71, 450054 Ufa, Russian Federation. Fax (7-347) 235 60 66. Tel. (7-347) 235 61 11. E-mail chemlum@ufanet.ru C C , 2 Received 16 June 1998 Uspekhi Khimii 68 (4) 283 ± 317 (1999); translated by Z P Bobkova254 it can be claimed with confidence that these three-membered cyclic peroxides have already occupied a special place in the world of shining reactions.The great interest in dioxiranes is also due to the fact that they represent an isomeric form of carbonyl oxides R1R2C+7O7O7 (3), which are oxidants and important reactive intermediates in many oxidative processes.23 ± 32 Despite the fact that the behav- iours of dioxiranes and carbonyl oxides are substantially different, both should be taken into account in consideration of the mechanisms of some oxidation processes. Moreover, photocycli- sation of carbonyl oxides 3 is the main method used to synthesise dioxiranes 1 in a matrix.33 The mechanism of decomposition of dioxiranes in the absence of easily oxidisable partners also presents interest. The mechanism of their reactions with alkanes, which has unexpectedly become the object of sharp debates, is equally interesting (see, for example, Refs 34 ± 39).There are grounds for believing that dioxiranes can be formed in the upper atmosphere,1, 3, 40 upon interaction of alkenes with ozone.41 ± 44 Study of gas-phase reactions of dioxiranes with polyaromatic hydrocarbons (PAH) 3, 45 ± 47 including those yield- ing carcinogens (which can affect the environment) could provide deeper insight into the processes occurring in the atmosphere. This review covers these and many other aspects. We hope that it would present interest not only for organic chemists but also for specialists in physical chemistry. II. Synthesis and spectral characteristics of dioxiranes The history of the dioxirane chemistry covers almost a century.In 1899, Baeyer and Villiger,48 who studied the reaction of menthone with monoperoxysulfuric acid, postulated that the formation of the corresponding lactone is preceded by the formation of a cyclic oxygen-containing intermediate, dioxirane. O O +HOOSO2OH O O O Now this reaction is named after the authors. They were the first to introduce the term `dioxirane' into scientific literature. The next mention of dioxiranes dates back to 1910, when Harries 49 suggested that decomposition of 1,2,3-trioxolanes, resulting from ozonisation of alkenes, affords carbonyl oxide and a peroxide and ascribed a dioxirane structure to the latter product. Only many years after these two publications had appeared, was the first dioxirane really prepared and characterised.This was done by Talbot and Thompson 50 in 1972. The authors reported on the synthesis of perfluorodimethyldioxirane 1c and chlorodi- fluoromethyl(trifluoromethyl)dioxirane 1d by oxidation of the corresponding dialkoxides with fluorine. However, this method has not been further developed. O7Li+ O F3C F3C C C +F2 O7Li+ O F2XC F2XC 1c,d X=F(c), Cl (d). The dioxiranes 1c and 1d were isolated using low-temperature gas chromatography; they were coloured pale yellow both in the liquid and solid states (the absorption maximum of the dioxirane 1c lies at l=306 nm).50 The compound 1c was described as unstable and explosive.50 At present, two main lines in the dioxirane synthesis can be distinguished: (1) the peroxide method, which is used most often and successfully to prepare dioxiranes and (2) non-peroxide V P Kazakov, A I Voloshin, D V Kazakov methods (e.g., ozonolysis of hydrocarbons, photooxidation of diazo compounds in a matrix and some other methods.) 1.Non-peroxide methods for the synthesis of dioxiranes When considering the known non-peroxide methods for the generation of dioxiranes, we dwelt not only on the studies the authors of which succeeded in isolating dioxiranes and obtaining their spectral characteristics but also on those in which dioxiranes were only suggested as possible intermediates (the latter type is represented by a few examples). a. Ozonolysis of saturated and unsaturated compounds In 1977 two groups of researchers working independently 41 ± 44 presented convincing experimental evidence (obtained by micro- wave spectroscopy and mass spectrometry) for the formation of the simplest dioxirane 1e in the gas-phase ozonisation (7130 to 775 8C) of ethylene. Dioxirane 1e was also detected among the products of ozonolysis of propene, vinyl fluoride and but-1-ene.O O7 + O O3 O O H2C CH2 H2C H2C O 7HCHO O 1e The microwave spectroscopy data showed that dioxirane 1e has a shorter C±C bond (1.3878 A) and a longer O±O bond (1.5155A) than ethylene ozonide, in which the corresponding bond lengths are 1.416 and 1.461A. A large variety of reactions of ozonisation of unsaturated substrates involving dioxiranes have been reported.51 ± 59 Thus Keay and Hamilton 51, 52 carried out ozonisation of but-2-yne in CH2Cl2 (770 8C).By varying the temperature and adding portions of methanol to the solvent, the researchers isolated three different products, capable of epoxidising alkenes; the first compound was identified as the peroxy acid MeC(O)OOH, the second one was identified as trioxolene 4, and the structure of dioxirane 1f was attributed to the third compound. Me O C O3 O Me O MeC CMe C C O MeOC O Me 4 1f Pryor et al.53 carried out a similar reaction in the presence of nitrone as a spin trap; they detected the adduct of the nitrone with the acetyl radical formed from the dioxirane 1f. Bufalini et al.54 interpreted the formation of acetic acid in the ozonisation of but- 2-ene as being due to the following sequence of reactions: Me O O Me O O3 C MeCH CHMe C MeCOOH.H O H 1g Eastman et al.55, 56 explained in a similar way the formation of methyl acetate and an ester of formic acid in the gas-phase ozonisation of tetramethylethylene and cyclohexene. O'Neal and Blumstein 57 proposed a general mechanism of gas-phase ozololysis based on participation of the biradical form of carbonyl oxide and the subsequent transformation of the biradical into dioxirane. Conversely, Vaccani et al. 58 suggested direct formation of dioxirane from 1,2,3-trioxolane during the gas-phase reaction of ozone with vinyl chloride. The liquid-phase ozonisation of 1,2-dimethoxy-1,2-diphenyl- ethene gave (methoxy)phenyldioxirane 1h, which was studied by 13C NMR spectroscopy.59 O Ph C O MeO 1h In several studies, dioxiranes have been considered as inter- mediates in ozonisation of saturated compounds.Thus ozonolysis of ketones 5 occurs presumably 60 via an attack by ozone on theDioxiranes: from oxidative transformations to chemiluminescence carbonyl group of 5 to give compounds 7 or 8, which eliminate an oxygen molecule being thus converted into either carbonyl oxide or dioxirane (Scheme 1). Scheme 1 O +O3 Me3SiC 5 R Me3Si O Me3Si 7 O O C + C 7O2 O R O O R 7 7 O O Me3Si + Me3Si + 7 O C O O C O 7O2 R R 8 O Me3SiOC R 6 It has been suggested 61 that the formation of anhydrides in the ozonisation of some a-diketones occurs by a similar scheme.b. Cyclisation of carbonyl oxide to dioxirane in a matrix Yet another aspect of the dioxirane chemistry is related to low- temperature photochemistry. In a series of studies,28, 33, 62 ± 72 a new pathway to dioxiranes has been found, which is based on low- temperature irradiation of carbonyl oxides in an argon matrix. O + O2 hn hn (2) R2C R2C N2 R2C R2C O O7 7N2 O This method was used to prepare diphenyldioxirane, chlor- o(phenyl)dioxirane, phenyl(trifluoromethyl)dioxirane, a series of substituted dioxiranes based on quinone O-oxides, silicon-con- taining dioxiranes, etc.28, 33, 62, 65 ± 77 R2 R1 Ph O O O C Me2Si O R O O O R3 R4 R=Ph, Cl, CF3, PO(OMe)2 O O O O Evidence has been obtained for the formation of unsubsti- tuted dioxirane 1e in the oxidation of carbene :CH2 in an oxygen- containing matrix.78 Photocyclisation of propynal O-oxide 3a to give propargyldioxirane 1i has been reported.79 l=480 nm O2 HC C CH HC C CH 7N2 35 K N2 7 O O+ O HC C hn C HC C C O l=590 nm H H 3a 1i Despite the fact that photooxidation of diazo compounds made it possible to detect several dioxiranes, this method for their synthesis has not found wide application because it requires thorough control of the photolysis conditions, temperature and the solvent (in order to avoid side reactions of carbenes) and because carbene and carbonyl oxide are unstable.The lifetimes of these species have to be sufficiently long and, in addition, photo- decomposition of the diazo compound and photocyclisation of carbonyl oxide have to occur at those wavelengths where the dioxirane is stable in order to avoid its rearrangement into an ester.Until recently, dioxiranes obtained in this way could be studied only at low temperatures. 255 However, in 1994, Sander et al.80 succeeded in preparing the relatively stable dimesityldioxirane 1j at quite plausible temper- atures (about 780 8C). This compound was synthesised from dimesityldiazomethane 9 via the corresponding carbonyl oxide 3b, the lifetime of which is several orders of magnitude longer than that of diphenylcarbonyl oxide. + O O2 hn hn Mes2C 780 8C O Mes2C N2 9 Mes2C O O¡ 3b Mes2C 1j An advantage of this system is that the dioxirane 1j does not absorb in the spectral range needed to synthesise it.Later, Sander et al.81 proposed several convenient procedures for the synthesis of dimesityldioxirane 1j, resulting in the formation of this com- pound both in solution and in the crystalline state (melting point 62 ± 64 8C). c. Formation of dioxiranes in other peroxide systems Among various non-peroxide methods for the synthesis of dioxir- anes, studies by Russo and DesMarteau 82, 83 deserve attention. They prepared difluorodioxirane 1k, which is stable in the gas phase at room temperature over a period of several days, and characterised it by IR spectroscopy (the boiling point of the dioxirane 1k is 780 to 790 8C, and the melting point is <7160 8C).O O F CsF FCOF +ClF C O F 1k In some studies dioxiranes are considered to be possible intermediates in various chemical reactions. Thus in a study of the oxidation of acyl-substituted diazo compounds by singlet oxygen, Ando et al.84, 85 concluded that this reaction can give both carbonyl oxide and dioxirane; it is these compounds that are responsible for the oxidation of sulfides. O O O 1O2 PhC C Ph PhC CPh PhC CPh 7N2 + O O O N2 O7R2S 7R2SO O O PhC CPh Apparently, the photosensitised oxidation of phenyl(tri-meth- ylsilyl)diazomethane with singlet oxygen also occurs via a dioxir- ane.86 1 O O2 Me3Si C Ph Me3Si C Me3Si C Ph 7N2 O Ph + O N2 O7 Me3SiO C Ph O Dioxiranes have been suggested as intermediates in the decomposition of a-azo hydroperoxides by pyridine, 87 ± 90 oxida- tion of some azines 91 and ylides 92, 93 by singlet oxygen, in the reaction of the T(F2C:) carbene with O2 in the presence of alkenes 94 and in the decomposition of some endoperoxides.95, 96 Steinfatt,97 ± 100 who observed chemiluminescence during the reaction of geminal dichloro-derivatives of hydrocarbons with Na2O2, suggested that luminescence is due to a dioxirane formed as the key intermediate in this reaction. A dioxirane intermediate has been postulated to interpret the mechanism of biolumines- cence of bacteria.101 Recently, we suggested that chemilumines- cence in the Ph2CCl2 ±NaOH± H2O2 system, which is similar to the Steinfatt systems, is also associated with a dioxirane 12 (studies256 dealing with the chemiluminescence of dioxiranes are described in greater detail in Section V).2. Peroxide method for the synthesis of dioxiranes Despite the existing successful examples where dioxiranes have been synthesised using the procedures described above, the per- oxide method for the synthesis of dioxiranes is still the most convenient and the most widely used in synthetic practice. The discovery of this method was preceded by the publication of Montgomery,102 who found that some ketones catalyse decom- position of monoperoxysulfuric acid (Caro's acid) and accelerate various oxidative transformations involving this acid. Montgom- ery suggested that dioxirane is formed as an intermediate in the catalytic decomposition of H2SO5.Somewhat later,103 ± 108 the presence of dioxirane in the H2SO5±R2CO system has been proved by the isotopic dilution method using the 18O isotope (Scheme 2). Scheme 2 H 18 18 7 O SO¡3 HO HO7 O SO¡3 O 18 18O R2CO+18 18 R H2O O O C R O C SO¡3B R A R 7SO2¡ 4 7H+,7SO2¡ 4 R 18O O C R O R C18OR Su: b 7O18OSO¡ a 3 R2C é+Sué R2C é+18O7é+SO2¡ 4 Su: is substrate, é is 50%16O and 50%18O. It was in the above series of studies 103 ± 107 that the researchers showed for the first time that dioxirane itself is also a strong oxidant, which is able, for example, to accomplish highly efficient epoxidation of alkenes (Scheme 2, pathway b). The reactions were carried out in situ in the system `KHSO5 [or K2SO4 .KHSO4 ..2KHSO5 (oxone)] ± ketone ± substrate (Su:)' at pH&7.5. The necessity of maintaining a constant pH value is due to the fact that pH >7.5 leads to an increase in the concentration of the 7O7OSO¡3 dianion, which reacts with dioxirane (Scheme 2, pathway a) to destroy the latter, whereas at pH <7.5, deproto- nation of intermediate A is virtually terminated and the formation of intermediate B and then of dioxirane becomes unlikely. However, the main difficulty lay in the fact that dioxirane itself could exist in situ only together with the corresponding ketone, oxone,H2O and other reagents needed to maintain pH; of course, this created certain problems hampering the use and investigation of dioxirane. Therefore, the main challenge was to isolate dioxirane from the reaction mixture.This was attained in 1985 by Murray and Jeyaraman,1 who developed a procedure for the preparation of the individual dioxirane 1a and some other alkyldioxiranes (ethylmethyldioxirane, diethyldioxirane, methyl- n-propyldioxirane, n-butylmethyldioxirane, etc.). This study was the first to make dioxiranes accessible for investigations and to open up the way for their extensive use. A key point in the Murray method 1 was the fact that the reaction of oxone with the initial ketone was carried out in a stream of an inert gas and under a slightly reduced pressure; this made it possible to separate dioxirane as a vapour, which was then collected in cooled traps.Later, this procedure was somewhat modified;109 ± 111 however, the basic principle remained the same. This method was also used to prepare the dioxirane 1b,111 which proved even more reactive than 1a. It is noteworthy that the Murray procedure for the prepara- tion of dioxiranes is fairly simple and can be performed almost in any laboratory (see, for example, Ref. 110). It should only be borne in mind that the reactants need to be thoroughly purified V P Kazakov, A I Voloshin, D V Kazakov from possible impurities in order to avoid decomposition of dioxirane (see Section III) and that drying agents, if required, should be chosen with caution because it has been noted (see, for example, Refs 2, 112 and 113) that some drying agents affect the stability of the dioxirane 1a and shorten its lifetime.Therefore, when the purpose of the study does not imply thorough drying, it is better to avoid this procedure and to remove water by decanting the solution from H2O crystals at a low temperature (775 8C). The drawbacks of the peroxide Murray method are that it yields dioxiranes only in small amounts and that the initial ketone is distilled from the reaction mixture together with the dioxirane. Thus the concentrations of the dioxiranes 1a and 1b in the initial ketone are only 0.06 ± 0.12 and 0.65 ± 0.82 mol litre71, respec- tively. The concentrations of other alkyldioxiranes prepared by this procedure are even lower.1 The attempts to increase the concentration of the dioxirane 1a by varying the synthesis conditions and the experiments on its distillation failed.3 Thus, acetone is an immutable `companion' of the dioxirane 1a in all its chemical transformations. However, in the case of the dioxirane 1b, the initial ketone, 1,1,1-trifluoropropanone (TFP), has been completely separated.For this purpose, the dioxirane obtained was dissolved in the corresponding solvent (CCl2FCClF2, CCl4, CH2Cl2, etc.) and the solution was washed with doubly distilled water. The initial ketone, which reacts with water forming a hydrate, is extracted into the aqueous phase, whereas the dioxirane 1b remains in the organic phase.114 To obtain more concentrated solutions, frozen solutions of the dioxirane 1b (77 K) were slowly evaporated (<1072 Torr) and then recovered in cooled traps.114 A similar concentration procedure has been developed by Messeguer et al.115, 116 for the dioxirane 1a.The method is based on the fact that 1a is more lipophilic than acetone. Although complete removal of acetone was not attained in this case, extraction of an acetone solution of the compound 1a with an organic solvent (CCl4, CH2Cl2, CHCl3) followed by washing of the organic extract with a phosphate buffer (pH 7) made it possible to obtain more concentrated solutions of the dioxirane 1a (0.23 ± 0.35 mol litre71). In conclusion, another study by Murray et al.117 should be mentioned; the researchers reported a procedure for preparation of a number of dioxiranes (0.2 ± 0.8 mol litre71) from ketones poorly soluble in water.O O O O O O O O O O Pri C C Me Me Pri But Me 1l Me Unfortunately, the peroxide method described above cannot be used for the synthesis of `heavier' dioxiranes with bulky substituents, in particular, phenyl-substituted dioxiranes. 3. Identification and analysis of dioxiranes NMR, UV and IR spectroscopy are the most informative meth- ods, used most often to identify dioxiranes. As can be seen from Table 1, common features of dioxiranes include a characteristic signal (d 100 ppm) for the carbon atom bound to the peroxide group in the 13CNMRspectrum and a relatively weak absorption band in the near UV region (l=300 ± 380 nm), ending in the visible region, which is due to the `forbidden' n ± p* transition and is responsible for the pale yellow colour of dioxirane solutions (Fig.1). Configurations of dioxiranes are determined using their reactions with methyl phenyl sulfide and triphenylphosphine, iodometric titration and spectrophotometry (the latter method is applicable provided that the extinction coefficient of dioxirane is known).Dioxiranes: from oxidative transformations to chemiluminescence Table 1. Main spectroscopic characteristics of some dioxiranes (the data were taken from Refs 1, 3, 81, 109, 111 and 117). Dioxirane T/ 8C d /ppm 1 13C H O 1.65 ; 22.69 a (Me) 0 102.3 COO O Me2C 1a Me O C 1.97 c 97.32 COO ; 14.51 c (Me); 122.2 (CF3) 720 F3C O 1bO 740 O 103.0 COO ; 20.9 (p-Me); 21.6 (o-Me); 130.6 (m-C) Mes2C 1j 2.19 (12H, o-Me) 2.24 (6H, p-Me) 8.82 (4H, aryl) Me O C 103.9 e COO 7 Et O 1m O 717 O 1l 104.51 COO 33.36, 24.68 (signals of the other carbon atoms) a 13C NMR spectra were recorded relative to Me4Si.b Acetone labelled by the 17O-isotope was used as the initial ketone. c The measurements were performed in 1,1,1-trifluoropropanone. d 19FNMRspectra were recorded relative to CFCl3. e The measurements were performed in methyl ethyl ketone. e/ litre mol71 s71 105 335 400 l/ nm Figure 1. Absorption spectrum of the dioxirane 1Â. 4. Thermochemistry of dioxiranes The data obtained by microwave spectroscopy 41 ± 44 for unsub- stituted dioxirane 1e indicate that this compound contains the longest peroxide bond (1.52 A) among such bonds known so far.This strained character of the peroxide ring should favour the homolytic cleavage of the O±O bond to give the biradical intermediate O O (3) H2C H2C O O 1e According to theoretical calculations, the activation energy of this process is *15 kcal mol71, whereas the activation barrier to the back reaction (cyclisation) is negligibly small,4 <1 kcal mol71 (note that in a study 118 which is considered in more detail below, the activation energy of cyclisation of the biradical has been suggested to be*10 kcal mol71). The results of studies of various energy states of dioxirane 1e, the corresponding biradical and the carbonyl oxide indicate that dioxirane 1e cannot pass into carbonyl oxide without substantial energy expenditure, because the energy of the carbonyl oxide is much higher.4 Indeed, no examples of this transformation are known.The back reaction, which also requires additional activation energy, equal to *22 kcal mol71, anes.28, 29, 33, 62, 65 ± 77, 80, 81 III. Thermal decomposition of dioxiranes Despite the substantial progress attained in the studies of oxida- tive processes of dimethyl- (1a) and methyl(trifluoro-methyl)diox- iranes 1b, the behaviour of these compounds in solutions in the absence of easily oxidisable substrates is still enigmatic and contradictory and remains the least studied aspect in the chemistry of dioxiranes. At present, facts are being accumulated along this line; however, they are often fairly contradictory.In fact, there is still no general agreement concerning either the products of decomposition of the dioxirane 1a or its stability (the values for the time needed for decomposition of the dioxirane 1a at room temperature reported in the literature 109, 112, 119 range from 7 h 109 to 26 days 112). This situation is due to the properties of dioxiranes; appa- rently, their decomposition is a complex process depending on numerous factors and conditions. 1. The products and mechanism of decomposition of methyl(trifluoromethyl)dioxirane Decomposition of methyl(trifluoromethyl)dioxirane 1b in the initial ketone gives methyl trifluoroacetate (MTFA) and trifluoro- acetic acid, formed upon its hydrolysis, as the major products.111 Me C F3C 1b The half-life of the dioxirane 1b in the initial ketone is*20 h at 15 8C (at720 8C, the decrease in the concentration is*6% over a period of 48 h).111 In addition, it was noted 111 that decomposi- tion of the dioxirane 1b at 0 8C follows complex kinetics corre- sponding to a mixed first and second order.Later, when solutions of the dioxirane 1b in inert solvents were obtained, the full picture of its decomposition occurring at elevated temperatures or on exposure to UV radiation was identified.114 Whereas at low temperatures the dioxirane 1b is lmax /nm 19F 17O 335 302 b 347 297 c 781.5 d 206, 274 333 345 irradiation on occurs O O O CF3C CF3C OH OMe O 257 e/litre mol71 s71 109 c 104.6, 103.2 126e dioxir- of (4)258 rather stable in inert solvents (at 720 8C, the decrease in its concentration in CCl4 or CH2Cl2 is 5%± 6% over a period of 168 h), at elevated temperatures (60 8C, CCl4), it decomposes by almost 50% within 30 min.114 Thorough investigation of the products of thermolysis (60 8C) and photolysis of solutions of the dioxirane 1b free from the corresponding ketone showed that under these conditions, decomposition occurs by a radical chain mechanism 114 and affords MTFA, trifluoromethyl acetate (TFMA) and methyl acetate (MA).Apart from the esters listed above, the reaction mixture contains acetic and trifluoroacetic acids, which, in the opinion of the authors cited,114 have resulted from hydrolysis of TFMA and trifluoromethyl trifluoroacetate (TFMTFA), respectively.In addition, evolution ofCO2 was noted in all cases. These facts and the fact that in the presence of O2, the photolytic process is substantially retarded and the formation of esters is markedly depressed provide strong evidence for the chain radical mechanism of decomposition of the dioxirane 1b (Scheme 3). Scheme 3 a R1R2 R1 O hn or D [(R1) (R2) ] C 7CO2 O R2 b 1 (R1) || (R2) 1 OR2 R1 R1 OR1 C C O R2 O R2 A B R1=Me, R2=CF3. trifluoromethyl)dioxirane gives rise to the radical pair [C.H3 C .F3], organic phase, whereas TFP passes into the aqueous phase as In conformity with the Scheme 3, decomposition of methyl(- which then either recombines according to pathway a or generates free radicals C .H3 and C .F3 (pathway b); these radicals, in turn, attack dioxirane yielding alkoxyl radicals A.and B.. Pathway a is realised when methyl(trifluoro-methyl)dioxirane is photolysed in a matrix. In this case (unlike experiments in solution), 1,1,1- trifluoroethane is a major product of decomposition of dioxirane. Radicals A. and B. undergo b-cleavage to give esters with the regeneration of alkyl radicals, which carry the chain (Scheme 4).114 Scheme 4 CF3 Me O Me Me OMe OCF3 CH3 C C C O O O F3C F3C F3C B 1b A 7CH3 7CF3 7CF3 7CH3 O O O O MeCOMe CF3COCF3 MeCOCF3 CF3COMe H2O H2O MeCO2H CF3CO2H It is of interest that no radical chain processes are involved in the vacuum flash pyrolysis (500 8C) of the dioxirane 1b,114 which gives only MTFA.Apparently, in this case, dioxirane simply isomerises to ester according to reaction (4). The radicals formed upon decomposition of the dioxirane 1b were detected at low temperatures using 1,1,3,3-tetramethyl-1,3- adduct of the nitroxide 10 and the C .H3 radical is formed dihydroisoindolin-2-yloxyl 10 as a spin trap.120 However, the apparently via the dioxirane radical anion, resulting from the transfer of an electron from the nitroxide 10 to the dioxirane 1b V P Kazakov, A I Voloshin, D V Kazakov (Scheme 5, pathway a).120 Yet another channel of consumption of the radical anion is pathway b. Scheme 5 electron transfer O O O O7 + CH2Cl2, 0 8C C +R2N O C R2N O 10 Me Me CF3 CF3 1b + 10 a R2NOMe R2N O+CF3COO7+CH3 + 7R2NO, CF3COO7electron transfer O CF3 C + O7 O + O Me R2N O R2N O C 1b b CF3CMe 7O2 O CF3 Me F3C C Me 7O O R2NO + 2CF3CMe R2N is N The decomposition of the dioxirane 1b can also be induced by various impurities.Thus it has been noted 121 that the presence of even traces of metals can cause rapid decomposition of dioxiranes. Messeguer et al.122 have found that catalytic amounts of dialkyl ethers (e.g., diethyl or dihexyl ether) induce rapid decomposition of the dioxirane 1b in a radical chain process. This finding appears very important because the same researchers reported 122 that these ethers are contained in the initial TFP even after distillation. However, they can be removed.Thus when TFP is washed with water and an inert solvent, the ethers are accumulated in the hydrate. 2. The products, kinetics and mechanism of decomposition of dimethyldioxirane Several routes for decomposition of dioxiranes 1a can be found in the literature (Scheme 6). Scheme 6 Dimerisation (?) Catalysis by various impurities a f O Me e b C Isomerisation to MA O Me Decomposition via epoxidation of the acetone enol form 1a c d Catalysis by decomposition products Decomposition involving radicals Evidently, the realisation of one or another channel of trans- formation of the dioxirane 1a depends on a whole series of conditions such as temperature, the content of O2, the presence of impurities, etc.Some of these factors can be controlled; the influence of some other factors can be reduced (for example, by thorough purification of the initial compounds). Table 2 contains data on the products of decomposition of the dioxirane 1a and on the reaction mechanisms that have been invoked by the research- ers in order to interpret the results obtained and that are considered in detail below.Dioxiranes: from oxidative transformations to chemiluminescence Table 2. Products of decomposition of dimethyldioxirane (1Â) under various conditions. Reaction conditions Room temperature, no special purging with oxygen or an inert gas Vacuum flash pyrolysis, 150 ± 180 8C In boiling acetone Decomposition in the presence of BF3 Room temperature Decomposition in the presence of CCl3Br, 20 8C Decomposition in the presence of the Ru(II) tris- (bipyridine) complex, 40 8C a Some quantity of MA was already present in the initial solutions of 1Â.b Methyl acetate was the major product. c In this case, we are dealing with catalysed isomerisation of dioxirane to MA according to the electron transfer mechanism (see Section V). a. Dimerisation of dimethyldioxirane The first data on the products of decomposition of dimethyldiox- irane 1a were published in 1985. Murray et al.1 reported on the conversion of the dioxirane 1a into cyclic diperoxide 11: O Me Me C 2 O Me Me 1a Later, however, they were unable to reproduce their own results 112 and suggested that compound 11, which they had observed previously, must have been formed as a side product during the synthesis of dioxirane.b. Decomposition with participation of the enol form of acetone Decomposition of the dimethyldioxirane 1a at room temperature has been reported 119 to give hydroxyacetone 12 together with a minor amount of methyl acetate. It was noted 119 that solutions of dioxirane always contain some MA, which appears apparently during the synthesis of dimethyldioxirane. Based on this finding, a decomposition mechanism has been proposed, the key stage of which includes the reaction of the dioxirane 1a with the enol form of acetone 13 followed by rearrangement of the resulting epoxide intermediate to hydroxyacetone 12. O O OH C + C Me CH2 Me Me 1a 13 Ref.Decomposition products Proposed mecha- nism (Scheme 6) a 1 diperoxide 11 b 119 112 hydroxyacetone (12)+MAa the mecha- MAa nism is not discussed e 112 MA d 112 MA+1-(acetyl- oxy)propan-2-one MA+12 112 15 37 pathways b and e occur in parallel ed, e and f MA MAb, 1-(acetyl- oxy)propan-2-one, CH3CO2H, CH3Br, CHCl3, CH3OH, ClCH2C(O)CH3 e (see c) MA 15 Me O O C C Me O O11 H2C O O C (5) C Me CH2OH HO Me 14 12 However, the possible formation of the hydroxy ketone 12 upon direct insertion of an oxygen atom into the C±H bond of acetone or in a free-radical process also cannot be ruled out.119 The contribution of reaction (5) to decomposition of the dioxirane 1a increases in the presence of BF3.In the opinion of Murray and Singh,112 boron trifluoride exerts a dual effect: on the one hand, it increases the rate of conversion of 1a intoMAand, on the other hand, it favours an increase in the concentration of the enol 13, which then reacts with 1a [reaction (5)] to give hydroxy- acetone (see Table 2). It was also found that solutions of the dioxirane 1a are sensitive to the presence of bases; the addition of KOH to a solution of dioxirane results in its rapid decomposition, which follows first-order kinetics.119 A similar situation has been observed in the case of a solution of deuterated dioxirane 1a, which proved to be more stable than the non-deuterated com- pound (kH/kD*4).119 c. Catalysis by decomposition products Many researchers (see, for example, Refs 109, 112, 118, 119, 123) have noted that at high concentrations (50.06 mol litre71), decomposition of the dimethyldioxirane 1a does not follow first- order kinetics; instead, it has a fairly long induction period, which is followed by rapid decomposition (Fig.2). It was found that the higher the temperature and the dioxirane concentration, the shorter the induction period.118, 123 It was suggested that reaction products have a catalytic effect on the decomposition of the dioxirane 1a. Indeed, comparison of curves 2 and 3 in Fig. 2 shows that 1a decomposes much faster in the presence of decom- position products. Unfortunately, the products of decomposition of 1a were not specified in the study cited.118 ln D 71 73 75 77 2.77 0 Figure 2.Kinetic curves for the consumption of dimethyldioxirane 1 in acetone at 50 8C (solutions of 1a in acetone were used without preliminary dehydration).118 The initial concentration of the dioxirane 1a (mol litre71): (1) 0.12, (2) 0.02, (3) 0.02 (in the presence of the products formed upon decomposition of 0.12 mol litre71 of a solution of the dioxirane 1a). When the concentration of the dioxirane 1a is low (0.02 mol litre71), its decomposition follows first-order kinetics (Fig. 2, curve 2).112, 118, 123 This fact was used 118 to determine the activa- tion parameters of the decomposition of 1a in the temperature range 25 ± 75 8C: log k=12.4 ± 24.9/(2.3RT). Thus, at 25 8C, k=1.5361076 s71, and the activation energy of decomposition of the dioxirane 1a is about 9 ± 10 kcal mol71 higher than the value calculated theoretically (*15 kcal mol71) for unsubstituted dioxirane 1e.4 The latter result was interpreted 118 as being due to 259 1 2 3 8.33 5.55 11.11 t/ h260 the possible underestimation of the activation energy for the back cyclisation of the dioxirane biradical [see reaction (3)]; the researchers cited estimated 118 this value to be actually*10 kcal - mol71.According to our data,123 a major product of decomposition of the dioxirane 1a (see Table 2), namely, methyl acetate (161072 mol litre71) actually accelerates the reaction; however, this effect is insignificant: the ratio of the effective rate constants for decomposition of 1a in the presence and in the absence of MA is *1.4. Autocatalytic decomposition might account for one chan- nel of consumption of the dioxirane 1a, occurring in parallel with other channels such as radical chain decay and isomerisation to give MA.d. Radical chain decay Singh and Murray 112 showed that radical chain processes play an important role in the decomposition of the dimethyldioxirane 1a. Analysis of the products resulting from refluxing 1a in acetone and in a mixture of acetone with other ketones (butan-2-one, pentan-2-one, etc.) demonstrated the presence of various esters, apart from MA, the formation of which could be explained only in terms of a radical chain mechanism. It was also found that when the compound 1a is refluxed in an acetone solution, the rate of the process, the products formed and the product ratio depend substantially on whether or not O2 is present in the system; in fact, under an atmosphere of O2, 1a decomposed only by 27% over a period of 2 h, whereas under argon the dioxirane completely decomposed over a period of 10 ± 15 min under similar condi- tions.112 Based on their own results and on the data on decom- position of the dioxirane 1b obtained by Adam, Curci, et al., 114 Singh and Murray 112 proposed a scheme for radical chain decay of dimethyldioxirane 1a in acetone (Scheme 7). Scheme 7 O O D H3C C H3C C O CO2, 7CH3 7CH3 O H3C 1a O O O H3C CH3 H3C CH3+ C C CH3, H3C C O 7CH3 O O H3C H3C O O CH4+ H2C C CH3, CH3+ H3C C CH3 O O O O O C CH3.H3C C CH2 H2C C CH3 + H3C C O Scheme 7 well accounts for the inhibitory effect of O2 on the rate of decomposition of 1a; an oxygen molecule reacts with The formation of MeO2 .was explained by assuming that the reactive alkyl radicals, for example C .H3, to convert them into methyl radicals .CH3, generated upon decomposition of 1a, react stable peroxyl radicals and thus inhibits the chain process. Our with O2 molecules (the rate constant for the reaction of the .CH3 experimental data 13 are also in good agreement with the results radicals with O2 is *56109 litre mol71 s71).128 However, the obtained by the researchers cited above:112 complete decomposi- formation of these radicals upon direct interaction of the dioxir- tion of dimethyldioxirane 1a in solvents freed from oxygen (46 8C) ane 1a with the nitrone 15 also seems quite likely.occurs 4 times faster than under ordinary conditions (the kinetic It is of interest that *10 min after the EPR signal due to the isotope effect keff H / keff D&3.12). As in the case of the dioxirane 1b, the reaction of 1a with nitroxide trap 10 affords the adduct R2NOCH3.120 Generally speaking, nitroxides [e.g., tetramethylpiperidyloxyl (TEMPO)] are not convenient traps for the radical intermediates formed during dioxirane decomposition, because they are able to react directly with 1a and 1b thus inducing their consumption in a radical chain process; for TEMPO, this is illustrated in Scheme 8.124 When the dioxirane 1a was made to react (0 ± 56 8C) with a spin trap, N-tert-butyl-C-phenylnitrone 15, the formation of the nitroxide 16 was detected based on the EPR signal (a triplet of doublets with splitting constants at the N and H atoms equal to 13.5 and 2ê, respectively) 125 (Fig.3). This signal was V P Kazakov, A I Voloshin, D V Kazakov Scheme 8 R3 O R1R2N O + C O CH3 R1R2N + R3 C O and/or R1R2N O7 R3 O O 7R1R2NO O CH3 C O CH3 R3 O b-cleavage CH3 + (R3) C CH3 R3CO2 7CO2 O CH3 1a or 1b products of radical chain decay of dioxirane O2 CH3OO (inhibition) CH3 R1R2NO R1R2N OCH3 R1R2N= N ;R3=Me, CF3. b a 10 ê H Figure 3. EPR spectra recorded in the dioxirane 1 ± nitrone 15 system at 40 8C within 5 (a) and 15 min (b) after the sample has been placed in the spectrometer resonator.The initial concentrations of the dioxirane 1a and the nitrone 15 are 0.03 and 0.045 mol litre71, respectively. assigned 126, 127 to an adduct of the nitrone 15 with the peroxyl radical MeO2 ., i.e. to the compound 16. O PhCH NBut MeO2 + PhCH NBut O OOMe 16 15 adduct 16 has arisen, one more triplet with the splitting aN= 8.1 ê appears in the EPR spectrum (Fig. 3); this signal has been attributed 125 to benzoyl tert-butyl nitroxide, the formation of which was explained by rearrangement of the adduct 16.126, 127, 129, 130 The unusual shapes of the kinetic curves for the decay of dioxirane 1a (see Fig. 2) can also be interpreted in terms of a radical chain mechanism.Indeed, the presence of an induction period under ordinary conditions, i.e. without additional purging of the system by an inert gas or O2, may be associated with the inhibitory effect of oxygen, which is always originally present in a solution (thus the concentration of O2 in acetone is 6.861073 mol litre71).131 The reaction of the reactive alkyl radicals, gen- erated upon decomposition of dioxirane, with O2 molecules decreases the oxygen concentration in the system and results inDioxiranes: from oxidative transformations to chemiluminescence the consumption of 1a in a radical chain process, which is manifested as a sharp acceleration of the reaction. This is quite consistent with the decrease in the induction period following an increase in the temperature 118 and also with the substantial effect of argon.Even when the concentration of the dioxirane 1a is relatively low (0.03 mol litre71) and the temperature is moderate (20 8C), the induction period in the reaction performed under argon decreases to *150 min.124 It comes as no surprise that the dioxirane decomposition under an atmosphere of O2, which inhibits the radical chain process, strictly follows first-order kinetics irrespective of the initial dioxirane concentration or temperature (30 ± 49.5 8C).132 e. Isomerisation of dimethyldioxirane to methyl acetate Although arguments in favour of the radical mechanism of decomposition of the dioxirane 1a are quite forcible, the existence of a parallel channel of the decomposition of 1a, namely, its isomerisation to MA via a biradical intermediate, can also be considered to be proven.O Me Me O O Me C OMe C C (6) Me Me O O 1a It was found 14 that reaction (6) occurs under conditions of photolysis of the dioxirane 1a in a matrix (77 K) (isomerisation is also a major pathway of the low-temperature phototransforma- tion of some other dioxiranes 33). In addition, at higher temper- atures, (T=150 ±180 8C, vacuum flash pyrolysis), reaction (6) is regarded as the major pathway for decomposition of dimethyl- dioxirane (remarkably, under these conditions some 1a remains intact!).112 Apparently, rearrangement to give MA is the main route of decomposition of the dioxirane adsorbed on the Silipor surface from the gas phase.11, 16 However, it is reasonable to suggest that decomposition of the dimethyldioxirane 1a in solution also involves reaction (6).Its contribution depends most likely on the temperature and other experimental conditions. Due to the influence of impurities and at elevated temperatures, which promote the occurrence of parallel routes of the radical chain decay of the dioxirane 1a, the fraction of isomerisation should decrease. However, it has been shown experimentally that even under conditions most favourable for a radical chain process (46 8C, absence of O2), reaction (6) still does occur, because it is this reaction that is responsible for the chemiluminescence observed under these conditions 13 (this aspect is considered in greater detail in Section V).In our opinion, the contribution of reaction (6) markedly increases at lower temper- atures; apparently, at room temperature and below room temper- ature, it becomes the major route for the dioxirane consumption. 3 Note that reaction (6) can also be induced by a catalytic influence of various compounds. Thus ruthenium tris(bipyridine) complex Ru(bipy)2á and some polyaromatic hydrocarbons, which act as activators of the CL arising by the chemically O O H3C H3C a-cleavage D C C CH3CO2 CH3 O O H3C H3C O2 O CH3OO CH3C OCH3 chain inhibition 261 initiated electron-exchange luminescence (CIEEL) mechanism, catalyse isomerisation of dioxirane.6, 10, 12, 15, 16, 123 Apparently, the Silipor surface also functions as a catalyst.11, 16 e.Catalysed (induced) decomposition of dimethyldioxirane by impurities Some impurities have an exceptionally significant influence on the stability and the decomposition mechanism of the dioxirane 1a. These impurities include some metals, traces of dehydrating agents (e.g., molecular sieves,112 MgSO4, etc.) and reactive com- pounds present in the initial acetone or introduced into a solution of the dioxirane 1a from the reaction vessel at the stage of its synthesis. Murray 2 noted that the lifetime of dioxirane depends on the pre-history of the sample and can be sensitive to admixtures of the dehydrating agent used (e.g., Na2SO4). An example of dioxirane decomposition induced by impurities has been reported.37 It was shown that the stability of dimethyl- dioxirane 1a is substantially affected by the addition of CCl3Br.Whereas decomposition of the dioxirane 1a under ordinary conditions follows first-order kinetics (k=6.261076 s71), the addition of CCl3Br, especially with simultaneous removal of O2 from the system, sharply accelerates the process (Fig. 4), the product composition leaving no doubt as to the participation of free radicals in the dioxirane decomposition in the presence of CCl3Br37 (Scheme 9). Presumably,37 CCl3Br can also participate in the formation of a biradical-ion pair with the dioxirane, resulting from transfer of an electron from the bromide to 1a. The subsequent reverse electron transfer from the radical anion to the radical cation increases the concentration of biradical A and, hence, the proba- bility of formation of the CH3 .radical from it. 3+log [1a] 1 0.5 2 3 70.5 5 10t/ h 0 Figure 4. Kinetics of decomposition of dimethyldioxirane (1Â) in the absence (1) and in the presence (2, 3) of an equimolar amount of CCl3Br; (2) under atmospheric conditions, (3) under inert atmosphere (N2). Scheme 9 CH3 7CO2 CCl3Br 1aO H3C CH3Br+CCl3 C H3C OCH3 a-cleavage O radical chain decay CH3C OCH3+CH3 radical chain decay262 electron transfer reverse electron transfer 7 O O O O O O CCl3Br+ C C C +CCl3Br +CCl3Br Me Me Me Me Me Me A The occurrence of another parallel channel for the trans- formation of the biradical-ion pair, resulting in the formation of CCl3 .and BrO. radicals, capable of participating in the radical disappears in 5 ± 10 min and the solution becomes colourless. temperature, the yellow colour, typical of dioxiranes, completely chain decay of dioxirane, also cannot be ruled out.37 It was noted 37, 121 that traces of metals can cause rapid decomposition of the dioxirane 1b. Recently we have confirmed experimentally that this warning is also true for the dioxirane 1a. It was found 15 that even catalytic amounts of ruthenium(II) [(4 ± 24)61075 mol litre71] induce rapid decomposition of the dioxirane 1a. It can be anticipated that other metals would also influence the stability of dioxiranes. The stability of dioxiranes can be affected not only by traces of metals and dehydrating agents but also by organic impurities. The radical chain decay of methyl(trifluoromethyl)dioxirane 1b in the presence of dialkyl ethers (for example, diethyl and dihexyl ethers) 122 has been already mentioned.The addition of ethers to dimethyldioxirane 1a has a similar influence, although it is less pronounced.122 Unfortunately, since the boiling points of dialkyl ethers and acetone are close, purification of acetone by distillation does not always lead to the desired result. The situation is aggravated by the fact that some impurities can form directly in the reaction vessel and, therefore, they can appear in a solution of dioxirane at the stage of its synthesis.For example, this concerns MA, small amounts of which get into solutions of 1a in exactly this way.112, 119 Impurities that have got into a dioxirane solution via this route can be involved in the radical decomposition of dioxirane; hence, the different lifetimes of the dioxirane 1a synthesised by various researchers and the non-reproducibility of the kinetic data15, 109, 112, 118, 119, 123, 132 can be due to different natures and amounts of non-controllable impurities able to accelerate decomposition of the dioxirane 1a and promote the formation of different decomposition products (see Table 2). This resembles the situation observed in the study of the kinetic and activation parameters of decomposition of tetramethyldioxetane (TMD).In these studies, the so-called `false solvent effect' had been discovered, manifested as a sharp acceleration of the reaction on passing from aprotic solvents (benzene, CCl4) to alcohols (MeOH and EtOH) and poor reproducibility of the kinetic data in alcoholic solutions.21, 133 The reason was that admixtures of transition metal ions were present even in distilled sol- vents.21, 134, 135 Treatment of alcoholic solutions of TMD with complexonates improved the reproducibility, and the kinetic and activation parameters acquired values typical of aprotic solvents. However, in the case of the dioxirane 1a, the situation must be more complicated. Thermal decomposition of dimethyldioxirane 1a is a complex process, its mechanism depending on numerous factors.To elucidate the extent of influence of each factor, further studies are needed. 3. Decomposition of other dioxiranes The formation of H2 and CO is the main pathway of decom- position of gaseous unsubstituted dioxirane 1e (7115 8C).42, 43 O H C H2+CO O H 1e It has been noted that decomposition of dioxirane 1e follows different channels, resulting in the formation of atomic hydro- gen.43 Gaseous difluorodioxirane 1k is more stable than 1e. No decrease in its concentration has been noted over a period of V P Kazakov, A I Voloshin, D V Kazakov 12 h at 22 8C and 15 Torr. The unusual stability of the dioxirane has become the subject of a special theoretical study.136 When a small amount of ClF is added to difluorodioxirane 1k, the dioxirane is destroyed fairly rapidly to give COF2 and O2.82 F O ClF C COF2+ O2 O F 1k The spirocyclic dioxirane 1l is relatively unstable:117 at room Simultaneously, the solution substantially warms up, indicating the exothermic character of the decomposition of 1l.Interestingly, instead of the expected lactone 18, decomposition of the dioxirane 1l at room temperature gives its linear oligomer 17 as the major product (90%). 20 8C HO[(CH2)5COO]12H 17 OO O 725 8C O 1l 18 However, at lower temperatures the reaction gives the lactone 18.117 This example clearly illustrates the statement that the reaction temperature can dictate the predominance of one or another channel of dioxirane decomposition. Dimesityldioxirane 1j can exist both in solution and in the crystalline state.80, 81 In both cases, the dioxirane 1j isomerises to the corresponding ester, mesityl mesitoate 19: O O hn or D MesC Mes2C (l>360 nm) OMes O 19 1j The dioxirane 1j is relatively stable at room temperature (its concentration decreases by 14% over two weeks) and virtually stable at 720 8C.However, on exposure to radiation, it com- pletely isomerises into the ester 19 in several minutes.80, 81 The stability of the dioxirane 1j under ordinary conditions is due to the facts that its molecule is sterically hindered and the O7O bond is relatively strong and, in addition, it is the shortest (1.503A) among the O7O bonds in dioxiranes.81 IV. Dioxiranes as oxidants Highly selective oxidation of organic compounds of various classes is a well-studied aspect of the chemistry of dioxiranes, which is becoming more and more significant in organic synthesis.This feature, discovered even in the first studies on in situ generation of dioxiranes,103 ± 107 has fully come to light in the subsequent studies carried out using pure solutions, most often of the dioxiranes 1a and 1b. The main types of oxidative trans- formations involving 1a and 1b include oxidation of alkanes, alkenes, their functionally substituted derivatives containing heteroatoms (O, S, N, P), and organometallic compounds. 1. Oxidation of saturated compounds Highly selective oxidation of saturated compounds to the corre- sponding hydroxy- and oxo-derivatives is one of the most impor- tant and most difficult problems in organic chemistry.137 At present, peroxy acids, hydroperoxides, ozone, catalytic systems including transition metals and some other compounds are used most often for this purpose.138 ± 144 Dioxiranes, capable of oxidis- ing selectively and under mild conditions non-activated C±H bonds in alkanes, occupy a unique place in the series of organic oxidants.The reactions of dioxiranes with alkanes give rise to the corresponding alcohols. The oxidation of cis- and trans-1,2-Dioxiranes: from oxidative transformations to chemiluminescence dimethylcyclohexanes by the dioxirane 1a, reported by Murray et al.,145 was among the first examples of this reaction. Me Me 18 h OH HH +1a H (45%) Me Me Me Me 18 h H +1a Me OH Me H H (100%) A similar reaction with participation of the dioxirane 1b, which is more reactive than 1a, occurs much faster.111 Oxidation of optically active (R)-(7)-2-phenylbutane 20 to (S)-(7)-2-phenylbutan-2-ol 21 by the dioxiranes 1a and 1b occurs with retention of the absolute configuration.39, 146 Me Me 1a or 1b (7) Et Et C Ph C Ph OH 21 H 20 In this reaction, too, methyl(trifluoromethyl)dioxirane 1b demonstrates obvious advantages over dimethyloxirane 1a.Thus when the dioxirane 1a is used, a 50% degree of conversion of the alkane 20 into the alcohol 21 requires a 10-fold excess of 1a, 2 days, and a temperature of 25 8C, whereas in the case of 1b, 100% conversion is attained with only a 2-fold increase of the oxidant and takes 1 h at a temperature of 24 8C.Dioxiranes have also been used successfully for the synthesis of hydroxy-derivatives of 2,3-dimethylbutane 22, cumene 23 (X=H) 121, 147, 148 and its derivatives and a series of other alkanes. Me Me Me OHMe 1b 3 min Me Me Me Me 22 Me Me 1a OH X H X 30 min, conversion 0.3% ± 15% Me Me 23 X=H, I, Me, OH, OMe, OPh, COMe. In all cases (except for norbornane), a tertiary C±H bond in the substrate is oxidised more efficiently than secondary C±H bonds.121 Non-activated primary and secondary C±H bonds in alkanes can also undergo selective oxidation, for example, in the presence of trifluoroacetic anhydride.149 Oxidation of cage compounds yields the corresponding alco- hols.37, 117, 121, 147, 150 ± 152 Thus oxidation of binor S by dimethyl- dioxirane 1a gave rise to mono- and dihydroxy-derivatives.OH HO OH 1a 1a (98%) or (1b : 24=1 : 1) adamantan-1-ol Oxidation of adamantane 24 by the dioxirane 1b gives predominantly, depending on the ratio of the reactants, either adamantane-1,3-diol (1b : 24=2 : 1).121 When 1b was taken in a larger excess, adaman- tane-1,3,5-triol and adamantane-1,3,5,7-tetraol were obtained. 263 OH OH excess 1b + HO OH OH HO HO 24 The dioxirane 1a has also been used to oxidise adaman- tane 37, 151 and its derivatives 147 and also 2,4-didehydroadaman- tane 25 152 to the corresponding alcohols; however, it is much less reactive than 1b. O 1a (2 equiv.) + OH conversion 82% (21%) 25 (29%) It is of interest that the dioxirane 1l is 4 times more reactive towards the oxidation of adamantane than 1a.117 The dioxiranes 1a and 1b have been used to synthesise 153 hydroxy- and polyhydroxy-derivatives of several centropolyin- dans [triptindan, 1,10-(o-phenylene)-2,20-spirobiindan, 10-methyl- tribenzoquinacene, fenestrindan, etc.].Thus oxidation of fenestrindan 26 by the dioxirane 1b in the CH2Cl2 ± CF3C(O)Me ± ButOH system affords, depending on the reaction conditions, either alcohol 27 or tetraol 28.153 a OH 16b 12b 4b 27 (>96%) OH 8b 26 b HO OH OH 28 (>56%) (a) 1.5 equiv. 1b, CH2Cl2: CF3C(O)Me : ButOH=9:1:1,710 8C, 25 min, conversion 56%; (b) 10 equiv.1b, CH2Cl2: CF3C(O)Me : ButOH=5 : 4 : 1,7108C, 25 min, conversion 97%. The alcohol 27 reacts with the dioxirane 1b (1.7 equiv. of 1b; CH2Cl2 : CF3C(O)Me = 9 : 1, 0 8C, 15 min, conversion 60%) to give a diol, 4b,8b-dihydroxyfenestrindan (yield >88%).38 Hydroxylation of several natural products,154 ± 158 for exam- ple, estrone acetate,156 by the dioxiranes 1a and 1b has been reported. O O 1a (2 equiv.) OH Me2CO, 20 8C, 22 h, conversion 93%AcO AcO (80%) The reactions of a *0.16 M solution of the dioxirane 1a in a CHCl3±Me2CO mixture with a number of 5b-H-cholic acids (lithocholic 29a, ursodeoxycholic 29b, chenodeoxycholic acid 29c, etc.) have been studied.157 In all cases, oxidation of the C±H bond in the 5b position occurred.However, whereas lithocholic acid 29a reacts relatively rapidly, the corresponding 5b-hydroxy-derivative being the only reaction product,157 the acids 29b and 29c, containing an electron-withdrawing acetoxy group at the C(7) atom, react slowly because the 5b position is264 deactivated and, apart from the 5b-hydroxy-derivative, the reac- tion gives, the 14a- and 17a-hydroxylation products.157 COOMe H 17 H 14 1a (2 equiv.) 1 5 23 7 6 4 CHCl3 : Me2CO (2 : 1), 20 8C, 24 h, conversion 35% ± 40% R MeCOO H 29a ± c COOMe H H MeCOO R OH R = H (a), b-OCOMe (b), a-OCOMe (c). Cholestane derivatives, for example, 5a-cholestan-3-one 30, 3b-acetoxy-5a-cholestane 31 and 3b-acetoxy-5a,6b-cholestane 32 are also oxidised by dioxiranes at the C(25) position to give the corresponding alcohols.158 H 25 H 1a or 1b H Y X 30 ± 32 X H H OH H Y X (80%) X 30: Y = O, X = H; 31: Y = b-OAc, H, X=H; 32: Y = b-OAc, H, X=Br.The rate of oxidation ofC±Hbonds by dioxiranes can depend on `external' factors. Whereas oxidation of 1,3-dicarbonyl com- pounds by even a substantial excess of the dioxirane 1a requires about three days,159 the same reaction carried out in the presence of Ni(II) salts as the catalyst occurs markedly faster, the reaction time being reduced to several hours.160 O O 1a (1 ± 2 equiv.) R3 R1 Ni(II), Me2CO±H2O, 20 8C R1 R2 This reaction is one of the few examples of `external' interfer- ence in the course of oxidative reactions involving isolated dioxiranes.Previously, acid catalysis has been used 161 to accom- plish selective oxidation of methoxybenzenes by the dioxirane 1a to the corresponding p-benzoquinones. In some cases, the alcohols formed from alkanes are oxidised by excess dioxirane to give the corresponding ketones.121 Several secondary alcohols have been oxidised 162 to the corresponding ketones (yields 92%± 99%) by the dioxirane 1b (oxidation of secondary alcohols proceeds more smoothly and requires less time than the oxidation of primary alcohols). A remarkable selectivity was found in the reaction of the dioxirane 1b with 2-norborneol: O O R3 OH R2 V P Kazakov, A I Voloshin, D V Kazakov the endo-isomer was found to be 40 times more reactive than the exo-isomer.162 Oxidation of chiral a-epoxy alcohols 33 by dioxir- anes does not affect the oxirane groups and occurs with retention of the configuration of the asymmetric centre adjacent to the hydroxy group.162 O O * 1b * Et Et H H * CH2Cl2±CF3C(O)Me (7 : 3 or 1 : 1), ±20 8C, 15 min, conversion 96% (94%) O OH 33 On treatment with dimethyldioxirane 1a, several para-sub- stituted a-methylbenzyl alcohols have been converted into the corresponding acetophenones in good yields.163 1a X CH CH3 20 8C, 3 h OH C X C CH2OH CH3+ X O O (2% ± 3%) (97%) X=H, F, Cl, Br, Me, OMe, CN.Oxidation of simple phenols by dioxiranes affords complex mixtures of products;164 the best results were obtained in the reactions of dioxiranes with substituted phenols and cate- chol.164, 165 OH O But But O 1a (4 equiv.) (55%) But But O OH 1b (2.2 equiv.) OH O OH Me2CO±CF3C(O)Me (1 : 1), ±20 8C, 60 min, conversion 80% (88%) OH Aliphatic diols (including optically active ones) react with the dioxiranes 1a and 1b to give a-hydroxy ketones.166, 167 It is noteworthy that oxidation of (+)-pinane-2,3-diol to (7)-2- hydroxypinan-3-one occurs with virtually complete retention of the configuration (the optical yield of the ketone is >97%).166 OH OHOH O 1a H CH2Cl2±Me2CO (7 : 3), 0 8C, 4 h, conversion >96% (98%) Oxidation of non-symmetrical 1,2-diols results in their com- plete conversion to the corresponding mono- and dioxo deriva- tives (regioselectivity of the process depends considerably on the nature of the substituents).168 HO O O HO O OH O OH1a + + *20 8C R R R R R=H, p-OMe, o-OH, o-NO2, p-NO2.Optically active O-isopropylidene derivatives of 1,2-diols are converted into 2-hydroxy ketones, formed in high optical yields and with retention of the optical purity.169Dioxiranes: from oxidative transformations to chemiluminescence R3 H * * R3 O 1a or 1b * * R2(H) R1 O O R2(H) R1 OH Depending on the reaction conditions and the nature of the substrate, oxidation of allylic alcohols by dioxirane 1a occurs as either epoxidation of the double bond 106, 107 or competing oxida- tion of the hydroxy group to an oxo group.170 In the oxidation of unsaturated nitro alcohols 34, the double bond remains intact because it is deactivated by the NO2 group.171 O OH 1a *20 8C, 12 h NO2 NO2 34 The deactivation effect is also manifested in the oxidation of nitro diols: the hydroxy group remote from NO2 is oxidised, whereas theOHgroup occurring in the a- or b-position to theNO2 group remains intact.171 When dioxiranes are made to react with allyl hydroperoxides, the corresponding epoxy hydroperoxides are formed.172 Oxidation of aliphatic esters with the dioxirane 1b affords oxo and hydroxy derivatives.173 Acetals and cyclic and acyclic ethers are also oxidised by dioxiranes to give the corresponding carbonyl compounds,174 whereas aldehydes are converted into the corre- sponding carboxylic acids;1 oxidation of substituted benzalde- hydes by the dioxirane 1a follows a radical mechanism.119 Ethylene ketals undergo oxidative cleavage.174 O 1a or 1b O 0 8C, 24 or 2 h O (95%) The reaction of diphenylmethane with dimethyldioxirane affords Ph2CO (92%). In this case, the methylene carbon atom, which is absolutely inert under other circumstances, can be oxidised because the CH2 unit is activated by the two phenyl groups.175 Phenylcyclopropanes and halophenyl-substituted cyclopropanes do not react with the dioxirane 1a,176 whereas bicyclo[4.1.0]heptane and exo-9-bromobicyclo[6.1.0]nonane are converted into the corresponding ketones.176 Dioxiranes have also been used to oxidise vegetable oil components,177 caffeine and purine nucleosides.178 At present, two possible mechanisms for the reaction of dioxiranes with alkanes are being discussed in the literature, namely, insertion of an oxygen atom into the C±H bond of the substrate (by analogy with the oxenoid mechanism, proposed previously for the oxidation by ozone 179) [reaction (8)] and a free- radical mechanism [reaction (9)].= d R O d Me O O O RH H (8) C ROH+ C C O Me Me Me Me Me A Me O Me O Me O RH C C C HO O Me R O Me Me (9) O Me RO a C C ROH+ Me HO Me Me b exit from the cage with initiation of a radical chain process 265 In the former case, oxidation of the substrate by a dioxirane passes through the formation of transition state A [reaction (8)], while in the latter case, dioxirane first undergoes homolytic cleavage at the O7O bond, the dioxirane biradical abstracts an H atom from the substrate and then the radicals either undergo intracage recombination [reaction (9), pathway (a)] to give the oxidation products or leave the cage and initiate a radical chain process [reaction (9), pathway (b)], or both pathways occur in parallel. The main argument favouring the former mechanism is the high selectivity of a large number of reactions of oxidation of saturated hydrocarbons by dioxiranes, which could hardly be expected in the case of a radical chain mechanism.The selectivity of the reactions of the dioxiranes 1a and 1b with cis- and trans-1,2- dimethylcyclohexanes,111, 145 2-norborneols 162 and with the para- substituted isopropylbenzenes 23 121, 145, 147, 148 have already been noted above.The oxidation of 3-methyltetrahydropyran is equally selective:174 an oxygen molecule is inserted exclusively at the two a-positions, whereas in the case of a radical mechanism, the b-positions of the substrate would also undergo oxidation. Oxidation of R-(7)-2-phenylbutane 20 occurs with retention of the configuration [reaction (7)], whereas in the case of a radical chain process, at least partial racemisation would be observed. The relatively large negative values of activation entropy 146 (Table 3) provide more evidence for the formation of an ordered transition state of type A [reaction (8)]. Table 3. Rate constants (k2 /litre mol71 s71) and activation parameters for the oxidation (Ea /kcal mol71; DS= /cal mol71K71; DG= /kcal mol71) of 2-phenylbutane with the dioxirane 1b.146 Solvent logA DG= DS=a T/ 8C k26102 Ea a 9.70.2 6.60.2 7302 17.4 2.83 7.34 15.10 11.30.2 7.40.2 7262 17.9 0.55 2.58 5.82 CH2Cl2 715.0 0.0 9.9 CF3C(O)Me 719.8 0.0 9.7 a Found from the plot for log k2 vs 1/T (in K).The formation of transition stateAis supported by the data 180 on the reaction of dimethyldioxirane 1a with cis-1,2-dimethylcyc- lohexane in various solvents (Table 4). The reaction is facilitated by proton-donating solvents, which stabilise the spiro transition state. H Solv Me O O . Me H Me Me H Table 4. Second-order rate constants for the reaction of dimethyldioxirane (1Â) with cis-1,2-dimethylcyclohexane.180 Solvent k26103/ litre mol71 s71 Relative reactivity 1.370.03 1.290.01 1.020.02 3.080.06 1.00 0.94 0.74 2.25 3.24 2.96 MeC(O)Me MeC(O)Et MeC(O)OEt CH2Cl2 CHCl3 CDCl3 4.440.13 4.050.04 Note.The reaction was carried out in a solvent ± acetone mixture (1 : 1) at 0 8C.266 Kinetic data provide additional evidence supporting the `insertion' mechanism; reactions described in numerous stud- ies 8, 37 ± 39, 121, 145 ± 147, 151, 162, 180 obey second-order kinetics (first- order kinetics with respect to each reactant). The fairly moderate primary kinetic isotope effect observed in the oxidation of cyclo- hexane-d12 (kH/kD&2) 121 also points to a molecular mechanism of the reaction.In those cases where the reaction rate is limited by radical abstraction of a hydrogen atom from an sp3-hybridised carbon atom, the primary isotope effect increases substantially and can be greater than 10.181, 182 Comparison of the relative reactivity of the dioxiranes 1a and 1b with respect to cumene and ethylbenzene 121, 145 with the reactivity of the ButO. radical showed that dioxiranes are more selective; this also provides evidence for reaction (8). Finally, the mechanism of insertion is in good agreement with the results of theoretical calculations.183 Despite all the above facts, which attest to the insertion mechanism, the radical reaction mechanism [reaction (9)] has been still considered in a number of recent publica- tions.34 ± 36, 184 ± 190 An early publication that considered the radi- cal character of the interaction of the dioxirane 1a with alkanes and appeared in 1989 119 dealt with the influence of O2 on the products formed upon oxidation by dimethyldioxirane 1a of a series of substituted benzaldehydes. The radical mechanism has been considered as a possible mechanism of oxidation of para- substituted a-methylbenzyl alcohols.163 Later, the Minisci's research group 34 has obtained data on the strong influence of oxygen and inhibitors on the rate and the products of oxidation of a number of alkanes by the dioxirane 1a.Thus it was found that the degree of conversion of alkanes in oxygen-free systems is much lower than that attained under ambient conditions, the corresponding alkyl acetates being formed as the major reaction products.Meanwhile, in the presence of O2, the formation of acetates is largely suppressed. Trapping by TEMPOmade it possible to detect the corresponding adducts with alkyl radicals. However, it was noted that TEMPO could induce decomposition of the dioxirane. This assumption has later been confirmed in another study.124 When the reaction of the dioxirane 1a with cyclohexane and adamantane was carried out in the presence of chinaldine, adducts of the trap with alkyl radicals were isolated.184 The reactions of alkanes and adamantane with the dioxirane 1a in the presence of CBrCl3 resulted in a set of halo-containing products, their ratio being dependent on the 1a : CBrCl3 ratio.35 These and other experimental facts led Minisci et al 34, 35, 184 ± 186 to the conclusion that in the presence of alkanes, the compound 1a undergoes radical chain decomposition induced by the alkyl radicals that have left the cage according to pathway b [reaction (9)].The radical chain model has later been extended to reactions of dimethyldioxirane 1a with esters and aldehydes.184 The high selectivity of the oxidation of alkanes by dioxiranes was attributed to the unusual selectivity of the dioxirane biradical, compared with other alkoxy radicals; this biradical can selectively abstract an H atom from the substrate, which leads subsequently to the formation of the reaction products [reaction (9), pathway a]. Meanwhile, oxygen present in the system reacts with the radicals having left the cage [reaction (9), pathway b] and thus prevents the development of a radical chain process.34 Analysis of the kinetic features of the oxidation of cumene by dimethyldioxirane 1a and the products and the thermochemistry of the process also attest in favour of the radical character of the reaction.36 An indirect proof of the formation of radicals is the slight chemiluminescence (obviously, caused by recombination of peroxyl radicals 191) in the visible region of the spectrum, which accompanies the reaction in question when it is carried out in the presence of oxygen.187 According to the radical mechanism being discussed, chain decomposition of the dioxirane 1a (in the absence ofO2) is responsible for its `idle' consumption; therefore, the yields of the products of oxidation of cumene based on the converted dioxirane are relatively low.36 A radical mechanism has also been V P Kazakov, A I Voloshin, D V Kazakov proposed for reactions of the dioxirane 1a with isopentane 189 and adamantane.190 However, it can be easily seen that a radical chain mechanism for the reactions of dioxiranes with saturated hydrocarbons is at variance with the kinetic curves and with the high selectivity of oxidation reactions, which can be perfectly explained in terms of the insertion mechanism [reaction (8)]. These contradictions were partially eliminated in the study by Curci et al.,37 which dealt with the oxidation of adamantane 24 by the dioxirane 1a under various conditions.When the 1a : 24 molar ratio was *1 : 1.2, the oxidation gave an alcohol, 1-AdOH (91.5%), and a diol, 1,3- Ad(OH)2 (4.5%). However, the reaction in the presence of CCl3Br (i.e., under the conditions used in the above-mentioned study by Minisci et al.35) was appreciably less selective and yielded a series of side products: 1-AdBr (42.3%), 1-AdCl (9.2%), 2-AdBr (10.5%), 2-AdCl (2.5%), 2-AdOH (2.0%), adamantanone (<0.5%), etc.37 The reaction kinetics, which corresponded to the simple second order without CCl3Br (both in air and under an atmosphere of N2), became more complex in the presence of this additive. It was also found that the addition of CCl3Br induces rapid radical decomposition of the dioxirane 1a.37 Curci, Adam, et al.37 ± 39 suggested that, when there are no factors able to induce decomposition of dioxirane (various admixtures, for example, metal ions, irradiation with light, etc.) and when there is no O2, the radical chain mechanism is not involved in the oxidation of alkanes.The influence of drying agents (e.g., MgSO4) and impurities introduced together with drying agents can also be regarded as destabilising factors of this type. Other factors that should also be taken into account include temperature (it is reasonable to expect that at higher temperatures, the proportion of radical processes would increase and thus the process selectivity would decrease) and the nature of the substrate being oxidised (structural features, C7H bond strength, etc.). An interesting view on the mechanism of reactions of dioxir- anes with saturated hydrocarbons has been expressed by Asensio et al.192Athorough study of the primary kinetic isotope effect and the products of the reaction of the dioxirane 1a with cyclohexane and methylcyclohexane at various reaction conditions, both in solution (0 8C, Ar atmosphere) and in the gas phase (25 8C) showed that the radical chain process actually does contribute to the oxidation of cyclohexane and methylcyclohexane under experimental conditions but the major reaction products � cyclohexanone (in the case of cyclohexane) and the corresponding alcohol (in the case of methylcyclohexane) � are formed by the insertion mechanism.192 The researchers suggested that the for- mation of free radicals can be due to a change in the electronic configuration of dioxirane [namely, transition into the triplet (p, p*)3 state with the properties of a biradical] induced by interaction with an alkane.Depending on the energy and the route of this interaction, the process follows either a radical chain mechanism (b-cleavage of the biradical to give methyl radicals) or an insertion mechanism [reaction (8)].192 2. Oxidation of unsaturated compounds Epoxidation of compounds containing double bonds is the best studied oxidative reaction of dioxiranes, which is often used for synthetic purposes. O O O C + + O These reactions usually proceed at high rates, give products in good yields and are stereospecific.Yet another advantage of these reactions is that the possibility of conducting them under mild conditions (low temperatures, neutral medium) is combined with the possibility of isolating unstable epoxides; this can be seen taking the synthesis of pH-sensitive oxaspiropentanes from the corresponding methylenecyclopropanes as an example.193 Dioxir- anes efficiently epoxidise alkenes containing electron-donatingDioxiranes: from oxidative transformations to chemiluminescence substituents,104, 107, 194 ¡À 196 which obviously makes them better epoxidising agents compared to other peroxides because dioxir- anes are more reactive; this allows the synthesis of relatively labile epoxides. The fact that dioxiranes are able to oxidise electron- unsaturated alkenes is equally significant.103, 104, 197 ¡À 199 Although these reactions are usually rather slow, the use of excess dioxirane makes it possible to attain high yields of epoxides.Epoxidation can be carried out both using isolated dioxiranes and in situ.103, 104, 106 107, 200 ¡À 205 In the latter case, the pH of the medium should be strictly controlled (7.3 ¡À 7.5). The procedures using isolated dioxiranes are not faced with this problem. In some cases, phase transfer catalysts are used (for example, for water- insoluble substrates). In this respect, the in situ procedure with the use of Caro's acid derivatives (peroxomonosulfates) seems quite promising.206 In this procedure, dioxiranes are generated in a homogeneous organic medium, which substantially facilitates the oxidation.An advantage of the in situ method is that ketone is virtually not consumed in the reaction (only the oxone is con- sumed) and can be quantitatively recovered after its completion. The in situ reactions in which the corresponding optically active ketones are used as the precursors of dioxiranes present considerable interest.107, 203 ¡À 205 Thus the use of (+)-3-(trifluor- oacetyl)camphor or R-(+)- and S-(7)-4,4,4-trifluoro-3- methoxy-3-phenylbutan-2-one as the initial ketones allowed asymmetric epoxidation of prochiral alkenes (trans-b-methylstyr- ene, trans-oct-2-ene, cis-2-methyloctadec-7-ene) with optical yields of 12% ¡À 20%.203 Enantioselective epoxidation of trans- stilbene and its 4,40-dialkyl-substituted homologues catalysed by chiral ketones in the presence of oxone (2KHSO5 .KHSO4 .K2SO4) at *20 8C affords the corresponding epoxides (yields 90%¡À 95%) with 75%¡À 93% enantiomeric purity.204 Regarding the in situ oxidation, it is noteworthy that, based on the experiments with 18O isotope labelling, it has been suggested that the dioxirane intermediate is not responsible for the in situ epoxidation of alkenes.207 Thus in the epoxidation of cyclohexene, it is not dioxirane that acts as the main oxidation agent but rather the product of addition of the HOOSO¡¦3 anion to the carbonyl group of the transferring ketoneDcompound 35 (corresponding to intermediate A in Scheme 2).207 18OH 2KHSO5 .KHSO4 .K2SO4 18 SO¡¦3But But O O O 35 35 O The reactions of dioxiranes (both in situ and in a pure state) with cis- and trans-alkenes are stereoselective: cis- and trans- alkenes are converted into cis- and trans-epoxides, respectively (the cis-compounds are more reactive).103, 104, 107, 195, 196, 208 Treatment of strained polycyclic alkenes with the dioxirane 1a resulted in the synthesis of the corresponding epoxides.209 Me H Me O 1a Me Me Me 720 8C, 10 h Me Me e M e M Oxidation of hexamethylbenzene by the dioxirane 1a gives hexamethylbenzene polyoxides via the intermediate formation of 2,3,4,5,6,7-hexamethyloxepine.210 Me Me Me Me Me Me 1a O Me Me Me Me Me Me 267 Me Me O Me Me Me Me 1a O O O Me Me Me Me O Me Me (51%) exo,exo,exo-3,6,9-Tris(4-methylphenylsulfonyloxymethyl)- cis,cis-cyclonona-1,4,7-triene reacts with this dioxirane in a sim- ilar way.211 The dioxirane 1a oxidises allenes and their derivatives (allene alcohols and acids) to give the corresponding dioxides.212 ¡À 216 O 1a C C Me2CO, K2CO3 O On treatment with the dioxirane 1a, (E)- and (Z)-arylidenein- dolones give the corresponding spiro epoxides in 70% ¡À90% yields (the process is fully diastereoselective).217 The reactions of 6,6-disubstituted pentafulvenes, containing conjugated double bonds with different reactivities, with an excess of the dioxirane 1a afford endocyclic diepoxides in good yields.When the reactants are taken in stoichiometric amounts, a mixture of mono- and diepoxides is formed 218 (the exocyclic double bond remains intact, pointing to an electrophilic nature of 1a in the oxidation).O O O 1a + + O R2 R2 R1 R2 R1 R1 R2 R1 Dioxiranes are able to oxidise allyl alcohols,106 alkenyl hydro- peroxides,172 vinylsilanes 219 and unsaturated ketones, acids and esters 220, 221 to give the corresponding epoxy derivatives in good yields. Oxidation of 4-dioxenylcyclohexanone gives rise to epoxide 36.222 O O O O O O O 36 Oxidation of silyl ethers of enols by peroxides, resulting in the formation of a-hydroxy ketones, has been suggested to occur via intermediate epoxide.223 This type of epoxide also proved to be produced from silyl ether, phosphates and esters of enols as well as from g,d-unsaturated 5- and 6-membered lactones on treatment with the dioxirane 1a.These compounds can be isolated in a pure state.224 OSiMe3 OSiMe3 1a O CH2Cl2¡ÀMe2CO, N2,740 8C, 4 h High yields (92% ¡À 97%) of spiro oxiranes have also been detected in the oxidation of enol ethers, for example alkoxy(ar- yl)methylideneadamantanes and methoxy(2-naphthyl)-methyli- dene-2-bornane by the dioxirane 1b.225 Note for comparison that synthesis of epoxy esters and strained oxaspiroalkanes involving peroxy acids often does not lead to acceptable results, because the oxiranes formed in the reaction rearrange in the presence of acids to give a-alkoxy or a-hydroxy ketones. The ability of the dioxiranes 1a and 1b to epoxidise electron- unsaturated alkenes can be illustrated by the oxidation of 4-sub- stituted (E)-ethyl cinnamates by the dioxirane 1a.198 Enol ethers of268 b-diketone, which are relatively inert, can also be quantitatively epoxidised by the dioxirane 1a.199 O O R1 R1 1a O Me Me OR2 OR2 Me Me R1=H, Me; R2=Et, Bu, Ph.The corresponding epoxides are also formed in the oxidation of enol phosphates,226 g-methylene-g-butyrolactones 227 and acyl- and allylferrocenes.228 Epoxidation of primary and secondary alkenylammonium salts by the dioxiranes 1a and 1b gives rise to epoxy derivatives; on treatment with sodium carbonate, they are readily converted into epoxyalkylamines, formed in good ds.229 The epoxidation rate is lower than that in the case of epoxidation of simple alkenes because the double bonds are deactivated due to the ammonium groups. Adam et al.230 were able to detect the low-temperature NMR signals of epoxides of cis- and trans-(2-methyloxiranyl)benz- amide, which result from oxidation of (E)- and (Z)-N-propenyl- benzamides by the dioxirane 1a.Examples of catalytic epoxidation of alkenes by dioxiranes have been reported in several studies.231 ± 233 Thus epoxidation of 2,2-dimethyl-2H-chromenes by the dioxirane 1a in the presence of chiral Mn(III)(salen) complexes (Jacobsen catalysts) occurs enan- tioselectively. Selective synthesis of epoxides of uracil derivatives (important intermediates in oxidative transformations of DNA) catalysed by metal porphyrins has been described.233 (The attempt to prepare uracil epoxides without a catalyst using the dioxirane 1a as the oxidant was less successful; the yields of the correspond- ing epoxides were low and side products formed 234).The reaction was carried out in CH2Cl2 ±MeCN (1 : 1) at 20 8C in the presence of imidazole. O O Me Me R2 R2 N N O 1a metal porphyrin, CH2Cl2 ±MeCN (1 : 1), 20 8C N N O O R1 R1 Me Me Other dioxiranes also possess high oxidative poten- tials.1, 81, 82, 117, 235 Thus ethylmethyldioxirane 1m has been used to epoxidise natural triglycerides in the butan-2-one ± water two- phase system in the presence of the 18-crown-6 ether,235 while difluorodioxirane 1k has been employed to epoxidise fluorinated alkenes CF3CF=CF2 and F2C=CFCl (the yields of epoxides are >95%).82 Special mention should be made of those studies that are valuable not only for synthetic purposes but also from the medical or biological viewpoint.For example, this is true for several works 236 ± 245 dealing with epoxidation of furans by dioxiranes. Benzofurans are known to be toxic for animals and humans. Their toxicity may be due to the presence of labile epoxides, resulting from oxidation of the furan ring.236, 246, 247 However, benzofuran epoxides had not been detected even at low temperatures. This became possible only using the dioxirane 1a.236 ± 243 This reagent was employed to prepare epoxides of substituted benzofurans, occurring in equilibrium with the corresponding quinoneme- thides.R3 1a R1 R2 770 to720 8C, 1 ± 14 h O V P Kazakov, A I Voloshin, D V Kazakov R3 R3 O O R1 R1 R2 O O R2 R1=H, Me, OMe, Cl, MeCO; R2=H, Me, CH2OH, CH(OMe)Ph, CO2Et; R3=H, Me, But, C6H3R4R5-3,4 (R4=H, NO2; R5=H, MeO). Using the dioxirane 1a, regio- and stereoselective oxidation of the C(3)=C(4) enol bonds in the molecules of biologically active triterpenes containing a norquinonemethide fragment (e.g., pris- timerin, tingenone) was attained.248 Oxidation of steroids, flavones and chalcones by dioxiranes is equally important.249 ± 257 Chalcone epoxides are significant build- ing blocks in organic synthesis; they play an important role in the biosynthesis of many flavonoid systems. Oxidation of hydrox- ychalcones by the dioxirane 1a resulted in the formation of epoxide products, unstable in acidic or alkaline media, in high yields.249 R4 R3 R5 1a OH R1 CH2Cl2±Me2CO, N2, 75 to 20 8C, 30 ± 62 h R2 O R4 R3 R5 R1 OH O R2 O (99% ± 100%) R5 R4 R3 R2 R1 HH MeO H HH HMeH Cl H H H H H H H Cl H H MeO H H HH H Me H H MeO H Cl H H MeO Epoxidation reaction has been successfully used to prepare the 8,9-epoxide of the aflatoxin B1, noted for its carcinogenic proper- ties.258 O O O O H O O O H H H 1a O O CH2Cl2, 20 8C, 15 min O O H H The reactions of the dioxiranes 1a and 1b with vitamin D3 and its 3-O-acylated derivatives were reported to be highly selective.259 The reaction of 3b-acetyl- (37) and 3b-(p-bromobenzoyl)-deriva- tives (38) of vitaminD3 with methyl(trifluoromethyl)dioxirane 1b gives rise to the corresponding (R,R,R)-triepoxides. On treatment with the same dioxirane, vitamin D2 and its 3b- O-acetyl-derivative are converted into the corresponding (R,R,R,R)-tetraepoxides.260Dioxiranes: from oxidative transformations to chemiluminescence Me Me Me Me Pri Pri O H H H 1b (3.2 equiv.) H H O H CH2Cl2±CF3C(O)Me (9 : 1), 740 8C, 1 h, conversion >95% O RO RO 37, 38 (83% ± 85%) R=Ac (37), p-BrC6H4CO (38).Mention should be made of interesting studies 261, 262 in which dioxiranes have been used to synthesise epoxy-derivatives of insect juvenile hormones, which play an important role in the growth and development of insects.An example of epoxidation of a compound containing a CF3 group at a double-bond carbon atom has been reported.262 O CF3 1b (0 8C, 30 min) or 1a (0 8C, 16 days) O O CF3 O O (93%) Epoxidation of aminoalkenes is used to prepare indole alka- loids. However, epoxidation of this type of substrates by tradi- tional reagents is hampered by the predominant oxidation of the nitrogen atom. Only recently,263 were epoxides of several tertiary amines containing alkenyl groups synthesised chemoselectively using dioxiranes in the presence of BF3 . Et2O. (CH2)n (CH2)n 1b or 1a N BF3 N CH2Cl2±Me2CO, 0 8C O(70% ± 97%) The reactions of dioxiranes with alkenes (Table 5) is described by a second-order equation 39, 116, 195, 196, 198, 264, 265 (cis-isomers react approximately 10 times faster than trans-isomers). Based on experimental data, a reaction mechanism has been pro- posed,196 which includes a stage of formation of a spiro-type concerted transition state (Y).= Me O O O C + Me O CMe Me Y (10) O O C +Me Me This mechanism is in good agreement with the results obtained by Murray and Gu264 concerning the influence of solvents on the rates of epoxidation of trans-ethyl cinnamate and cyclohexene; analysis of the kinetic data in terms of the Kamlet ± Taft equation, which takes account of the ability of a solvent to act as a hydrogen bond donor (HBD) or acceptor (HBA), showed that HBD solvents increase the rate of epoxidation, whereas HBA solvents retard this process.264 Transition state Y0, which is similar to Y but takes into account the solvent effect on the reaction rate, explains well the characteristic features observed.Table 5. Second-order rate constants for epoxidation of di- and mono- substituted alkenes by the dioxirane 1 in dry acetone (according to Ref. 195). Alkene cis-Hex-3-ene trans-Hex-3-ene cis-4,4-Dimethylpent-2-ene trans-4,4-Dimethylpent-2-ene cis-2,5-Dimethylhex-3-ene trans-2,5-Dimethylhex-3-ene trans-2,2,5,5-Tetramethylhex-3-ene Cyclohexene cis-1-Phenylpropene trans-1-Phenylpropene cis-Stilbene trans-Stilbene Indene 4-Methoxystyrene 4-Methylstyrene Styrene 4-Bromostyrene 3-Nitrostyrene 3,3-Dimethylbut-1-ene 3-Methylbut-1-en-3-ol d+ Solv H O Me Me Od7 Y0 In fact, HBD solvents (MeOH, CDCl3, AcOH) stabilise the negative charge on the oxygen atom involved in H-bonding with a solvent molecule and thus facilitate epoxidation.Conversely, HBA solvents destabilise the transition state, which decelerates the reaction. This assumption accounts for the fact that addition of water (which can be regarded as an HBD solvent) increases the epoxidation rate.195 The relatively large negative values of the entropy factor DS= also support the assumed formation of an ordered spiro transition state.264 The data obtained by Messeguer et al.,116 who studied the influence of solvents on the epoxidation of cis-stilbene by more concentrated solutions of the dioxirane 1a (see Section II), are in good agreement with the results of Murray and Gu264 with the only difference that in the former case,116 the effect was more pronounced due to the use of acetone-free solutions of 1a.The solvent effect, like the influence of substituents, is manifested not only as a change in the reaction rate but also as a change in the diastereoselectivity and regioselectivity of epoxida- tion.266 ± 268 It was shown 266, 267 that diastereoselectivity of epox- idation of substituted cyclohexenes by the dioxirane 1a is determined by the substrate structure and the solvent, which includes steric effects, dipole ± dipole interactions, effects of hydrogen bonding and other factors. A similar solvent effect is involved in the epoxidation of acyclic allyl alcohols,268 in partic- ular, geraniol 39.OH 1a *20 8C, 1 ± 3 h O 39 269 Relative reactivity k26102/ litre mol71 s71 473 5.70:4 332 2.30.1 392 21 0.0240.004 482 182 292 4.00.1 4.30.2 221 573 251 131 8.90.3 8.3 1.0 5.8 0.4 6.8 0.4 0.004 8.4 3.2 5.1 0.70 0.75 3.9 10.0 4.4 2.3 1.6 0.53 0.58 0.28 3.00.3 3.30.1 1.60.2 OH OH OH O O + + O270 In a polar medium, MeOH±Me2CO (9 : 1), the ratio of the 6,7- and 3,2-monoepoxides is 88 : 12, whereas in a less polar system, CCl4±Me2CO (9 : 1), it is equal to 51 : 49.268 In fact, the D6 double bond in the alcohol 39 is more nucleophilic than the D2 bond, deactivated by the OH group; hence, it is the D6 bond that will be attacked predominantly by dioxirane.Methanol stabilises the transition state due to the formation of a hydrogen bond, so that the contribution of the geraniolOH group to the stabilisation of the transition state is minimised.268 Conversely, in non-polar CCl4, the external stabilisation is much less pronounced and the transition state is largely stabilised by the OH group belonging to the alcohol 39 molecule, resulting in a higher yield of the 2,3- epoxides.268 An interesting situation is observed when 4,4-dimethyl-2,3- dihydro-g-pyran 40 is oxidised by the dioxirane 1a.269 H b H Me O C + O Me O O a H O H 40 Measurements of the secondary kinetic isotope effect showed that in the transition state en route to the epoxide, the degree of rehybridisation of the b-carbon atom is higher than that of Ca.Hence, this reaction does not proceed via a symmetrical transition state but occurs as a non-synchronous concerted process.269 This result cannot be extended to simple alkenes in which the electron densities at the Ca and Cb atoms are identical. In fact, the experimental values for the a- and b-isotope effects found for the reactions of 1a with 3-methyl-1-phenylbut-2-ene and 2,2,7,7- tetramethyl-cis-oct-4-ene and their deuterated analogues support the formation of a concerted transition state of the spiro type.270 Study of the epoxidation kinetics also confirms the electro- philic mechanism of the reaction: Hammett correlations for a series of substituted styrenes 195 and 4-substituted (E)-ethyl cin- namates 198 give the values r+=70.9 and 71.153, respectively. Study of the kinetics of epoxidation of chalcones (anhydrous acetone, 30 8C) showed that electron-donating substituents at 4 and 40-positions accelerate the reaction (for 4- and 40-substituted chalcones, r+=71.03 and70.182, respectively).265 As noted above, experimental results point to a molecular mechanism of the epoxidation of alkenes by dioxiranes [reaction (10)]. However, arguments for a free radical mechanism of epoxidation have also been reported.185 Thus the oxidation of a-methylstyrene by the dioxirane 1a, in addition to the epoxide (35%) and a-phenylpropionaldehyde (51%), resulting from its rearrangement, gave the allyl alcohol PhC(CH2OH)=CH2 (6%) and the corresponding aldehyde PhC(CHO)=CH2 (5%).It was suggested 185 that alkenes can induce homolysis of dimethyldiox- irane 1a and the formation of epoxides can be explained in terms of a radical mechanism. C Ph O Me Me O CH2 Ph C C C CH2 + Me Me O Me O Me Ph O O + C Me Me Me These data, which contradict the molecular mechanism of the reaction, have been specially considered in the study by Adam, Curci, et al.39 The results obtained by these researchers 39 indi- cated that the reactions of alkenes with dioxiranes involve no radical processes. In particular, the reaction of the dioxirane 1a with a-methylstyrene obeys second-order kinetics both under ordinary conditions and under an inert atmosphere (N2), the corresponding epoxide being the only reaction product (neither allyl alcohol nor the aldehyde were detected even under conditions most favourable for radical chain processes, viz., in the presence of V P Kazakov, A I Voloshin, D V Kazakov CBrCl3 at 56 8C).Investigation of epoxidation of trans-cyclo- octene and 2-vinylcyclopropane also supported the hypothesis that no radical chain processes are involved.39 These examples indicate once again that, in all probability, in the absence of factors that could induce a radical chain process, oxidation of alkanes and alkenes by dioxiranes does not include radical pathways of transformation.37 ± 39 3. Oxidation of polyaromatic hydrocarbons Study of the chemical transformations of PAH on treatment with dioxiranes is an exceptionally important problem, if for no other reason than that many PAH are hazardous carcinogens.The mutagenic and carcinogenic action of PAH is preceded by a metabolic activation process,271 comprising a complex sequence of oxidative transformations, unstable arene oxides being the most significant intermediates in these processes. These important intermediates are prepared in most cases using multistage synthe- ses. The use of direct oxidation by classical reagents (peroxy acids, hypochlorites, etc.) is often restricted because many arene oxides are sensitive to acids, water or nucleophiles. Dioxiranes are convenient reagents for oxidative functionali- sation of PAH.1, 3, 40, 47 ± 47, 272, 273 Thus the reactions of the dioxir- anes 1a and 1b with phenanthrene in solution afford the corresponding oxide in 83% and 96% yields, respectively.1, 272 O 1b (720 8C, 8 min) or 1a (26 8C) Another typical example is the reaction of the dioxirane 1b with naphthalene, which gives anti-1,2:3,4-dioxide.272 O 1b O (98%) However, the reaction with pyrene 41 occurs less effec- tively.272 O 1b (11) (10%) 41 Among the products of reaction (11), CF3COOMe (a product of decomposition of the dioxirane 1b, see Section III) was also detected, and the EPR spectrum of the system (730 8C) con- tained a signal for the pyrene radical cation.272 It was suggested 272 that the low yield of the oxidation products is due to the competing electron transfer reaction, giving rise to CF3COOMe.reverse electron transfer electron transfer O O F3C F3C C C +41 41+ Me O7 Me O (12) O O F3C OMe+41 C F3C 41 C O Me An essentially similar mechanism has been proposed to interpret the chemiluminescence of dioxiranes in the presence of some activating agents, which is discussed in detail in Section V.Dioxiranes: from oxidative transformations to chemiluminescence In view of the formation of dioxiranes in gas-phase ozonisa- tion of unsaturated hydrocarbons,41 ± 44 the relatively high con- centrations of O3, alkenes and PAH in the atmosphere and the carcinogenic properties of PAH, Murray et al.1 ,3, 40, 46 suggested that reactions of dioxiranes withPAHmight be responsible for the formation of carcinogenic compounds in the atmosphere.To verify this hypothesis, gas-phase oxidation of PAH under con- ditions close to the atmospheric conditions was carried out.3, 46, 47 A gas stream of the dioxirane 1a in acetone or aMe2CO±CH2Cl2 mixture was directed at PAH supported on silica gel. Although in most cases, the yield of the resulting oxides was lower than that in the case of liquid-phase oxidation, this experiment demonstrated that dioxiranes can be involved in possible atmospheric reactions with PAH. Moreover, when PAH deposited on silica gel were oxidised by the O3±Me2C=CMe2 gas mixture,47 the reaction gave products similar to those obtained when the dioxirane 1a is used as the oxidant (ordinary ozonolysis does not yield this type of products under these conditions).4. Oxidation of compounds containing heteroatoms a. Nitrogen-containing compounds Oxidation of primary amines by dimethyldioxirane 1a occurs rapidly (taking from several minutes to several hours) and affords the corresponding nitro compounds.274, 275 1a RNO2 RNH2 Polyamines are also converted into nitro compounds. Thus 1,4-diaminocubane reacts with 1a to give 1,4-dinitrocubane.275 NO2 NH2 excess 1a *20 8C (80%) O2N H2N The latter compound can also be obtained by the reaction of the dioxirane 1a with 1,4-diisocyanatocubane (however, in this case, the presence of H2O is required).276 Yet another typical example of oxidation of polyamines is the transformation of 1,3,5,7-tetraaminoadamantane,275 which is extremely explosive although thermally stable.NH2 . HCl NO2 excess 1a O2N HCl .H2N *20 8C NH2 . HCl NO2 NH2 . HCl NO2 (91%) Chiral amines are converted into the corresponding nitro compounds with retention of the configuration.277 NH2 NO2 1a NH2 NO2 1a OH Presumably,274 oxidation of primary amines includes several stages, hydroxylamines and nitroso compounds being formed as intermediate products; the process can be partially controlled at the stage of formation of hydroxylamine.278 OH1a 1a 1a R NO2 R N R NH2 R N R NO H OH7H2O 271 This sequence of reactions can include either insertion of oxygen into the N±H bond (similar to the insertion into C±H bonds of saturated hydrocarbons) or formation of an intermedi- ate such as N-oxide followed by its rearrangement into hydroxyl- amine.277 Nitro compounds are not always the only reaction products. Thus oxidation of some aliphatic primary amines by the dioxirane 1a (either isolated or in situ) gives, depending on the reaction conditions, oximes, nitrosoalkanes, nitroalkanes and oxaziri- dines.279 In some cases, the corresponding nitrones, arising upon oxidation of intermediate imines, can also be found among the reaction products.279 Oxidation of ketoximes by the dioxirane 1a gives the corresponding ketones in high yields.280 O NOH 1a C C 0 ±20 8C R1 R2 R1 R2 (80% ± 100%) Secondary amines react with the dioxirane 1a (1 : 1) to give hydroxylamines.281 When excess dioxirane is used, the process affords either nitrone 42 (in the presence of hydrogen at the a-position in relation to the amino group) or stable nitroxide 43 (in the absence of hydrogen).282 +N O7 7H2O 1a OH 1a 42 NH NOH +N O7 N O 7OH7 43 A series of nitrones have been prepared by the reaction of the dioxirane 1a with aryl-substituted secondary amines 283, 284 + 1a ArCH NR , ArCH2NHR ArCH2NR OH O7 (95% ± 99%) while oxidation of N-methylaniline gives rise to dinitrone.284 Nitroxides are formed in good yields when secondary amines are oxidised by dioxiranes generated in situ in the systemMe2CO± (2KHSO5 .KHSO4 .K2SO4)±CH2Cl2±H2O±Bu4NHSO4 (phase transfer catalyst).285 Tertiary amines including pyridines are oxidised by the dioxiranes 1a and 1b to give N-oxides.3, 105, 263, 286, 287 + 1a (or 1b) R3N R3N O7 It is noteworthy that some N-oxides cause decomposition of dioxiranes,3, 263, 286 which gives singlet oxygen 286 (see Section V).Dioxiranes proved to be convenient reagents for the recovery of the initial ketones from derivatives of hydrazones,288 which are often used in organic chemistry to isolate carbonyl compounds from reaction mixtures and to purify them. R1N R2 1a or 1b O (94% ± 99%) N 0 ±20 8C Recently 289 new versions of the oxidation of amines with participation of the dioxirane 1a have been found. They include (1) oxidative fragmentation of 2-amino alcohols 44a,b or 1,2- diamines 45a,b to give the corresponding mono- and dioximes of bicyclic diketones and (2) intramolecular oxidative transforma-272 tion of the latter into tricyclic 2-nitro alcohols 46b and 1,2-dinitro compounds 47a,b.X HON X O OH H2N 44a,b X or X O O OH O2N 46a,b X X HON X NOH NH2 H2N NO2 O2N 45a,b 47a,b X=CH2 (a), C6H4-o (b). b. Sulfur- and phosphorus-containing compounds Dioxiranes selectively oxidise sulfides to the corresponding sulf- oxides (equimolar ratio of the reactants) and sulfones (excess dioxirane). O 1a 1a R2S O R2S R2S O Thus thioesters are quantitatively oxidised by dimethyldiox- irane 1a to give labile a-oxo sulfones.290 O 1a R2 R1 C S Me2CO±CH2Cl2, N2,730 8C, 2 ± 4 h O O R2 R1 C SO Oxidation of (Z)-thioaurones, (E)-3-arylidene-1-thiochro- man-4-ones and (E)-3-arylidene-1-thioflavan-4-ones by the diox- irane 1a gives rise to the corresponding sulfones and/or sulfoxides.291 The reaction of the dioxirane 1a, taken in an excess, with ketene S,S-acetals, thioacetals and thioketals affords the corresponding bis(sulfones) in excellent yields.292 When bis(sul- fides) are treated with one, two or three equivalents of dimethyl- dioxirane, this gives monosulfoxides, bis(sulfoxides) and sulfoxide sulfones, respectively, the ratio of the products depending appre- ciably on the reaction temperature and the order in which the reactants are mixed.292 The corresponding sulfides and sulfones are formed in high yields in the chemoselective oxidation of the pentacarbonyl[ami- no(arylthioalkyl)carbene]chromium(0) complex by the dioxirane 1a.293 Low-temperature (720 8C) oxidation 294 of bis(p-methoxy- phenyl)trisulfane 48 results in the formation of monooxide 49 and a small amount of 1,1-dioxide 50 and trisulfane-1,1,3-trioxide 51.1a (1 equiv.) S S Ar Ar 720 8C S 48 O O O O O O + S + S S S S S Ar S Ar Ar Ar Ar Ar S 50 51 S 49 Ar=4-MeOC6H4. V P Kazakov, A I Voloshin, D V Kazakov High enantiomeric yields have been attained in the oxidation of prochiral sulfides to chiral sulfoxides by dioxiranes generated in situ.295 In reactions with sulfides, dioxiranes act as electrophilic reagents; the Hammett correlations found for the oxidation of a series of methyl 4-R-phenyl sulfides to sulfoxides and oxidation of sulfoxides to sulfones gave the values r+=70.77 and 70.76, respectively, the reactions of dioxiranes with sulfides being faster than those with sulfoxides.296 Using the reaction with thianthrene 5-oxide as an electrophilicity test,297 Adam and Golsch 298 also confirmed the electrophilic nature of the dioxirane 1a as an oxidant.This is indicated by the fact that the rate of oxidation of sulfylimines containing electron-donating substituents in the aromatic nucleus by the dioxirane 1a is markedly higher than the rate of oxidation of sulfylimines with electron-withdrawing sub- stituents.299 It is noteworthy that the above-described method proved to be convenient for the synthesis of chiral sulfoxyimines (optical purity 80%).O7 + 1a (4 equiv.) Ts S Ts S N N Me2CO, 0±25 8C Me p-MeC6H4 Me p-MeC6H4 (90%) When considering the mechanism of oxidation of sulfur- containing compounds, mention should be made of a study 300 dealing with the oxidation of methyl phenyl sulfide by the dioxirane 1a and postulating the formation of a hypervalent sulfurane intermediate 52. Ph Me O O CH2Cl2, 0 8C Me C S C PhSMe+ Me O CF3 CF3 O52 1b PhSOMe 7CF3C(O)Me 1b 1b PhSO2Me Among the few examples of oxidation of phosphorus-con- taining compounds by dioxiranes, the reaction of methyl(tri- fluoro-methyl)dioxirane 1b with triphenylphosphine, resulting in the phosphine oxide, deserves attention; this reaction is used to determine dioxirane concentrations. c.Oxidation of organometallic compounds The above oxidative transformations involving dioxiranes also take place during oxidation of metal-containing compounds.301 In the majority of cases, these reactions are highly chemoselective, because they are not accompanied by oxidative decomposition of metal complexes. Oxidation of tricarbonyl iron complexes 53a, containing a furylcyclohexadiene ligand is accompanied by opening of the furan ring and gives rise to the corresponding carbonyl com- pound.302 Fe(CO)3 Fe(CO)3 COR 1a (3 equiv.) C R O Me2CO,*60 8C O 53a (60%) Oxidation of iron complex 53b having a similar structure yields a 1 : 1 mixture of diastereoisomeric epoxides. The most plausible results were attained at elevated temperatures (at low temperatures, oxidative decomposition of the complex upon direct oxidation of iron occurs as a side reaction).303Dioxiranes: from oxidative transformations to chemiluminescence O (CO)3Fe (CO)3Fe 1a (3 equiv.) Me2CO, conversion 59% 53b (41%) The reaction of the tungsten alkene complex with the dioxir- ane 1a results in the quantitative formation of the corresponding epoxide.304O O O O 1a O Tp*W Tp*W 54 HB N N Tp*W= NN N N W Ferrohydridosilanes react with 1a to give the corresponding ferrosilanols.305, 306 OH H 1a Fe Si Fe Si OC OC R R 778 to 0 8C R L L R The reaction of the ylide (Z6-arene)chromiumtricarbonyl complex 55 with the dioxirane 1a gives the corresponding lactone complex, which is converted in the metal-free lactone on further addition of the oxidant.307 R2 O O + NR2R3 R3 NR2R3 O O N 1a O 1a 7 R1 R1 R1 Ph Ph Cr (CO)3 Ph Cr (CO)3 Ph 55 R1=H, Me, Ph; R2=R3=Me, R2±R3=(CH2)5, R2=Me, R3=cyclo-C3H5. The oxidative capacity of dioxiranes is clearly illustrated taken as an example the transformation of tolane manganese-containing complexes into a-oxocarbene complexes (apparently, this reaction proceeds via intermediate epoxidation of the alkyne).308 O R1 R1 C6H4R2-p C C6H4R2-p C 1a C Mn (CO)2 Mn C (CO)2 C6H4R3-p C6H4R3-p Oxidation of iron and tungsten phosphine complexes gives rise to the corresponding metal phosphine oxides.309 Sulfur- containing metal complexes are also oxidised by dioxir- anes.310 ± 312 Thus a new approach to the synthesis of chiral sulfoxides via diastereoselective oxidation by the dioxirane 1a of a prochiral thioether incorporated in a metal complex was reported.311, 312Achiral sulfoxide complex of ruthenium is formed as an intermediate in this reaction.The subsequent decomposition of this complex results in the liberation of chiral sulfoxide. + + Ph Ph PhRu PhRu O NaI 1a (1 equiv.) PF¡ PF¡66 S S R R PP Ph PP Ph Me Ph Me Ph 273 O O + S S Me R Me R (S) (R) Enaniomerically pure vinyl-substituted complex 56 has been synthesised by the oxidation of chiral amino-containing (Z6-are- ne)chromiumtricarbonyl complex by the dioxirane 1a.313 H (R) 1a Me NMe2 E E Cr (CO)3 Cr (CO)3 56 Apart from oxidation of the ligands, dioxiranes can be used for oxidative decomposition of metal complexes.Thus the organic ligands incorporated in the (Z6-arene)chromiumtricarbonyl com- plexes are quantitatively liberated on treatment with the dioxirane 1a.314 R1 R1 R2 1a R2 20 8C Cr (CO)3 The reaction of dioxiranes with Fischer carbene complexes follows a similar pathway.301, 315 ± 317 R1 R1 1b or 1a O C (CO)5Cr C R2 R2 However, in the case of the Fischer complexes 57, containing conjugated enamine fragments, the reaction loses the above-noted selectivity and yields, instead of the expected enamino ester, amide 59 via intermediate 58.317 OEt OEt 1a Ph Ph O (CO)5Cr (CO)5Cr H H NEt2 NEt2 57 OEt Ph O2 Ph O (CO)5Cr NEt2 HO NEt2 59 (52%) 58 During decomplexation of (Z4-diene)irontricarbonyl and m-(Z2-alkyne)dicobalthexacarbonyl complexes, the process of liberation of organic ligands induced by dioxirane 1a competes with the oxidation of the unsaturated fragments present in the compounds being liberated.318 Lithium, sodium and titanium enolates are converted in most cases into the corresponding a-hydroxy carbonyl prod- ucts.159, 319, 320 It is of interest that the best results are achieved when the reaction is carried out at reduced temperatures.OTi(OPri)3 O 1a ... NH4F, H2O Me Me 778 8C Ph Ph OH The stereoselectivity of oxidation of chiral enolates hardly depends on the temperature and the solvent but depends on the nature of the ligands attached to the central metal atom.320 The highest enantiomeric excess for 2-hydroxy-1-oxo-1-phenylpro- pane (63% R) is attained in the oxidation of the enolate 60 containing a chiral ligand with bulky 1-naphthyl groups, where the steric differences between the two conformers are the most pronounced.320274 Ph Ar is 1-naphthyl, Cp is cyclopentadienyl.d. Other reactions of dioxiranes Single-electron transfer reactions involving dioxiranes have been considered to a degree in Sections IV.3 and III.2 in relation to the mechanisms of oxidation of pyrene 272 and reactions of dioxiranes with nitroxides.120, 124 A typical single-electron transfer reaction is the rapid decomposition of the dioxirane 1b to give CF3C(O)Me and O2 in the presence of catalytic amounts of lithium or tetrabutylammonium iodide.321 Based on experimental data, a chain electron mechanism was proposed for the dioxirane 1a consumption, according to which the dioxirane accepts an elec- tron from the I7 anion being thus converted into a radical anion, which interacts with a second dioxirane molecule to give a dimeric radical anion; the latter decomposes to ketone and O¡ O¡ and thus closes the catalytic cycle.Thus, the superoxide ion carries the chain, whereas the iodide anion acts as the initiator (Scheme 10).321 F3C C Me 1b 2 . Then the Study of the dioxirane chemilumunescence started with the 2 . radical anion passes an electron to a new dioxirane molecule pioneering work by Adam and Curci, 341 who were the first to propose the possibility of CL during isomerisation (at that time, hypothetical) of dimethyldioxirane 1a to MA[see reaction (6)].In fact, the sum of the activation energy and enthalpy of this reaction is quite sufficient for an ester to be formed in, at least, the triplet state (Fig. 5); hence, CL is possible.4, 5, 341 It was found that reaction (6) should also comply with other criteria necessary for the generation of electronically excited states.341 Thus, even before alkyldioxiranes were isolated,1 Adam and Curci 341 had discov- ered a new interesting chapter in their chemistry. A possible mechanism of the reaction between quadricyclane and the dioxirane 1a also implies an electron transfer.322, 323 It is known that the dioxirane 1a, even present in small amounts (7.461074 mmol), is able to catalyse isomerisation of quadricyc- lane into norbornadiene.In addition, it is the electron transfer that is responsible for chemiluminescence observed in the reactions of dioxiranes with PAH and Ru(II).6, 10, 12, 15 ± 17 Note that the capability of dioxir- anes to accept an electron is in good agreement with their theoretically calculated electron affinity (2 eV).324 The reaction of the dioxirane 1a with fullerene 325 is a unique example of a reaction with an organic substrate in which dioxirane Cp Ti O Ar O O 1a O (R) Ph O Ar Me Ar Ar (R)O Me 60 Me O O7 F3C 1b C O Me O I.7 1b 73O2 I2 (O2) (O¡ ) 2 O¡2 .72CF3C(O)Me 1a products 1a+ O O 62 61 O (R) Me Me (S) + Ph OH OH (R : S=81.5 : 18.5) Scheme 10 O O CF3 F3C C C Me Me O7 O MeMe C OO + 63 Owing to their oxidising capacity, dioxiranes have found wide use as bleaching or disinfecting reagents.327 ± 333 It is worth noting in conclusion that rhenium peroxides (64 Me Me O O H2O2 Re Re O O O O O64 V. Chemluminescence and photochemistry of dioxiranes = Me O C Me O 15 Me Me Me O C Me O 100 85 Figure 5. Diagram of the energy levels of the dioxirane 1 in relation to the product of its decomposition, methyl acetate. 1. Non-activated chemiluminescence Decomposition of the dioxirane 1a in solutions under ordinary conditions is not accompanied by CL (despite the theoretical prerequisites). This can be due both to a low efficiency of emission by the electronically excited MA* in the triplet state and to efficient side `dark' pathways of decomposition of 1a (see Sectio- E/ kcal mol71 V P Kazakov, A I Voloshin, D V Kazakov displays its biradical nature; the 1,3-dioxolane derivative 63 was detected among the products of fullerene oxidation, in addition to epoxide 61 and oxo derivative 62.325 The use of the dioxirane 1a to prepare silanol-containing polymers has been reported.326 These polymers were synthesised by selective oxidation of SiH groups in appropriate polymer precursors.326 and 65) formed in the MeReO3±H2O2 system resemble dioxiranes in their structure and behave remarkably similarly to dioxiranes in the oxidation of alkenes, nitro compounds and alkanes.334 ± 340 Me O O H2O2 Re O O O65 SO* Me OMe n, p* TO* Me OMe n, p* O C O 90 110 ± 120 O OMe MeDioxiranes: from oxidative transformations to chemiluminescence n III).The third reason for the absence of luminescence is associated with efficient emission quenching, in particular, with the presence of traces of O2 (which is a triplet biradical in its ground state). Dioxygen does not suppress fluorescence (FL) of electronically excited singlet states but functions as an efficient quencher for triplet states. The removal of dioxygen from the solution may result in a substantially greater contribution of phosphorescence (PH); this was demonstrated, in particular, in the study of the CL that accompanies decomposition of tetrame- thyldioxetane (TMD).342 We used a similar expedient and found that thermal (46 8C) decomposition of both non-deuterated and deuterated 1a in acetone purified from traces of oxygen was actually accompanied by CL in the visible region;13 the CL maximum occurs within a band with lmax = 390 nm, typical of the phosphorescence of the resulting electronically excited triplet state of methyl acetate (MA*).14 O* O O Me Me D C C O O Me Me Me C OMe MA* (13) O Me C OMe +hn MA The decay of CL follows first-order kinetics (for non-deuter- ated 1a, keff=8.561073 s71).13 The quantum yield of CL (jCL=2.2610711 and 6610711 Einstein mol71 for non-deu- terated and deuterated dioxirane, respectively) and the yield of excitedMA[j*(MA)=1074%] are relatively low{ compared, for example, with the j* values for ketones formed upon decom- position of 1,2-dioxetanes21, 22 (the yield of excitation of triplet acetone in the decomposition of TMD is 37%).This low j* value for MA* is evidently due to `dark' decomposition of 1a occurring in parallel (in the absence of O2 at high temperatures) by a radical chain mechanism (see Section III). However, according to energy estimates, the reaction sequence presented in Scheme 7 cannot lead to excitation of MA.13 Therefore, reaction (13) is the most probable CL channel. Apparently, this reaction proceeds in parallel with those shown in Scheme 7, but in the absence of O2, its contribution must be low, which accounts for the low intensity of luminescence.Under `normal' conditions, isomerisation also occurs, however CL is suppressed almost completely by the O2 present in the system. It should be noted that reaction (13), according to which the excited state is formed upon a direct isomerisation event without fragmentation of the molecule, is a very uncommon process. Decomposition of dimethyldioxirane 1a upon sorption from the gas phase on the Silipor surface is accompanied by much brighter CL than its decomposition in solution (MA* is the emitter).11 O* kads O O Me Me C C Me C OMe O Me Me O kdes Gas phase (14) O Me C OMe hn �Silipor.In fact, the minimum possible CL characteristics under these conditions were estimated16, 343 to be two orders of magnitude { Since no data on the yield of emission of MA (jemis) can be found in the literature, this value is assumed to be at least not greater (actually, it must be smaller) than the jemis values for related compounds, ketones, for which jemis=1075. Thus, from here on, we should imply the minimum possible CL characteristics. 275 larger (jCL5461079 Einstein mol71;j*(MA)>0.01 %)} than the corresponding values for decomposition of 1a in oxygen-free acetone solutions.13 Among other reasons, this may be due to lower efficiency of quenching processes on the Silipor surface. However, in our opinion, the main reason for the increase in the CL yield on the Silipor surface lies in the mechanism of dioxirane decomposition; whereas in the solution in the absence of O2 at elevated temperatures, the `dark' radical chain decomposition (see Scheme 7) is the predominant process, on the Silipor surface, where radical reactions are much less efficient, chemiluminescent isomerisation [reaction (14)] becomes the major channel for the consumption of 1a. The kinetics of the decay of CL during decomposition of dimethyldioxirane 1a adsorbed on a Silipor surface is described by a first-order equation; however, the effective rate constant (keff=0.01 s71), found from the kinetic curves for CL decay plotted on the semilogaithmic coordinates, scarcely depends on the temperature (in the range 65 ± 90 8C).16, 343 Evidently, the observed rate constant, which is an effective value, depends not only on the isomerisation constant of the dioxirane 1a but also on the adsorption equilibrium (kdes/kads), so that the increase in the rate constant for the desorption of the dioxirane 1a from the Silipor surface following an increase in the temperature makes up for the increase in the isomerisation rate constant, the keff value remaining almost invariable.It is noteworthy that low-intensity chemiluminescence is also observed in a cell containing no Silipor.11 This may be due to both isomerisation of the dioxirane 1a in the gas phase and its decomposition on the internal surface of the cell. The addition of Silipor to a solution of the dioxirane 1a in acetone causes a short burst of luminescence, characterised by a relatively low inten- sity.343 2.Activated chemiluminescence Luminescence activation by polyaromatic hydrocarbons is widely used to study the CL arising during oxidation of hydrocar- bons 344 ± 348 or decomposition of 1,2-dioxetanes.21, 22, 349 ± 352 Tak- ing the reaction of the dioxirane 1b with rubrene (RB) as an example, Adam, Curci, et al.6 demonstrated the applicability of the luminescence activation method to detection of CL during decomposition of dioxiranes. Scheme 11 Me F3C a RB* C RB +hn RB+ Me CF3 a electron transfer O C +RB O7 b O O b F3C O +RBO C Me It was suggested that rubrene activates the CIEEL mechanism (Scheme 11, pathway a).In addition to CIEEL, there is also another channel of dioxirane consumption, namely, oxidation of rubrene (Scheme 11, pathway b), which decreases the CL inten- sity.6 Detection of the EPR signal of the radical cation 41+., formed in the reaction of pyrene with the dioxirane 1b by reaction (12), is an additional argument pointing to the CIEEL mechanism in the chemiluminescence reactions of dioxiranes.272 The reaction of the dioxirane 1a with PAH is also accompa- nied by CL. Thus CL has been discovered in the thermolysis of the dioxirane 1a (35 8C, Ar) in the presence of 9,10-diphenylanthra- cene (DPA), 9,10-dibromoanthracene (DBA) and anthracene (A).10 In all cases, the activators acted as the emitters of the observed luminescence (the maximum CL intensity increases in } The CL characteristics were estimated under the assumption that all the dioxirane present in the cell with Silipor is accumulated on the sorbent surface; in reality, this proportion can be only several percent and, hence, the real CL yield and j*(MA) are an order of magnitude greater.276 the sequence IA<IDPA<IDBA). The mechanism of activation of CL depends on the nature of the activator. Based on experimental results, it has been suggested 10, 343 that anthracene and 9,10- diphenylanthracene, which are oxidised during the reaction, activate the CIEEL mechanism, and 9,10-dibromoanthracene activates luminescence by the mechanism of energy transfer from MA* to the activator (Scheme 12).Scheme 12 Me Me O... DBA O+DBA C C O O Me Me energy transfer O O* Me C OMe +DBA* Me C OMe ... DBA DBA +hn In the presence of DBA, the CL decay follows first-order kinetics; however, the observed rate constant depends on the activator concentration, which implies that 9,10-dibromoanthra- cene catalyses the dioxirane decomposition.123, 343 However, anthracene and DPA influence the process kinetics in a more complicated way than DBA: the curve for the luminescence decay has two sections, `fast' and `slow' (Fig. 6).123, 343 It can be suggested that decomposition of the dioxirane 1a accounts for only the `fast' section of the curve (section 1), whereas an intermediate labile compound (perhaps, of the peroxide type), resulting from oxidation of the activators by the dioxirane, is responsible for the luminescence in the slow section (section 2).Indeed, after the CL kinetics had reached section 2 (Fig. 6) and acetone had been completely evaporated from the reaction cell, the addition of a new portion of acetone restored the luminescence intensity nearly up to the previous level.123, 343 Similar kinetics observed in the presence of anthracene may be due to analogous reasons. I (rel. u.) 60 1 40 2 20 120 80 t/ s 0 40 Figure 6. Kinetic curve for the decay of luminescence in the presence of DPA. [DPA]0=6.761074 mol litre71, [1Â]0=261072 mol litre71, ace- tone, 35 8C. Besides PAH, luminescent metal compounds can also be used to activate the CL of dioxiranes.Thus the reaction of Ru(bi- py)3Cl2 with dimethyldioxirane 1a in solution is accompanied by bright CL,15 emitted by Ru(II)* (Fig. 7). The CL decay obeys a first-order equation, the observed first- order rate constant for the CL decay (kCL) being proportional to the Ru(II) concentration: kCL=k1+k2[Ru(II)]. The activion parameters found from the temperature dependence of the bimo- lecular rate constant for the reaction k2 are the following: Ea=9.61.6 kcal mol71, logA=9.11.0. It can be seen that the reaction of Ru(II) with the dioxirane 1a has a markedly lower (by *13 ± 14 kcal mol71) activation energy than non-catalysed V P Kazakov, A I Voloshin, D V Kazakov I (rel. u.) A (rel. u.) 1 0.6 60 1 0 2 0 2 0.4 40 0.2 20 3 600 400 300 200 500 700 l/ nm Figure 7.Absorption (1, 2) and photoluminescence (1 0, 2 0) spectra of Ru(II) ([Ru(II)]=561076 mol litre71, CH3CN, 25 8C): (1, 1 0) before the reaction with the dioxirane 1Â; (2, 2) 0 after the reaction with 1 ([1Â]=261072 mol litre71); (3) chemiluminescence spectrum {[Ru(II)]=1.2561074 mol litre71, [1Â]=661073 mol litre71}. decomposition,8, 118 because the ruthenium complex substantially catalyses the dioxirane decomposition. For [Ru(II)]=1.2561074 mol litre71, the rate of catalysed decomposition of the dioxirane 1a at 40 8C is greater than the rate of non-catalysed decomposi- tion by a factor of 170 (!).15 Apparently, the activation of Ru(II)* luminescence and at least one pathway of the dioxirane decomposition catalysed by the ruthenium complex (Scheme 13) occur by the CIEEL mechanism, as has been shown for the reaction of Ru(II) with 1,2-dioxe- tanes.353 ± 357 Scheme 13 Ru(II) O Me C OMe O7 Me C OMe ...Ru(III) Me O7... Ru(III) C O Me hn (630 nm) 1 Ru(II) O2 hn (1270 nm) a O Me 3O2 Ru(II) C O Me Ru(III) O7 Me C O Me 1a c b Me Me O O C C Me Me O O7 O2 7Me2CO 1a O¡2 Comparison of the photoluminescence and absorption spectra of Ru(II) before and after completion of the reaction (see Fig. 7) indicates that the reaction of the Ru(II) complex with dioxirane leads to oxidation of the complex; this, however, has no influence on the CL kinetics and does not distort the results because noticeable changes in the spectra can be observed only when aDioxiranes: from oxidative transformations to chemiluminescence 46103-fold excess of the dioxirane 1a is present, whereas most of the kinetic measurements were carried out at lower ratios of 1a to Ru(II).15 The CL quantum yield found from the plot for the light sum versus concentration (Fig.8) using the equation S= j*(Ru) jFL k2[Ru(II)]0[1a]0 /(k1+k2[Ru(II)]0) is equal to jCL=(9.53)61075 Einstein mol71, and the yield of excitation of Ru(II) (with allowance for the fact that the yield of ruth-enium emission jFL=0.0095) equals j*(Ru)= 0.010.005.15 The CL characteristics obtained indicate that the dioxirane 1a ¡¾ ruthenium complex system is a fairly bright chemiluminescence system.However, the j*(Ru) value for the reaction of Ru(II) with 1,2- dioxetanes is much greater (0.2).357 Among other factors, the low ruthenium excitation yield in the CIEEL reaction of Ru(II) with the dioxirane 1a may be due to the existence of a parallel channel for the dioxirane consumption, which yields no excited Ru(II). Below we demonstrate that this channel actually exists. [1a]6103/ mol litre71 0 2 4 4 1 2 10 5 0 2 a Aexp RuOIIU=RuOIIIU=ERuOIIU=RuOIIIU7E*= 1.297 where e is the electron charge, e is the dielectric constant of the solvent and R0 is the distance between ions in the transition state. Since the oxidation potential of Ru(II)* decreases by the energy of excitation,358 i.e., E 2.12 = 70.83 V, then, in conformity with Eqn (15), an increase in k2 by several orders of magnitude should be expected.In fact, the Stern quenching constant (K), found from the linear section of the kinetics of quenching of Ru(II)* by dioxirane using the Stern ¡¾ Volmer equation j0 j a tt0 a 1 a KaQa, (j0 and t0 are the quantum yield and the decay time of the luminescence without quencher Q, and [Q] is the quencher con- S610714 /photon ml71 [Ru(II)]6105/ mol litre71 Figure 8. Chemiluminescence light sum in the reaction of the dioxirane 1A with Ru(II) vs the concentration of Ru(II) (straight line 1) ([1A]=661073 mol litre71) and the concentration of 1A (straight line 2) ([Ru(II)]=1.2561074 mol litre71). The catalytic activity of Ru(II) increases appreciably on excitation of the complex,15 which is in good agreement with the theory of electron transfer.In fact, the k2 value is known to depend on the oxidation potential of the activator (EOx) and the reduction potential of the peroxide (ERed) according to the following equation: k ¢§EOx ¢§ ERed ¢§ e2=eR0, RT 6 8 215 20 25 (15) (16) 277 I0 I ¢§ 1 8642 0 2 4[1a]06104/ mol litre71 Figure 9. Kinetics of quenching of Ru(II) photoluminescence by the dioxirane 1A in the coordinates of the Stern ¡¾ Volmer equation. lexcit=450 nm, [Ru(II)]=2.561075 mol litre71, 16 8C. centration), is the following: K=kQ t0=1800200 litre mol71 [kQ is the rate constant for the interaction of Ru(II)* with 1a]. From this it follows that the catalytic activity of Ru(II) increases on excitation by a factor of more than 86107.15 It can be seen from Fig.9 that at [1a] > 2.561074 mol litre71, a negative deviation from the linear Stern ¡¾ Volmer dependence is observed, obviously, due to the apparent decrease in the quenching effi- ciency caused by the recovery of the excited Ru(II) complex. Ru(III) ...1a7 Ru(II)*...1a Ru(II)*+1a a Ru(II)*...MA Ru(II)+MA+hn Ru(III) ...MA7 Ru(II)+MA Ru(II)...MA a is the excitation regeneration coefficient. The calculation of the excitation regeneration coefficient gives the value a=0.300.01, which is much greater than j*[Ru(II)] for the reaction of 1a with non-excited ruthenium. This leads to the conclusion that the contribution of the catalysed isomerisation of 1a occurring by the reversible electron transfer mechanism (see Scheme 13, pathway a) increases markedly.15 As noted above, the relatively low j*[Ru(II)] value for the reaction of Ru(II) with the dioxirane 1a (compared to this value for the reaction with 1,2-dioxetanes) may be due to the occurrence of a parallel channel of consumption of 1a, which does not give excited Ru(II).This route actually does exist but this is not a dark reaction! On the contrary, it is accompanied by very bright CL, which occurs in the infrared region (1270 nm), indicating the formation of singlet oxygen in the system.17, 343 The yield of 1O2 based on the decomposed dioxirane 1a in the Me2CO¡¾CD3CN (1 : 2) system is 0.03%. It is notable that the kinetics of the IR CL decay, unlike that for the Ru(II)* luminescence in the visible region of the spectrum, follows a fairly complex pattern (Fig.10).17, 343 Thus, the Ru(II) ¡¾ 1a system contains two lumines- cence emitters,15, 17, 343 Ru(II)* in the visible region and 1O2 in the infrared region.Apossible pathway to 1O2 is the reaction of Ru(II) with the dioxirane 1a by the electron chain mechanism (Scheme 13, pathways b and c). Pathway b is similar to that found in the I7¡¾ 1b system (the Adam ¡¾ Curci system 321) (see Scheme 10) with the only difference that in this case, Ru(II) serves as the electron donor. However, unlike the I7¡¾ 1b system,321 in the Ru(II) ¡¾ 1a system, the oxidised trivalent ruthenium can be reduced to recover the initial divalent species (Scheme 13, path- way c), which apparently gives rise to the singlet oxygen [the interaction of Ru(III) with the superoxide ion is known to lead to the generation of 1O2].359 Thus, in the reaction of Ru(III) with 1a, the dioxirane is consumed, in all probability, via two competing pathways,278 I (rel.u.) 9000 6000 3000 0 300 t/ s 200 100 Figure 10. Typical kinetic curve for the decay of the 1O2 chemilumines- cence (IR region) in the reaction between Ru(II) and the dioxirane 1 (25 8C, Ar, [1a]0=5.2561072 mol litre71, [Ru(II)]0=161074 mol litre71, solvent Me2CO±CD3CN (1 : 2)]. namely, the CIEEL mechanism to give excited Ru(II) (Scheme 13, pathway a) and the electron chain decomposition to give singlet oxygen (Scheme 13, pathways b and c).The reactions of other transition metals with dioxiranes might also give rise to singlet oxygen.} The above-described thermal decomposition of 1a upon adsorption of the Silipor surface from the gas phase can be substantially enhanced by applying CL activators [DBA, DPA, Ru(II)] on the Silipor surface.16, 343 For example, in the presence of Ru(II) or DPA (concentration of the additive 161076 mol g71), the maximum luminescence intensity increases 100- and 10-fold, respectively. The activators function as the luminescence emitters, which are apparently activated in the same way as in solu- tions.16, 343 The CL yield (0.0361075 Einstein mol71) 165, 343 for the decomposition of 1a in the presence of Ru(II) applied to the Silipor surface proved to be about three orders of magnitude lower than the CL yield observed in the reaction of 1a with Ru(II) in solution.15 Since the electron transfer is controlled by diffusion, this difference can be explained by the decrease in the rate of the diffusion of the reactants on passing from the homogeneous system (solution) to heterogeneous conditions (Silipor ± gas phase). It is of interest that in the 1a ± Ru(II) ± Silipor system, no CL from singlet oxygen is observed.16 Apparently, the diffusion restrictions prevent development of the processes shown by path- way b (or c) (see Scheme 13).3. Other chemiluminescence reactions involving dioxiranes and dioxirane intermediates Although the examples of formation of singlet oxygen in decom- position of dioxiranes are still few in number, they deserve attention, because the reactions described below are apparently far from being the last examples in which an extremely efficient oxidant (dioxirane) gives rise to another one, namely, 1O2, which plays a very significant role in both chemistry and biology.360 ± 362 Even the synthesis of dioxiranes itself is accompanied by the formation of 1O2.363 Non-catalysed decomposition of Caro's acid is known to give 1O2.364 Decomposition of Caro's acid catalysed by ketones is also accompanied by the evolution of oxygen (see Scheme 2).Previously,4 this has been suggested to be singlet oxygen; later, this suggestion was confirmed experimentally by Lange and Brauer,363 who observed CL of singlet oxygen at l=1270 nm during decomposition of Caro's acid induced by }This should depend appreciably on the energy characteristics of the reaction.Thus we were unable to detect CL of singlet oxygen in the reaction of the dioxirane 1a with Ce(III),17, 343 apparently, due to the too high redox potential of the Ce(III)/Ce(IV) pair (1.4 V),358 which precludes the transfer of an electron from Ce(III) to the dioxirane. V P Kazakov, A I Voloshin, D V Kazakov various ketones (acetone, butan-2-one, fluoroacetone, cyclohex- anone, etc.). In addition to the detailed study of the reaction kinetics, they measured the yield of 1O2 (in the case of acetone) per HSO¡5 molecule, which proved to be 0.5; this means that all the oxygen evolved is in the singlet state.363 Adam et al.286 were the first to detect the evolution of 1O2 in the reactions of isolated dioxirane.Previously, Murray 3 had noted that some N-oxides induce decomposition of 1a with evolution of oxygen, which may be in the singlet state. Somewhat later, the Messeguer's group 263 found a catalytic effect of N-oxides on the decomposition of dioxiranes. Adam et al.286 observed the same phenomenon in the oxidation of 4-dimethyla- minopyridine by the dioxirane 1a: 4-dimethylaminopyridine N-oxide formed in the reaction induced rapid decomposition of 1a (Scheme 14). The reaction was accompanied by evolution of 1O2 (at 37 8C, the fraction of 1O2 in the total number of O2 molecules was 5%), which was proved by CL registered in the infrared and visible regions of the spectrum.Luminescence in the visible region might be due to the dimol emission of 1O2 (634 and 703 nm).286 NMe2 1a +N SN2 O7 NMe2 N NMe2 + 71O2,7Me2CO 7O N 3O2 O O hn (634, 703, 1268 nm) Finally, the third example of evolution of 1O2 in the reactions of dioxiranes, namely, in the decomposition of 1a catalysed by the complex Ru(bipy)3Cl217 was considered in detail above. When drawing indirect analogy with 1,2-dioxetanes, it is noteworthy that only one example of the formation of 1O2 during decomposition of 1,2-dioxetane (namely, 3-hydroxymethyl-3,4,4- trimethyl-1,2-dioxetane) has been reported.365 The excitation of O2 occurs via a trivial mechanism consisting in the transfer of energy from the triplet-excited carbonyl fragment (the product of dioxetane decomposition) to oxygen. By now we have considered CL of isolated dioxiranes.How- ever, several studies in which dioxiranes are considered as possible intermediates in various chemical and biochemical chemilumines- cence systems have also been reported.12, 97 ± 101 In the 1980s, Steinfatt 97 ± 100 published a series of studies, dealing with the reactions of a number of organic gem-dichlorides with sodium peroxide and hydroperoxide in the presence of aromatic sensi- tisers. These reactions were accompanied by fairly bright chem- iluminescence. The yield of activated CL in the reaction of Na2O2 with 3,3-dichlorophthalide 97 was 1073 Einstein mol71 (!).Stein- fatt also studied activated CL reactions of 1,8-C10H6(COCl)2 with Na2O2 100 and Cl2CO with NaOOH.98 The following scheme was proposed to interpret the CL observed: Cl R1 R1 Na2O2 C C 7NaCl Cl R2 R2 Scheme 14 1a NMe2 Me O C Me O N + O7 SN2 Me C Me O , ODioxiranes: from oxidative transformations to chemiluminescence O activator R1 R1 activator C C O+O* 7R1R2CO R2 O R2 activator *+ O hn. Dioxirane was also proposed as an intermediate to explain the CL of peroxyoxalate.99 reaction of O2 with the complex E.FMNH2 yields C(4a)-perox- ydihydroflavine 66, which subsequently reacts with the aldehyde to give a tetrahedral intermediate 67. These stages are in good agreement with known mechanisms.Presumably,101 the next step includes the formation of a dioxirane intermediate and C(4a)- hydroxyflavine 68. After that, there are two pathways for the generation of CL101 � decomposition of dioxirane to give an excited carboxylic O O O O C CO+CO3, O O O O acid and subsequent energy transfer on the hydroxyflavine 68, which acts as the CL emitter; in this case, luminescence is activated by the energy transfer mechanism (Scheme 15, pathway a); CO2+ O* (singlet-excited), CO3 �the CIEEL mechanism in which the hydroxyflavine 68 acts as the fluorophore and the electron donor (Scheme 15, path- way b). O*+ CO CO2 (singlet-excited), 4. Photochemistry of dioxiranes CO2+ activator * CO2 +activator hn. Later12 we have observed non-sensitised CL in the Ph2CCl2 ± H2O2 ±NaOH system, similar to the Steinfatt systems.The maximum of the luminescence intensity was concentrated in the range 400 ± 450 nm, pointing to the possible formation of triplet phenyl benzoate, the product of isomerisation of diphenyldioxir- ane.12 O* H2O2, NaOH Ph O Ph Cl C C Ph C OPh O Ph Ph Cl O As many other peroxides, dioxiranes are sensitive to light; this was partially illustrated in Section III in relation to the dioxirane 1b (see Schemes 3 and 4).114 A similar type of behaviour is displayed by the dioxirane 1a. Thus the quantum yield of photodecomposi- tion of the dioxirane 1a at 23 8C proved to be much greater than unity (j=13.90.6, 12.91.7 and 13.10.7 Einstein mol71 at 340, 350 and 360 nm, respectively),14 indicating that decomposi- tion occurs by a radical chain mechanism.More evidence in favour of this mechanism is provided by the detection of adducts formed from alkyl radicals during the photolysis (l=300 nm) of the dioxiranes 1a and 1b in the presence of the trap 10 (1b completely decomposes under these conditions over a period of 30 min).120 Ph C OPh+hn Me R1 R1=Me (1a), CF3 (1b). It is significant that CL of diphenyldioxirane (provided that it is actually formed in this system) can be observed even in the absence of luminescence activators. On addition of Ru(II), the luminescence intensity increases by several orders of magnitude, the maximum intensity being directly proportional to the concen- tration of the complex.Apparently, in this case, as in the case of isomerisation of dimethyldioxirane 1a, the CIEEL mechanism is involved.12 However, at 77 K in a matrix, radical chaiocesses are less significant, and decomposition of 1b (l > 300 nm) yields 1,1,1- trifluoroethane (41%) and MTFA (51%) as the major reaction products together with small amounts of trifluoromethyl acetate (TFMA, 8%). Thus, the photolysis of the dioxirane 1b in a matrix occurs as either isomerisation (Scheme 16, pathway a) or b-cleav- age followed by cage recombination of the resulting radical pair (Scheme 16, pathway b) or follows simultaneously both chan- nels.114 The formation of a dioxirane intermediate has also been assumed to interpret the mechanism of bioluminescence of bac- teria.101 The mechanism of excitation in these reactions cannot yet be considered to be conclusively established.The overall process is known to be catalysed by an enzyme � luciferase (E) � and consists in the oxidation of the reduced form of flavine mono- nuceotide (FMNH2) by oxygen with participation of a long-chain aldehyde. A mechanism for the generation of luminescence was proposed 101 (Scheme 15); according to this mechanism, the 7 O Me Me N RN O Me N RN O2 RCHO NH NH Me Me Me NH NH O E.FMNH2 O O O7 66 a O* 68 ... C R OH Me O N RNR O C + NH O H O O7 Me NH b OHO 68+ ... C 68 R H O O Me hn C C O CH2Cl2,710 8C R1 O 1a,b R22 NO (10) Me +(R1) R22 NOMe +R22 NR1 Me O N RN NH Me NH H R O O O7 CO hn O 68* ...C R OH O7 68*+ C 68+ ... R OH 279 7CO2 Scheme 15 O N RN NH NH O OO H R C 67 O O hn C OH R280 Scheme 16 O Me migration F3C C O Me MTFA a O CF3 migration F3C C O CF3 O O TFMA C 1b Me CF3 MeCO2 CF3 b TFMA+MTFA+ 7CO2 +MeCF3. CF3CO2 CH3 It should be noted that isomerisation to give the correspond- ing ester is the main route in the low-temperature photolysis of a whole series of other dioxiranes obtained in a matrix.33, 62, 65, 67, 69, 71, 72, 75, 80, 81 It has been suggested 7 that the [s, p]-configuration of the dioxirane biradical should be respon- sible for the generation of an excited product.O* O R1 O R1 hn C C C OR2 R1 O R2 O R2 [s,p] Indeed, when the dioxirane 1a in a matrix (77 K) is irradiated at a wavelength corresponding to its absorption band, phosphor- escence of MA is observed (Fig. 11),14 which is evidently due to the following process: Me O* Me O hn MA* 1a C C MA+hn. Me O Me O I (rel. u.) 1 40 2 30 20 200 20 4 10 3 450 500 400 350 l/ nm Figure 11. Phosphorescence spectra (77 K) of methyl acetate (1), dioxir- ane 1 (2, 2 0, 2 00) and acetone (3, 4). (1) lexcit=260 nm, [MA]0=0.09 mol litre71 , MeCN; (2, 2 0, 2 00) lexcit=350 nm, [1Â]0=0.09 mol litre71, acetone (spectra 2 0 and 2 00 were recorded at 25 min intervals under permanent irradiation); (3) lexcit=320 nm; (4) lexcit=350 nm.In addition to the triplet-excited MA*, photodecomposition of the dioxirane 1a in a matrix affords triplet-excited acetone, probably, due to the transfer of energy from MA* to acetone. Me2CO* MA*+Me2CO Me2CO+hn 7MA The formation of MA* and the fact of energy migration suggest the existence of one more channel of dioxirane consump- tion by a quantum chain (QC) mechanism. In the 1960s, Shilov and Vedeneev 366 discovered experimentally a new class of chain gas-phase reactions involving vibrationally excited states. Some- V P Kazakov, A I Voloshin, D V Kazakov what later, in the 1970s, taking decomposition of 1,2-dioxetanes in solution as an example, the occurrence of chain processes with participation of species existing already in electronically excited states was demonstrated.349, 367 ± 369 In this case, a product of dioxetane decomposition � a triplet excited ketone � or an activator molecule is included in the chain propagation reactions.Since decomposition of dioxiranes also gives a triplet-excited product (for example, decomposition of 1a affords MA*), it can be expected that in the case of dioxiranes, QC processes are, in principle, quite probable (Scheme 17). Scheme 17 O* Me O hn Me C OMe deactivation C O Me 1a Me2CO O O* O O* Me C Me + Me C OMe Me C OMe + Me C Me (from 1a) 1a 1a etc. O* deactivation O +Me C Me Me C OMe 1a etc. Certainly, a solution of the dioxirane 1a in acetone is far from being a perfect system for QC processes, first of all, due to the low efficiency of MA excitation and emission.In addition, the QC decomposition should be strongly hampered by the competing radical chain mechanism. However, other dioxiranes, in partic- ular, those with chromophore-containing substituents, which give esters characterised by markedly larger emission yields, may prove to be prone to undergo photo and, perhaps, also thermal decom- position by the QC mechanism. Dimesityldioxirane 1j seems quite promising in this respect. VI. Conclusion Dioxiranes remarkably combine two significant properties�the ability to act as strong oxidants and the ability to form products in the electronically excited states. It is these specific features that distinguish dioxiranes from other related compounds, in partic- ular, 1,2-dioxetanes, the principal property of which is CL, or from a number of peroxy compounds, which have found applica- tion as oxidants in organic synthesis.The high oxidative capacity of dioxiranes combined with the selectivity and mild conditions of reactions permitted researchers to perform a great number of oxidative transformations, which would have been impossible with other reagents. In addition, due to the availability of initial compounds and the ease of prepara- tion of dioxiranes, these reagents can be used almost in any chemical laboratory. Study of the CL of dioxiranes resulted in the discovery of a unique pathway to excited states. In fact, the rearrangement of dioxiranes into the corresponding esters initiated either thermally or photochemically is an exceptionally uncommon example of generation of an excited state directly upon an isomerisation event without fragmentation of the molecule (decomposition of 1,2- dioxetanes occurs via fragmentation of the molecule to give several products, one being in the excited state).Asimilar reaction route has been observed previously only for isomerisation of Dewar's benzene to excited Kekule's benzene.370 It can be conjectured that in the future, the chemistry of dioxiranes will develop along these lines. Without doubt, studies on the oxidative properties of dioxiranes and physicochemicalDioxiranes: from oxidative transformations to chemiluminescence regularities of these reactions will be continued.Until now, the mechanism of decomposition of dioxiranes in the absence of oxidisable compounds has not been ultimately determined. The role of isomerisation in the set of other channels of dioxirane decomposition, which depend substantially not only on the external conditions but also on the structure of dioxiranes themselves, is still to be elucidated. Despite the obvious difficulties, the search for the routes and conditions for the synthesis of new dioxiranes of various struc- tures still remains a topical task. It is beyond doubt that success along this line (the first successful steps are being taken 59, 80 ± 83, 117) would substantially extend the possibilities of studying the properties of this new class of peroxides. This refers both to oxidative transformations (in particular, with the outlook for the preparation of chiral dioxiranes suitable for attaining prochiral oxidation) and chemiluminescence.Thus decomposi- tion of a dioxirane with chromophore-containing substituents, for example dimesityldioxirane 1j already synthesised,80, 81 can be accompanied by CL comparable with the CL of dioxetanes. The presence of these dioxiranes including some bisdioxiranes would be useful for the study of energy migration paths in a matrix, in solution or on a sorbent surface and also for the study of quantum chain and energy coupled reactions.21, 371 However, we are sure that the study of CL of the dioxiranes 1a and 1b would provide not less impressive results.Apart from the CL of dioxiranes them- selves, one should also expect luminescence during their oxidative reactions with various organic and organometallic substrates, oxidation of which by other oxidants (XeF2, XeO3, O2, etc.) results in bright CL.372 ± 374 This is equally true for inorganic compounds. It is known that in thecades, a large number of bright CL reactions accompanying oxidation of low-valence uranium species (e.g., by xenon compounds, XeF2 or XeO3) were discovered.375 ± 386 If dioxiranes are included in the set of oxidants, high excitation yields can be expected in these systems. A lot of interesting discoveries would result from combination of the chemistry of dioxiranes and 1,2-dioxetanes with the chemistry of complexes of f- and d-elements.387 ± 401 A dioxir- ane ± lanthanide complex system may prove to be the second system, after a similar dioxetane-containing system, in which a new class of chain processes � quantum-chain reactions with energy branching�can be observed.399 ± 401 The authors are grateful to the Russian Foundation for Basic Research (Project No.99-03-32140a) for financial support. We also wish to thank Professor R Curci (Bari University, Italy) and Professor W Adam (WuÈ rzburg University, Germany) for help in overcoming the difficulties that we have faced in recent years due to the non-availability of foreign publications and also for the fruitful discussion of some aspects of the peroxide chemistry. References 1.R W Murray, R Jeyaraman J. Org. Chem. 50 2847 (1985) 2. R W Murray Mol. Struct. Energ. 6 311 (1988) 3. R W Murray Chem. Rev. 89 1187 (1989) 4. W Adam, R Curci, J O Edwards Acc. Chem. Res. 22 205 (1989) 5. R Curci, in Advances in Oxygenated Processes Vol. 2 (Ed. A L Baumstark) (Greenwich: JAI Press, 1990) p. 1 6. W Adam, L P Hadjiarapoglou, R Curci, R Mello, in Organic Peroxides Ch. 4 (Ed.W Ando) (New York: Wiley, 1992) p. 195 7. W Adam, L Hadjiarapoglou Top. Curr. Chem. 164 45 (1993) 8. R Curci, A Dinoi, M F Rubino Pure Appl. Chem. 67 811 (1995) 9. E L Clennan Trends Org. Chem. 5 231 (1995) 10. D V Kazakov, N N Kabal'nova, A I Voloshin, V V Shereshovets, V P Kazakov Izv. Akad. Nauk, Ser. Khim. 2286 (1995) a 11. D V Kazakov, A I Voloshin, N N Kabal'nova, V V Shereshovets, V P Kazakov Izv.Akad. Nauk, Ser. Khim. 2582 (1996) a 12. A M Nazarov, A I Voloshin, G A Yamilova, V D Komissarov, V P Kazakov Izv. Akad. Nauk, Ser. Khim. 2593 (1996) a 281 13. D V Kazakov, A I Voloshin, N N Kabal'nova, S L Khursan, V V Shereshovets, V P Kazakov Izv. Akad. Nauk, Ser. Khim. 477 (1997) a 14. D V Kazakov, A I Voloshin, N N Kabal'nova, V V Shereshovets, V P Kazakov Izv. Akad. Nauk, Ser. Khim. 938 (1997) a 15. D V Kazakov, A I Voloshin, N N Kabal'nova, V V Shereshovets, V P Kazakov Izv. Akad. Nauk, Ser. Khim. 1138 (1997) a 16. D V Kazakov, A I Voloshin, N N Kabal'nova, V V Shereshovets, V P Kazakov Mendeleev Commun. 49 (1998) 17. D V Kazakov, A I Voloshin, V V Shereshovets, V N Yakovlev, V P Kazakov Mendeleev Commun.169 (1998) 18. W Adam, in The Chemistry of Functional Groups: Peroxides. (Ed. S Patai) (New York: Wiley, 1983) p. 829 19. G B Schuster, S P Schmidt Adv. Phys. Org. Chem. 18 187 (1982) 20. R F Vasil'ev, in Biokhemilyuminestsentsiya (The Biochemilumi- nescnce) (Ed. A I Zhuravlev) (Moscow: Nauka, 1983) p. 31 21. G L Sharipov, V P Kazakov, G A Tolstikov Khimiya i Khemilyumi- nestsentsiya 1,2-Dioksetanov (The Chemistry and Chemiluminescnce of 1,2-Dioxetanes) (Moscow: Nauka, 1990) 22. C R Saha-MuÈ ller, W Adam, in Comprehensive Heterocyclic Chemistry II Vol. 1B (Ed. A Padwa) (Oxford: Pergamon Press, 1996) p. 1041 23. R Criegee, G Wenner Liebigs Ann. Chem. 564 9 (1949) 24. T Sugawara, H Iwamura, H Hayashi, A Sekiguchi,W Ando, M T H Liu Chem.Lett. 1261 (1983) 25. T A Hinrichs, V Ramachandran, R W Murray J. Am. Chem. Soc. 101 1282 (1979) 26. R W Murray, R Banavali Tetrahedron Lett. 24 2327 (1983) 27. S Kumar, R W Murray J. Am. Chem. Soc. 106 1040 (1984) 28. W Sander Angew. Chem., Int. Ed. Engl. 29 344 (1990) 29. W Sander, A Kirschfeld, W Kappert, S Muthusamy, M Kiselewsky J. Am. Chem. Soc. 118 6508 (1996) 30. R L Kuczkowski, in Ozone and Carbonyl Oxides Vol. 2 (Ed. A Padwa) (New York: Wiley, 1984) p. 197 31. J C Scaiano,W G McGimpsey, H L Casal J. Org. Chem. 54 1612 (1989) 32. W Sander, G Bucher, S Wierlacher Chem. Rev. 93 1583 (1993) 33. W Sander, A Kirschfeld, in Advances in Strain in Organic Chemistry Vol. 4 (London: JAI Press, 1995) p. 1 34.A Bravo, F Fontana, G Fronza, A Mele, F Minisci J. Chem. Soc., Chem. Commun. 1573 (1995) 35. F Minisci, L Zhao, F Fontana, A Bravo Tetrahedron Lett. 36 1697 (1995) 36. D V Kazakov, N N Kabal'nova, S L Khursan, V V Shereshovets Izv. Akad. Nauk, Ser. Khim. 694 (1997) a 37. R Curci, A Dinoi, C Fusco, M A Lillo Tetrahedron Lett. 37 249 (1996) 38. C Fusco,M Fiorentino, A Dinoi, R Curci, R A Krause, D Kuck J. Org. Chem. 61 8681 (1996) 39. W Adam, R Curci, L D'Accolti, A Dinoi, C Fusco, F Gasparrini, R Kluge, R Paredes,M Schulz, A K Smerz, L Angela Veloza, S Weinkoetz, R Winde Chem. Eur. J. 3 105 (1997) 40. R Jeyaraman, R W Murray J. Am. Chem. Soc. 106 2462 (1984) 41. F J Lovas, R D Suenram Chem. Phys. Lett. 51 453 (1977) 42. R D Suenram, F J Lovas J.Am. Chem. Soc. 100 5117 (1978) 43. R I Martinez, R E Huie, J T Herron Chem. Phys. Lett. 51 457 (1977) 44. S A Kafaki, R I Martinez, J T Herron Mol. Struct. Energ. 6 283 (1988) 45. R W Murray, R Jeyaraman, in Polynuclear Aromatic Hydrocarbons: Tenth International Symposium on a Decade of Progress (EdsMWCooke, A J Dennis) (Columbus, OH: Battelle Press, 1985) p. 595 46. R W Murray,M K Pillay,M J Snelson, in Polynuclear Aromatic Hydrocarbons: Measurements, Means, and Metabolism (EdsMCooke, KLoening, J Merritt) (Columbus, OH: Battelle Press, 1991) p. 615 47. R W Murray,W Kong Polycyclic Aromat. Compd. 5 139 (1994) 48. A V Baeyer, V Villiger Berichte 32 3625 (1899) 49. C D Harries Liebigs Ann. Chem. 374 288 (1910) 50. US P.3 632 606; Chem. Abstr. 76 99 638 (1972) 51. R E Keay, G A Hamilton J. Am. Chem. Soc. 97 6876 (1975) 52. R E Keay, G A Hamilton J. Am. Chem. Soc. 98 6578 (1976) 53. W A Pryor, C K Govindan, D F Church J. Am. Chem. Soc. 104 7563 (1982)282 54. T A Walter, J J Bufalini, B W Gay Jr Environ. Sci. Technol. 11 382 (1977) 55. R H Eastman, R M Silverstein J. Am. Chem. Soc. 75 1493 (1953) 56. H E Smith, R H Eastman J. Am. Chem. Soc. 83 4274 (1961) 57. H E O'Neal, C Blumstein Int. J. Chem. Kinet. 5 397 (1973) 58. S Vaccani, H Kuhne, A Bauder, H H Gunthard Chem. Phys. Lett. 50 187 (1977) 59. K R Kopecky, Y Xie, J Molina Canad. J. Chem. 71 272 (1993) 60. A Sekiguchi,W Ando J. Chem. Soc., Chem. Commun. 575 (1979) 61. P S Bailey Ozonation in Organic Chemistry Vol.1 (New York: Academic Press, 1978) 62. O L Chapman, T C Hess J. Am. Chem. Soc. 106 1842 (1984) 63. G A Bell, I R Dunkin J. Chem. Soc., Chem. Commun. 1213 (1983) 64. I R Dunkin, G A Bell Tetrahedron 41 339 (1985) 65. I R Dunkin, C J Shields J. Chem. Soc., Chem. Commun. 154 (1986) 66. G A Bell, I R Dunkin, C J Shields Spectrochim. Acta, Part A 41 1221 (1985) 67. G A Ganzer, R S Sheridan, M T H Liu J. Am. Chem. Soc. 108 1517 (1986) 68. W Sander Angew. Chem., Int. Ed. Engl. 25 255 (1986) 69. W Sander J. Org. Chem. 54 333 (1989) 70. W Sander Angew. Chem., Int. Ed. Engl. 24 988 (1985) 71. W Sander J. Org. Chem. 53 121 (1988) 72. W Sander J. Org. Chem. 53 2091 (1988) 73. S Murata, H Tomioka, T Kawase,M Oda J. Org. Chem. 55 4502 (1990) 74.H Tomioka, K Komatsu,M Shimizu J. Org. Chem. 57 6216 (1992) 75. G Bucher,W Sander Chem. Ber. 125 1851 (1992) 76. W Sander Spectrochim. Acta, Part A 43 637 (1987) 77. S Wierlacher, W Sander, M T H Liu J. Org. Chem. 57 1051 (1992) 78. J R Sodeau, L J Whyte J. Chem. Soc., Faraday Trans. 87 3725 (1991) 79. S Wierlacher,W Sander,C Marquardt, E Kraka,D Cremer Chem. Phys. Lett. 222 319 (1994) 80. A Kirschfeld, S Muthusamy,W Sander Angew. Chem., Int. Ed. Engl. 33 2212 (1994) 81. W Sander,K Schroeder, S Muthusamy, A Kirschfeld,W Kappert, R Boese, E Kraka, C Sosa, D Cremer J. Am. Chem. Soc. 119 7265 (1997) 82. A Russo, D D DesMarteau Angew. Chem., Int. Ed. Engl. 32 905 (1993) 83. H Burger, P Weinrath, G A Arguello, B Julicher, H Willner, D D DesMarteau, A Russo J.Mol. Spectrosc. 168 607 (1994) 84. W Ando, H Miyazaki, S Kohmoto Tetrahedron Lett. 1317 (1979) 85. W Ando,Y Kabi,H Miyazaki Photochem. Photobiol. 31 191 (1980) 86. A Sekiguchi, Y Kabe, W Ando J. Org. Chem. 47 2900 (1982) 87. T Ta, M Iwaki Tetrahedron Lett. 24 3109 (1983) 88. T Tezuka, M Iwaki Heterocycles 22 725 (1984) 89. T Tezuka, M Iwaki J. Chem. Soc., Perkin Trans. 1 2507 (1984) 90. T Tezuka, M Iwaki, Y Haga J. Chem. Soc., Chem. Commun. 325 (1984) 91. W Ando, R Sato, H Sonobe, T Akasaka Tetrahedron Lett. 25 853 (1984) 92. W Ando, S Kohmoto, K Nishizawa J. Chem. Soc., Chem. Commun. 894 (1978) 93. W Ando, S Kohmoto, H Miyazaki, K Nishizawa, H Tsumaki Photochem. Photobiol. 30 81 (1979) 94.M Rahman,M L McKee, P B Shevlin, R Sztyrbicka J. Am. Chem. Soc. 110 4002 (1988) 95. W Adam, A Rodriquez J. Am. Chem. Soc. 102 404 (1980) 96. W Adam, A Rodriquez Tetrahedron Lett. 22 3509 (1981) 97. M Steinfatt J. Chem. Res. (S) 111 (1984) 98. M Steinfatt J. Chem. Res. (S) 211 (1984) 99. M Steinfatt Bull. Soc. Chim. Belg. 94 85 (1985) 100. M Steinfatt J. Chem. Res. (S) 140 (1985) 101. F M Raushel, T O Baldwin Biochem. Biophys. Res. Commun. 164 1137 (1989) 102. R E Montgomery J. Am. Chem. Soc. 96 7820 (1974) 103. J O Edwards, R H Pater, R Curci, F Di Furia Photochem. Photobiol. 30 63 (1979) 104. R Curci, M Fiorentino, L Troisi, J O Edwards, R H Pater J. Org. Chem. 45 4758 (1980) 105. A R Gallopo, J O Edwards J. Org. Chem. 46 1684 (1981) V P Kazakov, A I Voloshin, D V Kazakov 106.G Cicala, R Curci, M Fiorentino, O Laricchiuta J. Org. Chem. 47 2670 (1982) 107. R Curci,M Fiorentino,M R Serio J. Chem. Soc., Chem. Commun. 155 (1984) 108. L Cassidei,M Fiorentino, R Mello, O Sciacovelli, R Curci J. Org. Chem. 52 699 (1987) 109. W Adam, Y-Y Chan, D Cremer, J Gauss, D Scheutzow, M Schindler J. Org. Chem. 52 2800 (1987) 110. W Adam, J Bialas, L Hadjiarapoglou Chem. Ber. 124 2377 (1991) 111. R Mello,M Fiorentino, O Sciacovelli, R Curci J. Org. Chem. 53 3890 (1988) 112. M Singh, R W Murray J. Org. Chem. 57 4263 (1992) 113. H K Chenault, S J Danishefsky J. Org. Chem. 54 4249 (1989) 114. W Adam, R Curci, M E Gonzalez-Nunez, R Mello J. Am. Chem. Soc. 113 7654 (1991) 115.M Ferrer,M Gibert, F Sanchez-Baeza, A Messeguer Tetrahedron Lett. 37 3585 (1996) 116. M Gibert, M Ferrer, F Sanchez-Baeza, A Messeguer Tetrahedron 53 8643 (1997) 117. R W Murray,M Singh, R Jeyaraman J. Am. Chem. Soc. 114 1346 (1992) 118. L A Hull, L Budhai Tetrahedron Lett. 34 5039 (1993) 119. A L Baumstark, M Beeson, P C Vasquez Tetrahedron Lett. 30 5567 (1989) 120. W Adam, S E Bottle, R Mello J. Chem. Soc., Chem. Commun. 771 (1991) 121. R Mello,M Fiorentino, C Fusco, R Curci J. Am. Chem. Soc. 111 6749 (1989) 122. M Ferrer, F Sanchez-Baeza, J Casas, A Messeguer Tetrahedron Lett. 35 2981 (1994) 123. D V Kazakov, Candidate Thesis in Chemical Sciences, Institute of Organic Chemistry, Ural Scientific Centre, Russian Academy of Sciences, Ufa, 1997 124.A Dinoi, R Curci, P Carloni, E Damiani, P Stipa, L Greci Eur. J. Org. Chem. 871 (1998) 125. N N Kabal'nova, D V Kazakov, N M Shishlov, V V Sheresho- vets Izv. Akad. Nauk, Ser. Khim. 1552 (1996) a 126. V E Zubarev Metod Spinovykh Lovushek (The Method of Spin Traps) (Moscow: Moscow State University, 1984) 127. E Niki, S Yokoi, J Tsuchiya, Y Kamiya J. Am. Chem. Soc. 105 1498 (1983) 128. P Neta,R E Hull,A B Ross J. Phys. Chem. Ref. Data 19 413 (1990) 129. B Plesnicar, F KovacÏ ,M Schara J. Am. Chem. Soc. 110 214 (1988) 130. W A Pryor, D G Prier, D F Church J. Am. Chem. Soc. 105 2883 (1983) 131. V B Kogan, V M Fridman, V V Kafarov Spravochnik po Rastvorimosti (Handbook on Solubility) (Moscow: Izd. Akad. Nauk. SSSR, 1961) Vol.1, Book 1 132. S A Grabovski, D V Kazakov, N N Kabal'nova, S L Khursan, V V Shereshovets React. Kinet. Catal. Lett. 62 179 (1997) 133. N J Turro, P Lechtken J. Am. Chem. Soc. 95 266 (1973) 134. T Wilson, M E Landis, A L Baumstark, P D Bartlett J. Am. Chem. Soc. 95 4766 (1973) 135. W H Richardson, F C Montgomery, P Slusser, M B Yelvington J. Am. Chem. Soc. 97 2819 (1975) 136. E Kraka, Z Konkoli, D Cremer, J Fowler, H F Schaefer J. Am. Chem. Soc. 118 10595 (1996) 137. B A Arndtsen, R G Bergan, T A Mobley, T H Peterson Acc. Chem. Res. 28 154 (1995) 138. A Tenaglia, E Terranova, B Waegell Tetrahedron Lett. 30 5271 (1989) 139. H-J Schneider,W MuÈ ller J. Org. Chem. 50 4609 (1985) 140. H Mimoun, L Saussine, E Daire,M Postel, J Fischer, R Weisse J.Am. Chem. Soc. 105 3101 (1983) 141. P S Bailey Ozonization in Organic Chemistry Vol. 2 (New York: Academic Press, 1982) 142. B S Jaynes, C L Hill J. Am. Chem. Soc. 117 4704 (1995) 143. B Meunier Chem. Rev. 92 1411 (1992) 144. A Ya Sychev, V G Isak Usp. Khim. 64 1183 (1995) [Russ. Chem. Rev. 64 1105 (1995)] 145. R W Murray, R Jeyaraman, L Mohan J. Am. Chem. Soc. 108 2470 (1986) 146. W Adam, G Asensio, R Curci, M E Gonzalez-Nunez, R Mello J. Org. Chem. 57 953 (1992)Dioxiranes: from oxidative transformations to chemiluminescence 147. R W Murray, H Gu J. Org. Chem. 60 5673 (1995) 148. D Kuck, A Schuster Z. Naturforsch., B Chem. Sci. 46 1223 (1991) 149. G Asensio, R Mello, M E Gonzalez-Nunez, G Castellano, J Corral Angew.Chem., Int. Ed. Engl. 35 217 (1996) 150. K Pramod, P E Eaton, R Gilardi, J L Flippen-Anderson J. Org. Chem. 55 6105 (1990) 151. R Mello, L Cassidei,M Fiorentino, C Fusco, R Curci Tetrahedron Lett. 31 3067 (1990) 152. D S Teager, R K Murray Jr J. Org. Chem. 58 5548 (1993) 153. D Kuck, A Schuster, C Fusco,M Fiorentino, R Curci J. Am. Chem. Soc. 116 2375 (1994) 154. P Bovicelli, A Gambacorta, P Lupattelli Tetrahedron Lett. 33 7411 (1992) 155. J T Dixon, C W Holzapfel, F R van Heerden Synth. Commun. 23 135 (1993) 156. P Bovicelli, P Lupattelli, E Mincione, T Prencipe, R Curci J. Org. Chem. 57 2182 (1992) 157. C CerreÁ , A F Hofmann, C D Schteingart,W Jia, D Maltby Tetrahedron 53 435 (1997) 158. P Bovicelli, P Lupattelli, E Mincione, T Prencipe, R Curci J.Org. Chem. 57 5052 (1992) 159. W Adam, F Prechtl Chem. Ber. 124 2369 (1991) 160. W Adam, A K Smerz Tetrahedron 52 5799 (1996) 161. W Adam,M Shimizu Synthesis 560 (1994) 162. R Mello, L Cassidei,M Fiorentino, C Fusco,W HuÈ mmer, V JaÈ ger, R Curci J. Am. Chem. Soc. 113 2205 (1991) 163. F KovacÏ , A L Baumstark Tetrahedron Lett. 35 8751 (1994) 164. J K Crandall, M Zucco, R S Kirsch, D M Coppert Tetrahedron Lett. 32 5441 (1991) 165. A Altamura, C Fusco, L D'Accolti, R Mello, T Prencipe, R Curci Tetrahedron Lett. 32 5445 (1991) 166. R Curci, L D'Accolti, A Detomaso, C Fusco, K Takeuchi, Y Ohga, P E Eaton, Y C Yip Tetrahedron Lett. 34 4559 (1993) 167. L D'Accolti, A Detomaso, C Fusco, A Rosa, R Curci J. Org. Chem.58 3600 (1993) 168. P Bovicelli, A Sanetti, P Lupattelli Tetrahedron 52 10 969 (1996) 169. R Curci, L D'Accolti, A Dinoi, C Fusco, A Rosa Tetrahedron Lett. 37 115 (1996) 170. W Adam, F Prechtl,M J Richter, A K Smerz Tetrahedron Lett. 34 8427 (1993) 171. R Ballini, F Papa, P Bovicelli Tetrahedron Lett. 37 3507 (1996) 172. M Abou-Elzahab,W Adam, C R Saha-MoÈ ller Liebigs Ann. Chem. 445 (1991) 173. G Asensio, G Castellano, R Mello,M E Gonzalez-Nunez J. Org. Chem. 61 5564 (1996) 174. R Curci, L D'Accolti, M Fiorentino, C Fusco,W Adam, M E Gonzalez-Nunez, R Mello Tetrahedron Lett. 33 4225 (1992) 175. P Bovicelli, A Sanetti, R Bernini, P Lupattelli Tetrahedron 53 9755 (1997) 176. E V Dehmlow, N Heiligenstaedt Tetrahedron Lett. 37 5363 (1996) 177.P E Sonnet,M E Lankin, G P McNeill J. Am. Oil Chem. Soc. 72 199 (1995) 178. R Saladino, C Crestini, R Bernini, E Mincione, R Ciafrino Tetrahedron Lett. 36 2665 (1995) 179. T M Hellman, G A Hamilton J. Am. Chem. Soc. 96 1530 (1974) 180. R W Murray, D Gu J. Chem. Soc., Perkin Trans. 2 451 (1994) 181. J T Groves, T E Nemo, R S Myers J. Am. Chem. Soc. 101 1032 (1979) 182. J T Groves, T E Nemo J. Am. Chem. Soc. 105 6243 (1983) 183. R D Bach, J L Andres, M-D Su, J J W McDougall J. Am. Chem. Soc. 115 5768 (1993) 184. F Minisci, L Zhao, F Fontana, A Bravo Tetrahedron Lett. 36 1895 (1995) 185. A Bravo, F Fontana, G Fronza, F Minisci, A Serri Tetrahedron Lett. 36 6945 (1995) 186. A Bravo, H-R Bjorsvik, F Fontana, F Minisci, A Serri J.Org. Chem. 61 9409 (1996) 187. D V Kazakov, N N Kabal'nova, A I Voloshin, V V Shereshovets, V P Kazakov Izv. Akad. Nauk, Ser. Khim. 1395 (1995) a 188. D V Kazakov, N N Kabalnova, S L Khursan, S A Grabovsky, V V Shereshovets React. Kinet. Catal. Lett. 60 131 (1997) 189. D V Kazakov, D R Khusnullina, N N Kabal'nova, S L Khursan, V V Shereshovets Izv. Akad. Nauk, Ser. Khim. 1785 (1997) a 283 190. D R Khusnullina, D V Kazakov, N N Kabal'nova, S L Khursan, V V Shereshovets Kinet. Katal. 39 8 (1998) b 191. V A Belyakov, R F Vasil'ev, G F Fedorova Dokl. Akad. Nauk SSSR 239 344 (1978) c 192. G Asensio, R Mello, M E Gonzalez-Nunez, C Boix, J Royo Tetrahedron Lett. 38 2373 (1997) 193. A Hofland, H Steinberg, T J de Boer Recl. Trav. Chim.Pays-Bas 104 350 (1985) 194. W Adam, L Hadjiarapoglou, X Wang Tetrahedron Lett. 32 1295 (1991) 195. A L Baumstark, P C Vasquez J. Org. Chem. 53 3437 (1988) 196. A L Baumstark, C J McCloskey Tetrahedron Lett. 28 3311 (1987) 197. W Adam, J Halasz, Z Jambor, A Levai, C Nemes, T Patonay, G Toth J. Chem. Soc., Perkin Trans. 1 395 (1996) 198. R W Murray,D L Shiang J. Chem. Soc., Perkin Trans. 2 349 (1990) 199. W Adam, L Hadjiarapoglou Chem. Ber. 123 2077 (1990) 200. M Kurihara, S Ito, N Tsutsumi, N Miyata Tetrahedron Lett. 35 1577 (1994) 201. C W Jones, J P Sankey,W R Sanderson,M C Rocca, S L Wilson J. Chem. Res. (S) 114 (1994) 202. D Yang, M-K Wong, Y-C Yip J. Org. Chem. 60 3887 (1995) 203. R Curci, L D'Accolti, M Fiorentino, A Rosa Tetrahedron Lett.36 5831 (1995) 204. D Yang, X-C Wang, M-K Wong, Y-C Yip, M-W Tang J. Am. Chem. Soc. 118 11 311 (1996) 205. D S Brown, B A Marples, P Smith, L Walton Tetrahedron 51 3587 (1995) 206. M Schulz, S Liebsch, R Kluge, W Adam J. Org. Chem. 62 188 (1997) 207. A Armstrong, P A Clarke, A Wood J. Chem. Soc., Chem. Commun. 849 (1996) 208. R W Murray,M Singh Org. Synth. 74 91 (1997) 209. R M Coates, Z Ho, L Zhu J. Org. Chem. 61 1184 (1996) 210. R W Murray,M Singh, N P Rath J. Org. Chem. 61 7660 (1996) 211. G Person, M Keller, H Prinzbach Liebigs Ann. Chem. 507 (1996) 212. J K Crandall, D J Batal J. Org. Chem. 53 1340 (1988) 213. J K Crandall, D J Batal Tetrahedron Lett. 29 4791 (1988) 214. J K Crandall,D J Batal,D P Sebesta, F Lin J.Org. Chem. 56 1153 (1991) 215. J K Crandall, E Rambo J. Org. Chem. 55 5929 (1990) 216. J K Crandall, D J Batal, F Lin, T Reix, G S Nadol, R A Ng Tetrahedron 48 1427 (1992) 217. W Adam, A Lgvai, J-Y Mgrour, C Nemes, T Patonay Synthesis 268 (1997) 218. W Adam, L P Hadjiarapoglou, A Meffert Tetrahedron Lett. 32 6697 (1991) 219. W Adam, F Prechtl,M J Richter, A K Smerz Tetrahedron Lett. 36 4991 (1995) 220. W Adam, L Hadjiarapoglou, B Nestler Tetrahedron Lett. 31 331 (1990) 221. W Adam, L Hadjiarapoglou, A Smerz Chem. Ber. 124 227 (1991) 222. C Baylon, I Hanna Tetrahedron Lett. 36 6475 (1995) 223. G M Rubottom,M A Vasquez, D R Pelegrina Tetrahedron Lett. 15 4319 (1974) 224. W Adam, L Hadjiarapoglou, V JaÈ ger, J Klicic', B Seidel, X Wang Chem.Ber. 124 2361 (1991) 225. L Troisi, L Cassidei, L Lopez, R Mello, R Curci Tetrahedron Lett. 30 257 (1989) 226. W Adam, L Hadjiarapoglou, J Klicic' Tetrahedron Lett. 31 6517 (1990) 227. W Adam, L Hadjiarapoglou, V Jaeger, B Seidel Tetrahedron Lett. 30 4223 (1989) 228. W Adam, R M Schuhmann J. Organomet. Chem. 487 273 (1995) 229. G Asensio, R Mello, C Boix-Bernardini,M E Gonzalez-Nunez, G Castellano J. Org. Chem. 60 3692 (1995) 230. W Adam, D Reinhardt, H-U Reissing, K Paulini Tetrahedron 51 12257 (1995) 231. W Adam, J Jeko, A Levai, C Nemes, T Patonay, P Sebok Tetrahedron Lett. 36 3669 (1995) 232. W Adam, J Jeko, A Levai, Z Majer, C Nemes, T Patonay, L Parkanyi, P Sebok Tetrahedron: Asymmetry 7 2437 (1996) 233. R Saladino, R Bernini, E Mincione, P Tagliatesta, T Boschi Tetrahedron Lett.37 2647 (1996)284 234. R Saladino, P Lupattelli, E Mincione Tetrahedron Lett. 34 6313 (1993) 235. P E Sonnet, T A Foglia J. Am. Oil Chem. Soc. 73 461 (1996) 236. M Sauter,W Adam Acc. Chem. Res. 28 289 (1995) 237. W Adam, L Hadjiarapoglou, T Mosandl, C R Saha-MoÈ ller, D Wild J. Am. Chem. Soc. 113 8005 (1991) 238. W Adam, L Hadjiarapoglou, T Mosandl, C R Saha-MoÈ ller, D Wild Angew. Chem., Int. Ed. Engl. 30 200 (1991) 239. W Adam, J Bialas, L Hadjiarapoglou,M Sauter Chem. Ber. 125 231 (1992) 240. W Adam, K Peters, M Sauter Synthesis 111 (1994) 241. W Adam,M Sauter Tetrahedron 50 11441 (1994) 242. W Adam,M Sauter Tetrahedron 50 8393 (1994) 243. W Adam, L Hadjiarapoglou, K Peters, M Sauter J.Am. Chem. Soc. 115 8603 (1993) 244. S Oishi, S D Nelson J. Org. Chem. 57 2744 (1992) 245. F Nan, X Chen, Z Xiong, T Li, Y Li Synth. Commun. 24 2319 (1994) 246. J Ashby, B M Elliot, in Comprehensive Heterocyclic Chemistry Vol. 1 (Ed. O Methcohn) (Oxford: Pergamon Press, 1984) p. 135 247. M R Boyd Nature (London) 269 713 (1971) 248. A G Gonzalez, N L Alvarenga, A Estevez-Braun, A G Ravelo, R Estevez-Reyes Tetrahedron 52 10 667 (1996) 249. W Adam, J Bialas, L Hadjiarapoglou, T Patonay Synthesis 49 (1992) 250. W Adam, J Jeko, A Levai, C Nemes, T Patonay Liebigs Ann. Chem. 1547 (1995) 251. T Patonay, A Levai, C Nemes, T Timar, G Toth,W Adam J. Org. Chem. 61 5375 (1996) 252. W Adam, D Golsch, L Hadjiarapoglou, T Patonay Tetrahedron Lett.32 1041 (1991) 253. W Adam, D Golsch, L Hadjiarapoglou, T Patonay J. Org. Chem. 56 7292 (1991) 254. C Nemes, A Levai, T Patonay, G Toth, S Boros, J Halasz, W Adam, D Golsch J. Org. Chem. 59 900 (1994) 255. W Adam, L Hadjiarapoglou, A Levai Synthesis 436 (1992) 256. B A Marples, J P Muxworthy, K H Baggaley Tetrahedron Lett. 32 533 (1991) 257. P Bovicelli, P Lupattelli, E Mincione J. Org. Chem. 59 4304 (1994) 258. S W Baertschi, K D Raney,M P Stone, T M Harris J. Am. Chem. Soc. 110 7929 (1988) 259. R Curci, A Detomaso, T Prencipe, G B Carpenter J. Am. Chem. Soc. 116 8112 (1994) 260. R Curci, A Detomaso, M E Lattanzio, G B Carpenter J. Am. Chem. Soc. 118 11089 (1996) 261. A Messeguer, F Sanchez-Baeza, J Casas, B D Hammock Tetrahedron 47 1291 (1991) 262.A-M Lluch, F Sanchez-Baeza, A Messeguer, C Fusco, R Curci Tetrahedron 49 6299 (1993) 263. M Ferrer, F Sanchez-Baeza, A Messeguer, A Diez,M Rubiralta J. Chem. Soc., Chem. Commun. 293 (1995) 264. R W Murray, D Gu J. Chem. Soc., Perkin Trans. 2 2203 (1993) 265. A L Baumstark, D B Harden J. Org. Chem. 58 7615 (1993) 266. R W Murray,M Singh, B L Williams, H M Moncrieff Tetrahedron Lett. 36 2437 (1995) 267. R W Murray,M Singh, B L Williams, H M Moncrieff J. Org. Chem. 61 1830 (1996) 268. W Adam, A K Smerz J. Org. Chem. 61 3506 (1996) 269. R W Murray, D L Shiang, M Singh J. Org. Chem. 56 3677 (1991) 270. Y Angelis, X Zhang,M Orfanopoulos Tetrahedron Lett. 37 5991 (1996) 271. R G Harvey Acc.Chem. Res. 14 218 (1981) 272. R Mello, F Ciminale,M Fiorentino, C Fusco, T Prencipe,R Curci Tetrahedron Lett. 31 6097 (1990) 273. S K Agarwal, D R Boyd, W B Jennings, R M McGuckin, G A O'Kane Tetrahedron Lett. 30 123 (1989) 274. R W Murray, R Jeyaraman, L Mohan Tetrahedron Lett. 27 2335 (1986) 275. R W Murray, S N Rajadhyaksha, L Mohan J. Org. Chem. 54 5783 (1989) 276. P E Eaton, G E Wicks J. Org. Chem. 53 5353 (1988) 277. R W Murray,M Singh, N Rath Tetrahedron: Asymmetry 7 1611 (1996) V P Kazakov, A I Voloshin, D V Kazakov 278. M D Wittman, R L Halcomb, S J Danishefsky J. Org. Chem. 55 1981 (1990) 279. J K Crandall, T Reix J. Org. Chem. 57 6759 (1992) 280. G A Olah,Q Liao, C-S Lee,G K Surya Prakash Synlett 427 (1993) 281. R W Murray,M Singh Synth.Commun. 19 3509 (1989) 282. R W Murray,M Singh Tetrahedron Lett. 29 4677 (1988) 283. R W Murray,M Singh Magn. Res. Chem. 29 962 (1991) 284. R W Murray,M Singh J. Org. Chem. 55 2954 (1990) 285. M E Brik Tetrahedron Lett. 36 5519 (1995) 286. W Adam, K Briviba, F Duschek, D Golsch, W Kiefer, H Sies J. Chem. Soc., Chem. Commun. 1831 (1995) 287. W Adam, C van Barneveld, D Golsch Tetrahedron 52 2377 (1996) 288. A Altamura, R Curci, J O Edwards J. Org. Chem. 58 7289 (1993) 289. P Camps, D Munoz-Torrero, V Munoz-Torrero Tetrahedron Lett. 36 1917 (1995) 290. W Adam, L Hadjiarapoglou Tetrahedron Lett. 33 469 (1992) 291. W Adam, D Golsch, L Hadjiarapoglou, A Levai, C Nemes, T Patonay Tetrahedron 50 13113 (1994) 292. D Curi, V L Pardini, H Viertler, A L Baumstark, D B Harden Heteroat.Chem. 5 555 (1994) 293. C Baldoli, P Del Buttero, E Licandro, S Maiorana, A Papagni Synlett 666 (1995) 294. E L Clennan, K L Stensaas J. Org. Chem. 61 7911 (1996) 295. S Colonna, N Gaggero Tetrahedron Lett. 30 6233 (1989) 296. R W Murray, R Jeyaraman, M K Pillay J. Org. Chem. 52 746 (1987) 297. W Adam,W Haas, B B Lohray J. Am. Chem. Soc. 113 6202 (1991) 298. W Adam, D Golsch Chem. Ber. 127 1111 (1994) 299. N Gaggero, L D'Accolti, S Colonna, R Curci Tetrahedron Lett. 38 5559 (1997) 300. G Asensio, R Mello, M E Gonzalez-Nunez Tetrahedron Lett. 37 2299 (1996) 301. A Messeguer Acros Org. Acta 1 71 (1995) 302. W Adam, R M Schuhmann Liebigs. Ann. Chem. 635 (1996) 303. W Adam, R M Schuhmann J.Org. Chem. 61 874 (1996) 304. W Adam, J Putterlik, R M Schuhmann, J Sundermeyer Organometallics 15 4586 (1996) 305. W Adam,U Azzena, F Prechtl,K Hindahl,W Malisch Chem. Ber. 125 1409 (1992) 306. W Malisch, M Neumayer, O Fey, W Adam, R Schuhmann Chem. Ber. 128 1257 (1995) 307. E Chelain, R Goumont, L Hamon, A Parlier, M Rudler, H Rudler, J-C Daran, J Vaissermann J. Am. Chem. Soc. 114 8088 (1992) 308. S Sun, J O Edwards, D A Sweigart, L D'Accolti, R Curci Organometallics 14 1545 (1995) 309. W Malisch, K Hindahl, K Gruen, W Adam, F Prechtl, W S Sheldrick J. Organomet. Chem. 509 209 (1996) 310. W A Schenk, J Frisch, W Adam, F Prechtl Inorg. Chem. 31 3329 (1992) 311. W A Schenk, J Frisch,W Adam, F Prechtl Angew. Chem., Int.Ed. Engl. 33 1609 (1994) 312. W A Schenk, J Frisch, M Duerr, N Burzlaff, D Stalke, R Fleischer,W Adam, F Prechtl, A K Smerz Inorg. Chem. 36 2372 (1997) 313. P W N Christian, R Gil, K Muniz-Fernandez, S E Thomas, A T Wierzchleyski J. Chem. Soc., Chem. Commun. 1569 (1994) 314. A M Lluch, F Sanchez-Baeza, F Camps, A Messeguer Tetrahedron Lett. 32 5629 (1991) 315. A M Lluch, L Jordi, F Sanchez-Baeza, S Ricart, F Camps, A Messeguer, J M Moreto Tetrahedron Lett. 33 3021 (1992) 316. J Barluenga, R-M Canteli, J Florez, S Garcia-Granda, A Gutierrez-Rodriguez J. Am. Chem. Soc. 116 6949 (1994) 317. A M Lluch, M Gibert, F Sanchez-Baeza, A Messeguer Tetrahedron 52 3973 (1996) 318. A M Lluch, L Jordi, F Sanchez-Baeza, S Ricart, F Camps, J M Moreto, A Messeguer An.Quim. 90 407 (1994) 319. W Adam,M Muller, F Prechtl J. Org. Chem. 59 2358 (1994) 320. W Adam, F Prechtl Chem. Ber. 127 667 (1994) 321. W Adam, G Asensio, R Curci, M E Gonzalez-Nunez, R Mello J. Am. Chem. Soc. 114 8345 (1992) 322. R W Murray,M K Pillay, R Jeyaraman J. Org. Chem. 53 3007 (1988) 323. R W Murray,M K Pillay Tetrahedron Lett. 29 15 (1988)Dioxiranes: from oxidative transformations to chemiluminescence 324. M Cantos, M Merchan, F Tomas-Vert, B O Roos Chem. Phys. Lett. 229 181 (1994) 325. V Y Elemes, S K Silverman, C Sheu, M Kao, C S Foote, M M Alvarez, R L Whetten Angew. Chem. 104 364 (1992) 326. E M Pearch, T K Kwei, S Lu Polym. Mater. Sci. Eng. 75 178 (1996) 327. WO PCT 91 12 369; Chem. Abstr. 210 522 (1990) 328.T J McDonough,A Marquis,A J Ragauskas, in International Pulp Bleached Conference (Abstracts of Reports), Vancouver, 1994 p. 47 329. D Santiago, A Rodriguez, J Szwec, A L Baumstark, A J Ragauskas Ind. Eng. Chem. Res. 34 400 (1995) 330. K Hunt, C L Lee J. Pulp Pap. Sci. 21 J263 (1995) 331. K G McGrouther, R W Allison Appita J. 48 445 (1995) 332. A J Ragauskas Adv. Oxygen. Proc. 4 177 (1995) 333. Y Sun, D S Argyzopoulos Holzforschung 50 175 (1996) 334. W A Herrmann, R W Fischer, D W Marz Angew. Chem., Int. Ed. Engl. 30 1638 (1991) 335. S Yamazaki, J H Espenson, P Huston Inorg. Chem. 32 4683 (1993) 336. W A Herrmann, R W Fischer, W Scherer, M U Rauch Angew. Chem., Int. Ed. Engl. 32 1157 (1993) 337. W Adam,W A Herrmann, J Lin, C R Saha-MoÈ ller, R W Fischer, J D G Correia Angew.Chem., Int. Ed. Engl. 33 2475 (1994) 338. A M Al-Ajlouni, J H Espenson J. Org. Chem. 61 3969 (1996) 339. R W Murray, K Iyanar, J Chen, J T Wearing Tetrahedron Lett. 36 6415 (1995) 340. R W Murray, K Iyanar, J Chen, J T Wearing Tetrahedron Lett. 37 805 (1996) 341. W Adam, R Curci Chim. Ind. (Milan) 63 20 (1981) 342. N J Turro, H-C Steinmetzer, A Yekta J. Am. Chem. Soc. 95 6470 (1973) 343. V P Kazakov, D V Kazakov, A I Voloshin, N N Kabal'nova, V V Shereshovets Khimiya i Khemilyuminestsentsiya Dioksiranov (The Chemistry and Chemiluminescence of Dioxiranes) (Moscow: Nauka, 1999) 344. V A Belyakov, R F Vasil'ev, in Molekulyarnaya Fotonika (Molec- ular Photonics) (Leningrad: Nauka, 1970) 345. R F Vasil'ev Nature (London) 196 668 (1962) 346. V A Belyakov, R F Vasil'ev Photochem. Photobiol. 11 179 (1979) 347. R F Vasil'ev Progr. React. Kinet. 4 305 (1967) 348. V Ya Shlyapintokh, O N Karpukhin, L M Postnikov, I V Zakharov, A A Vichutinskii, V F Tsepalov Khemilyuminest- sentnye Metody Issledovaniya Medlennykh Khimicheskikh Protsessov (Chemiluminescence Methods of Investigation of Slow Chemical Processes) (Moscow: Nauka, 1966) 349. T Wilson, A P Schaap J. Am. Chem. Soc. 93 4126 (1971) 350. H-C Steinmetzer, P Lechtken, N J Turro Liebigs. Ann. Chem. 1984 (1973) 351. W Adam, E Cancio, O Rodriguez Photochem. Photobiol. 27 617 (1978) 352. P Lechtken, N J Turro Mol. Photochem. 6 95 (1974) 353. G A Tolstikov, G L Sharipov, A I Voloshin, S S Ostakhov, V P Kazakov Izv. Akad. Nauk SSSR, Ser. Khim. 787 (1986) a 354. G L Sharipov, V P Kazakov, G A Tolstikov Izv. Akad. Nauk SSSR, Ser. Phys. 51 559 (1987) 355. S S Ostakhov, G L Sharipov, A I Voloshin, V P Kazakov, G A Tolstikov Dokl. Akad. Nauk SSSR 287 1165 (1986) c 356. G L Sharipov, A I Voloshin, S S Ostakhov, V P Kazakov, G A Tolstikov Khimicheski Initsiirovannaya Elektronoobmennaya Lyuminestsentsiya pri Kataliticheskoi Aktivatsii Razlozheniya Dioksetanov Dipiridil'nym Kompleksom Dvukhvalentnogo Ruteniya [Chemically Initiated Electron Exchange Luminescence at Catalytic Activation of Decomposition of Dioxetanes by Dipyridyl Complex of Bivalent Ruthenium (Preprint)] (Ufa: Institute of Chemistry, Bashkiriya Scientific Centre, Ural Branch of Academy of Science of the USSR, 1989) 357. A I Voloshin, G L Sharipov, V P Kazakov, G A Tolstikov Izv. Akad. Nauk SSSR, Ser. Khim. 1316 (1991) a 358. G J Kavarnos, N J Turro Chem. Rev. 86 401 (1986) 359. S S Miller, K Zahir, A Haim Inorg. Chem. 24 3978 (1985) 360. C S Foote Acc. Chem. Res. 1 104 (1968) 361. K Gollnick, in Singlet Oxygen Reactions with Organic Compounds and Polymers (Eds B Ranby, J F Rabek) (New York: Wiley, 1978) p. 111 362. B M Monroe, in Singlet Oxygen Vol. 1 (Ed. A A Frimer) (Boca Raton, FL: CRC Press, 1985) 285 363. A Lange, H-D Brauer J. Chem. Soc., Perkin Trans. 2 805 (1996) 364. D F Evans, M W Upton J. Chem. Soc., Dalton Trans. 1151 (1985) 365. K Briviba, C R Saha-MoÈ ller,W Adam,H Sies Biochem. Mol. Biol. Int. 38 647 (1996) 366. V I Vedeneev, A E Shilov Fizicheskaya Khimiya. Sovremennye Problemy (Physical Chemistry. Modern Problems) (Moscow: Khimiya, 1985) 367. P Lechtken, A Yekta, N J Turro J. Am. Chem. Soc. 95 3028 (1973) 368. N J Turro, N E Schore, H-C Steinmetzer, A Yekta J. Am. Chem. Soc. 96 1938 (1974) 369. N J Turro, P Lechtken, N E Schore, G Schuster, H-C Steinmetzer, A Yekta Acc. Chem. Res. 7 97 (1974) 370. N J Turro, G B Schuster, J Pouliquen, R Petit, C Mauldin J. Am. Chem. Soc. 96 6799 (1974) 371. A I Voloshin, G L Sharipov, V P Kazakov, G A Tolstikov Dokl. Akad. Nauk SSSR 297 368 (1987) c 372. R G Bulgakov, G Ya Maistrenko, V N Yakovlev, S P Kuleshov, G A Tolstikov, V P Kazakov Dokl. Akad. Nauk SSSR 282 1385 (1985) c 373. R G Bulgakov,V P Kazakov,G A Tolstikov J. Organomet. Chem. 387 11 (1990) 374. R G Bulgakov, V P Kazakov, G A Tolstikov Khemilyuminest- sentsiya Metalloorganicheskikh Soedinenii (Chemiluminescence of Organometallic Compounds) (Moscow: Nauka, 1989) 375. V P Kazakov Khemilyuminestsentsiya Uranila, Lantanoidov i d-Elementov (Chemiluminescence of Uranyl, Lanthanides and d-Elements) (Moscow: Nauka, 1980) 376. V P Kazakov Zh. Fiz. Khim. 39 2936 (1965) d 377. V P Kazakov, Yu K Gusev, G S Parshin, L A Khamidullina Izv. Akad. Nauk SSSR, Ser. Khim. 2634 (1977) a 378. V P Kazakov, R G Bulgakov Radiokhimiya 20 102 (1978) e 379. V P Kazakov, G S Parshin, Yu K Gusev, S V Lotnik, S V Zemskov Dokl. Akad. Nauk SSSR 239 1397 (1978) c 380. V P Kazakov, G S Parshin, R G Bulgakov, L A Khamidullina, D D Afonichev Radiokhimiya 21 199 (1979) e 381. Yu K Gusev, V P Kazakov, L A Khamidullina, S V Lotnik, S V Zemskov, in Khimiya Urana (The Chemistry of Uranium) (Moscow: Nauka, 1981) p. 264 382. A V Mamykin, G S Parshin, V P Kazakov Zh. Fiz. Khim. 58 464 (1984) d 383. A D Karavaev, V P Kazakov Radiokhimiya 27 570 (1985) e 384. V P Kazakov, D D Afonichev, L A Khamidullina, S P Kuleshov Radiokhimiya 29 165 (1987) e 385. S V Lotnik, V M Kalinina, V P Kazakov, G A Tolstikov Dokl. Akad. Nauk SSSR 296 918 (1987) c 386. V A Antipin, G S Parshin, V P Kazakov, S N Zagidullin React. Kinet. Catal. Lett. 27 103 (1985) 387. A I Voloshin, G L Sharipov, V P Kazakov, G A Tolstikov Izv. Akad. Nauk, Ser. Khim. 1056 (1992) a 388. N Sh Ableeva, A I Voloshin, E V Vasil'eva, G L Sharipov, L M Khalilov, V P Kazakov Kinet. Katal. 34 811 (1993) b 389. G L Sharipov, S S Ostakhov, N Sh Ableeva, A I Voloshin, V P Kazakov, G A Tolstikov Izv. Akad. Nauk, Ser. Khim. 1824 391. V P Kazakov, A I Voloshin, V A Antipin, I A Khusainova Izv. (1993) a 390. N Sh Ableeva, A I Voloshin, S S Ostakhov, A G Kukovinets, V N Korobeinikova, V P Kazakov, G A Tolstikov Izv. Akad. Nauk, Ser. Khim. 1762 (1994) a Akad. Nauk, Ser. Khim. 1844 (1995) a 392. V A Antipin, A I Voloshin, S S Ostakhov, V P Kazakov Izv. Akad. Nauk, Ser. Khim. 1159 (1996) a 393. V P Kazakov, A I Voloshin, S S Ostakhov, I A Khusainova Izv. Akad. Nauk, Ser. Khim. 2479 (1996) a 394. V P Kazakov, A I Voloshin, S S Ostakhov, N Sh Ableeva Khim. Vys. Energ. 30 295 (1996) f 395. N Sh Ableeva, A I Voloshin, S S Ostakhov, V P Kazakov, G A Tolstikov Khim. Fiz. 15 34 (1996) g 396. V P Kazakov, A I Voloshin, S S Ostakhov, N Sh Ableeva Khim. Vys. Energ. 31 129 (1997) f 397. V P Kazakov, A I Voloshin, S S Ostakhov, I A Khusainova, E V Zharinova Izv. Akad. Nauk, Ser. Khim. 724 (1997) a 398. V P Kazakov, A I Voloshin, S S Ostakhov, I A Khusainova, E V Zharinova Izv. Akad. Nauk, Ser. Khim. 730 (1997) aV P Kazakov, A I Voloshin, D V Kazakov 286 399. V P Kazakov, A I Voloshin, S S Ostakhov Opt. Spektrosk. 83 860 (1997) h 400. V P Kazakov, A I Voloshin, S S Ostakhov, N Sh Ableeva Khim. Vys. Energ. 30 456 (1996) f 401. V P Kazakov, A I Voloshin, S S Ostakhov Dokl. Akad. Nauk 354 65 (1997) c a�Russ. Bull. Chem. (Engl. Transl.) b�Kinet. Catal. (Engl. Transl.) c�Dokl. Chem. Technol., Dokl. Chem. (Engl. Transl.) d�Russ. J. Phys. Chem. (Engl. Transl.) e�Radiochemistry (Engl. Transl.) f�High Energy Chem. (Engl. Transl.) g�Russ. J. Chem. Phys. (Engl. Transl.) h�Opt. Spectrosc.

ISSN:0036-021X    

出版商:RSC    

年代:1999

数据来源: RSC

摘要:

Russian Chemical Reviews 68 (4) 287 ± 298 (1999) Alkoxy(alkyl)silylalkyl derivatives of nitrogen-containing heterocycles OMTrofimova, N F Chernov,MG Voronkov Contents I. Introduction II. Synthesis III. Chemical properties IV. Biological activities and practical applications Abstract. The published data on the synthesis, properties and transformations of alkoxy(alkyl)silylalkyl derivatives of nitrogen- containing heterocycles of the general formula Het(CH2)nSiX3 are surveyed and systematised. Data on the biological activities and applications of these compounds are presented. The bibliography includes 255 references. I. Introduction Considerable interest in organosilicon compounds containing a heterocyclic fragment in a hydrocarbon chain linked to the silicon atom is due to their valuable properties.These compounds served as the basis for the preparation of a large series of adsorbents, immobilised catalysts, synthetic intermediates, medicinal drugs, pesticides and other substances endowed with specific biological activities. To date, a great number of publications are devoted to organosilicon derivatives in which the silicon atom is directly linked to a heterocyclic substituent (e.g., see, Refs 1 ± 7). How- ever, the publications which describe carbofunctional organo- silicon compounds with a silicon atom attached to the heterocyclic fragment through a hydrocarbon bridge are still few in number. Among those, special mention should be made of the review 8 which describes the compounds containing a heterocyclic sub- stituent with one nitrogen atom (the studies surveyed therein had been published before 1970) and two more recent reviews 9, 10 concerned with the synthesis of organosilicon derivatives of pyridine and quinoline.The present review gives a systematic and critical analysis of the data published after 1970 concerning heterylalkylsilanes containing at least one nitrogen atom in their heterocycles. OMTrofimova Irkutsk Institute of Chemistry, Siberian Branch of the Russian Academy of Sciences, ul. Favorskogo 1, 664033 Irkutsk, Russian Federation. Fax (7-395) 239 60 46. Tel. (7-395) 246 25 45 N F Chernov Irkutsk State Pedagogical University, ul. Nizhnyaya Naber- ezhnaya 6, 664011 Irkutsk, Russian Federation.Fax (7-395) 224 05 59. Tel. (7-395) 251 01 33 MG Voronkov Russian Academy of Sciences. Russian Federation. Tel. (7-395) 246 24 00. E-mail: voronkov@irioch.irk.ru Received 28 May 1998 Uspekhi Khimii 68 (4) 318 ± 330 (1999); translated by R L Birnova #1999 Russian Academy of Sciences and Turpion Ltd UDC 547.245 : 547.78 287 287 292 294 II. Synthesis 1. Organometallic synthesis One of the methods for preparing alkoxy(alkyl)silylalkyl deriva- tives of nitrogen-containing heterocycles in which the silicon atom is linked to the nitrogen or the carbon atom through a hydro- carbon bridge, 7(CH2)n7, where n=1, 3, is based on the reaction of organolithium, -sodium, -potassium or -magnesium derivatives of the corresponding heterocycles with silicon-substi- tuted (chloroalkyl)silanes:11 ± 70 R1M+Cl(CH2)nSiR2m(OR3)37m R1(CH2)nSiR2m(OR3)37m+MCl R1=N- or C-heteryl; R2, R3=Me, Et; M=Li, Na, K, MgBr, ZnCl; n=1, 3; m=0±3.Thus silicon-substituted N-heterylalkylsilanes were obtained from the corresponding alkoxy(alkyl)chloroalkylsilanes and N-potassium derivatives of phthalimide,11 imidazole, 1,2,4-tri- azole,12, 13 benzothiazinone,14 piperidine, perhydroazepine, mor- pholine 15 and purine 16 in boiling benzene or toluene. The use of Bu4NBr as a phase transfer catalyst permits one to reduce the reaction time.12 The reaction of C- or N-sodium derivatives of quinoline,17, 18 2-pyrrolidinone,19 substituted 1,2,4-triazole,20 ± 31 imida- zole,22, 23, 26, 30 ± 35 uracil, thymine and adenine,36 pyridone,37 pyr- azine 38 and benzotriazole 39 with Cl(CH2)nSiR2m(OR3)37m (where n=1, 3 and m=0 ± 3) in DMF gave the corresponding C- or N- substituted heterylalkylsilanes.The silicon-substituted (heterylthiomethyl)silanes HetSCH2. .SiMen(OMe)37n, where n=0 or 1, were synthesised in 65%± 86% yields by the reaction of S-sodium derivatives of 8-mercap- toquinoline, 2-mercaptobenzooxazole, 2-mercaptobenzothiazole and 2-mercaptobenzoimidazole with trimethoxy-(chloromethyl)- and dimethoxymethyl(chloromethyl)silanes (1) in a polar aprotic solvent (DMF, DMSO) for 2 ± 3 h at 80 ± 90 8C.40 ± 42 N DMF +ClCH2SiMen(OMe)37n SNa 1288 N SCH2SiMen(OMe)37nN N DMF SNa+1 SCH2SiMen(OMe)37n Y Y n=0, 1; Y=NH, O, S.The synthesis of trimethylsilylalkyl-substituted pyrrole,43, 44 piperidine,45 pyridine,46 ± 49 2-pyridone,50 pyrrolidine,51, 52 pyrazole, imidazole, benzoimidazole,53 quinoline,54 ± 56 3,4-di- methylisoxazole,57, 58 2-mercaptobenzothiazole,59, 60 benzo- thiazole,61 indole,62 tetrazole,63 pyrimidine 64 and carbazole 65 makes wide use of C-, N- or S-lithium derivatives of these hetero- cycles. The latter are obtained by the reaction of the correspond- ing heterocyclic compounds with RLi (R=Me, Bun, But, Ph, NPri2) in THF or hexane. Thus the 2-ethylpyridine carbanion prepared by the reaction of ethylpyridine with butyllithium (THF, 770 8C) readily reacts with tert-butyldimethylchlorosilane. In this case, the silyl group enters into the a-position of the alkyl substituent.47 The reactions of 2-, 3- and 4-methylquinoline 54 with lithium diisopropylamide and then with trimethylchlorosilane give rise to 2-, 3- and 4-trimethylsilylmethyl derivatives (in this case, 3-sub- stituted derivatives are formed with the lowest yield).Metallation of 2-methyl-6-(2,5-dimethylpyrrolo)pyridine (THF ± hexane, 725 8C) with lithium diisopropylamide and subsequent reaction with trimethylchlorosilane gave 2-trimethylsilylmethyl-6-(2,5- dimethylpyrrolo)pyridine in 77% yield.44 Lithium derivative of 2-methylbenzothiazole reacts with trimethylchlorosilane analogously.59, 60 The reaction of halogen-substituted pyridines and quinolines with trimethylsilylmethylmagnesium chloride or -zinc chloride in ether in the presence of a catalytic amount of Cl2Ni[Ph2P(CH2)3PPh2] afforded 2- and 3-trimethylsilylmethyl- pyridines (72% and 35% yields, respectively), 2,6-bis(trimethyl- silylmethyl)pyridine (yield 69%) and trimethylsilylmethylquino- line (yield 44%).66 The reaction of 2-bromopyridine with (1-trimethyl- silylvinyl)zinc chloride or -magnesium bromide in the presence of a palladium ± phosphine complex results in 2-(1-trimethyl- silylvinyl)pyridine.67, 68 +MXBr CH2 N N +Me3SiC CH2 Br MX SiMe3 MX=MgBr, ZnCl.2-(3-Trimethylsilylbut-3-enyl)pyridine was obtained unexpec- tedly when a fourfold excess of 2-bromopyridine was used. (2-Trimethylsilylvinyl)magnesium bromide or -zinc chloride was used in the synthesis of the corresponding organosilicon derivatives of pyrrole and indole.67 Thus trimethyl(a-bromo- vinyl)silane reacts with 1-methyl-2-pyrrolyl- and 1-methyl-2-indo- lylmagnesium bromide or -zinc chloride in the presence of a catalytic amount of Cl2Pd[Ph2P(CH2)4PPh2] to give the corre- sponding 1-methyl-2-trimethylsilylvinyl derivatives of these het- erocycles in 74%± 87% yields.67 For example: CH2 Br +MXBr MX + CH2 N N SiMe3 Me3Si Me Me MX=MgBr, ZnCl.The reaction of 6-methylpyridine with methyl chloroformate and trimethylsilylethynylmagnesium bromide gives exclusively 2-trimethylsilylethynyl-6-methyl-N-methoxycarbonyl-1,2-dihydro- pyridine (yield 79%).69 OM Trofimova, N F Chernov,M G Voronkov The reaction of 7-chloro-4-(4-iodopyrazolo)quinoline with CuI and Me3SiC:CH in the presence of Cl2Pd(PPh3)2 gives 7-chloro-4-(4-trimethylsilylethynylpyrazolo)quinoline.70 2.Amination reactions The following methods are also used in the synthesis of alkox- y(alkyl)silylalkyl derivatives of nitrogen-containing heterocycles: 1. Reaction of the corresponding derivatives of (halogenoal- kyl)silanes X(CH2)nSiR1m(OR2)37m with compounds containing an endocyclic ( NH) group. 2. Reaction of halogen-substituted nitrogenous heterocycles with organosilicon derivatives containing a (CH2)nNH2 group at the Si atom. 3. Attachment of substituted nitrogenous heterocycles con- taining endocyclic ( NH) groups with an active hydrogen atom to unsaturated organosilicon compounds. Organosilicon derivatives of morpholine,71 perhydroaze- pine,71 ± 73 piperazine,71, 73, 74 piperidine,71, 72, 74, 75 pyrroli- dine 71 ± 73, 76 and imidazole 77, 78 were obtained by heating trialkyl(chloroalkyl)- or trialkoxy(chloroalkyl)-silanes with an excess of the corresponding N-heterocycle which acts simulta- neously as an acceptor of hydrogen chloride: R1R22 Si(CH2)nCl+2HN R1R22 Si(CH2)nN + NH.HCl R1R22 Si =Me3Si, Et3Si, Me(EtO)2Si, (EtO)3Si, Me(Me3SiO)2Si, (Me3SiO)3Si; n=1, 3; is a nitrogen-containing heterocyclic base. Hereinafter HN This reaction is carried out in a boiling non-polar solvent (benzene, hexane, toluene). Trialkoxy(chloromethyl)silanes react faster than the corresponding trialkyl derivatives. The synthesis of silicon-substituted N-silylmethyllac- tams,79 ± 81 1-trialkylsilylmethyl(propyl)piperazine 82 and 1-trime- thylsilylmethyl-1,2,4-triazole 83 ± 85 was carried out in the presence of anhydrous potassium carbonate or sodium carbonate.Siliconalkylation of pyrrole, carbazole, pyrazole, imidazole, benzoimidazole, 1,2,4-triazole, 1,2,3-benzotriazole and tetrazole with trialkyl(3-halogenopropyl)silanes gave the corresponding N-(3-trialkylsilylpropyl)azoles in 80%± 90% yields.86, 87 The reaction was carried out in a biphasic system (benzene ±60% aqueous KOH) with boiling for 4 ± 6 h in the presence of 5 mol.% of tetrabutylammonium hydrogen sulfate as a phase transfer catalyst. Attempts to obtain these compounds by hydrosilylation of N-allyl derivatives of the corresponding azoles failed.86 The reaction of 4-amino-1,2,4-triazole with trimethyl(halogeno-meth- yl)silanes in DMSO (8 h, 80 8C) afforded 4-amino-1-trimethylsi- lylmethyl-1,2,4-triazolium halides.4-Amino-3- trimethylsilylmethyl-1,2,4-triazole is formed when boiling nitro- methane is used as a solvent.88 Triethylamine was used as a hydrogen chloride acceptor in the synthesis of N-(trialkylsilylalkyl)- and N-(trialkoxysilylalkyl) derivatives of piperazine,89 3,5-dimethylpyrazole,90 1,2,3,4-tetra- hydro(iso)quinoline,91 ± 93 pyrrolidone 94 and other lactams.95 This reaction is carried out in boiling toluene or xylene. N,N 0- Bis(triethoxysilylalkyl)piperazines were obtained by heating tri- ethoxy(chloroalkyl)silane with piperazine in a 2 : 1 molar ratio.89 Heating of quinoline-2- and -4-carbonyl chlorides,92 9-chlor- oacridine 96 and chloroquinolines 91,97 ± 99 with (3-aminopropyl)- trialkylsilanes gives the corresponding 3-(trialkylsilyl)propyl- amino derivatives of these heterocycles. N N 2 +H2N(CH2)3SiR1R2 Cl 7HCl NH(CH2)3SiR1R22 R1R22 Si =Et3Si, MeBun2 Si, BuiMe2Si.Alkoxy(alkyl)silylalkyl derivatives of nitrogen-containing heterocycles Their isolation is usually simplified when diglyme is used as a solvent and triethylamine is used as a hydrogen chloride acceptor. A two-step procedure for the synthesis of N-[3-(trialkoxysi- lyl)propyl]phthalimide has been developed.The first step con- sisted in condensation of phthalic anhydride with 2-amino- pyridine to give the corresponding imide; its interaction with (3-aminopropyl)trialkoxysilane (toluene, 10 ± 15 h) resulted in 3-(trialkoxysilyl)propylphthalimide with good yield.100 O 7H2O O +H2N N O O H2N(CH2)3Si(OR)3 N N O ON (CH2)3Si(OR)3 +H2N N O R=Me, Et.Heterocycles containing an endocyclic NH group are smoothly and regioselectively added to unsaturated organosilicon compounds containing a SiCH=CH2 or SiCH2CH=CH2 frag- ment in the presence of alkali metals (Li, Na,Kor their amides). In both cases, the adducts formed contain a nitrogen atom in the b- position relative to the silicon atom. The addition of pyrrolidine,71 perhydroazepine,71 piperazine,82 3,5-dimethylpyrazole, imida- zole, benzoimidazole,90, 101 3(5)-methylpyrazole,102 aziridine,103 piperidine 71, 104, 105 and azetidine 106 to vinyltrialkyl- and vinyl- trialkoxy-silanes proceeds rather easily even at 20 ± 75 8C.The adducts are formed in 70% ± 85% yields. R3SiCH CH2 + HN R3SiCH2CH2N R=Alk, AlkO. The rate of addition of nitrogenous heterocycles to silicon- substituted vinylsilanes depends substantially on the nature of the solvent. Thus the yields of the addition products of aziridine and piperidine to triethylvinylsilane in 2 h under identical conditions were 39% and 72% in the absence of a solvent, 20% and 15% in n-heptane and 55% and 92% in THF.103 The nature of the substituents at the silicon atom has also a profound effect on the reactivity of the original silicon-substituted vinylsilanes. Thus the yield of 2-(aziridinoethyl)triethylsilane formed in the reaction of triethylvinylsilane with aziridine is 90% (7 h, 100 8C).2-(Aziridinoethyl)triethoxysilane, the addition product of aziridine to triethoxyvinylsilane, was obtained in 69% yield in 10 h at 100 8C. The rate of catalysed addition ofN-hetero- cycles to silicon-substituted vinylsilanes R1R22 SiCH=CH2 increases in the following order depending on the substituents R1 and R2 at the silicon atom: (OEt)Me2<Et3<Me3<Me2Ph<- MePh2. This was ascribed to an increase in the pp ± dp interaction of the vinyl group with the silicon atom which resulted in electron density displacement toward the a-carbon.103 At present, this effect is interpreted as s ± p conjugation, i.e., the interaction of the C=C bond p-orbital with the Si7C bond s-orbitals.The decrease in the rate of addition of N-heterocycles to triethoxyvi- nylsilane was attributed to the consumption of the catalyst upon cleavage of the Si7OR bond.103 As the double bond in compounds of the R1R22 Si(CH2)nCH=CH2 series, where n=0, 1 and 2 becomes more distant from the silicon atom, the rate of addition of 289 N-heterocycles decreases. In the case of n=1, b-elimination often accompanies the addition reaction. R1R22 SiCH2CH CH2 + HNR1=Ph, R2=Me R1=R2=Et Et3SiCH2CHMeN N +H2C CHMe PhMe2Si The yield of the addition product of aziridine to allyltriethyl- silane is 35%. However, aziridine is not added to allyldimethyl- phenylsilane, the b-degradation product, viz., azidirinyl- dimethylphenylsilane (10% yield), and propene are formed instead.105 3.Hydrosilylation reactions Hydrosilylation of heterylalkenes usually gives a mixture of two isomers the yields and ratio of which depend on the structure of each of the reagents and the catalyst as well as on reaction conditions (solvent, temperature). R1R22 SiH+ H2C CHN +R1R22 SiCH2CH2N R1R22 SiC(Me)HN R1, R2=Alk, AlkO, Cl. Trichlorosilane is added to 2-vinyl-, 4-vinyl- and 2,6-dimethyl- 4-vinylpyridines in the absence of a catalyst to give the corre- sponding pyridylethyltrichlorosilanes.8 It is assumed that the role of a catalyst is played by the heterocyclic base itself. Labile yellow complexes Cl3SiH . nB (n=3 for 4-vinylpyridine; n=4 for 2-vinylpyridine) are intermediate products of this reaction.Triorganyl- and diorganyl-chlorosilanes are added to the same vinylpyridines only in the presence of catalysts. Thus the corresponding b-adducts are formed in the presence of an Me2NCH2CH2NMe2±Cu2Cl2 complex, while a mixture of a- and b-adducts with the predominance of the former is formed in H2PtCl6-catalysed hydrosilylation of 2-vinylpyridine.107 In the absence of a catalyst, triethylsilane does not react with 2- and 4-vinylpyridines, whereas in the presence of H2PtCl6 it is added to 4-vinylpyridine and 2-methyl-5-vinylpyridine to give solely b-adducts (in 46% and 36% yields, respectively). Hydrosilylation of 2-vinylquinoline catalysed byH2PtCl6 also results in a mixture of a- and b-adducts.Thus ethyldichlorosilane is added to 2-vinylquinoline to give predominantly the b-adduct (75% yield); trialkylsilanes give a mixture of regioisomers with the predominance of the a-adduct (10 h, 120 ± 160 8C, overall yield 65%), while triethoxysilane gives a mixture of a- and b-adducts in a 1 : 1 ratio. The use of non-polar aprotic solvents (xylene, dioxane, diglyme) has no effect on the ratio of isomeric adducts but permits one to increase the total yield from 55% to 70%.108 As for polar solvents (pyridine, quinoline), these favour the forma- tion of the b-isomer; the total yield of the adducts decreases to 40% under these conditions. No hydrosilylation takes place in DMF. 2-(1-Triethoxysilylethyl)pyrrolidone 109 ± 111 and 2-(1-tri- ethoxysilylethoxy)perhydroazepine 112, 113 were obtained by the reaction of N-vinylpyrrolidone and N-vinylcaprolactam with triethoxysilane.This reaction was catalysed by rhodium or palladium complexes, rhodium dicarbonyl acetylacetonate being the most efficient catalyst.111, 112 With this catalyst, the reaction was selective and gave only the a-adduct in 73% yield. Hydrosilylation of 2- and 2,3-substituted 1-vinylpyrroles and 1-vinyl-4,5,6,7-tetrahydroindole with triethylsilane catalysed by H2PtCl6 and ClRh(PPh3)3 (4 ± 10 h, 80 ± 100 8C) was highly regioselective and resulted exclusively in the b-adducts in 55%± 80% yields.114 ± 118 The use of polar aprotic solvents (THF, acetone) and increase in the reaction time allow one to increase the yield of the adduct up to 90%.No hydrosilylation of290 these 1-vinylpyrroles with alkyldichloro-, trichloro- and trialk- oxysilanes occurred. Hydrosilylation of N-allyl pyrrolidine, -piperidine,71, 119 -N0-methylpiperazine,120 -morpholine 120, 121 and -benzotria- zole 122 with triorganylsilanes catalysed by 0.1 MH2PtCl6 resulted in N-(3-triorganylsilylpropyl)derivatives of the corresponding heterocycles. R1R22 SiCH2CH2CH2N R1R22 SiH +H2C CHCH2N R1=Me, R2=Et, Pr, Bu, C5H11, Ph, Cl; R1=Et, R2=Et, Pr, Bu; R1=R2=Pr, Bu, EtO. No individual reaction products could be obtained upon hydrosilylation of N-allylcarbazole with ethyldichlorosilane.123 Hydrosilylation of N-propargyl-substituted pyrrolidine, piperidine, perhydroazepine and morpholine with triethylsilane in the presence of H2PtCl6 gives the g-adducts with a trans- structure.71, 124, 125 Et3SiCH CHCH2N Et3SiH+HC CCH2N The yields of the hydrosilylation products formed upon 10-h boiling of the reaction mixture vary from 25% to 53%.Substitu- tion of silanes with more electronegative substituents for triethyl- silane favours the formation of the a-adduct. 4. Cyclisation reactions The reaction of carbohydrazides with ethyl b-trimethyl- silylpropionimidate (2) yields 3-alkyl-5-(2-trimethylsilylethyl)- 1,2,4-triazoles.126 Trimethylsilylethylamidrazones are the primary products of this reaction; their intramolecular cyclisation results in the corresponding organosilicon derivatives of 1,2,4-triazole upon heating in vacuo.NH O Me3SiCH2CH2COEt+ H2NNHCR 7HOEt 2 O NH2N NHCR Me3SiCH2CH2C 7H2O N N R Me3SiCH2CH2 NH R=H, Me. D Dicarboxylic acid dihydrazides are converted into 3,3 0-R- di[5-(2-trimethylsilyl)ethyl]-1,2,4-triazoles less easily (only upon heating to 200 8C). O O 2 2+H2NNHCRCNHNH2 72HOEt NH2 NH2 D O O Me3SiCH2CH2C NNHCRCNHN CCH2CH2SiMe372H2O N N N N CH2CH2SiMe3 R Me3SiCH2CH2 NH NH R=CH2, (CH2)4, C6H4. The addition of ethyl N,N-dichlorocarbamate to allyltrime- thylsilane (3) with subsequent reduction with sodium hydrogen- sulfite and dehydrochlorination affords ethyl-N-chloro-N-(2- chloro-3-trimethylsilylpropyl)carbamate and ethyl-N-chloro-N- (1-chloromethyl-2-trimethylsilylethyl)carbamate.Intramolecular alkylation of the latter results in ethyl 2-(trimethylsilylmethyl)a- ziridine-2-carboxylate in 20% yield.127 OM Trofimova, N F Chernov,M G Voronkov Cu2Cl2 ± CCl4 1) NaHSO3 2) NaOH Me3SiCH2CH CH2+Cl2NCOOEt 3 Me3SiCH2CHCH2NCOOEt+Me3SiCH2CHCH2Cl NCl Cl Cl COOEt CH2 Me3SiCH2CH NCOOEt The reaction of allyltrimethylsilane with PhMeNCH2O. .C(O)Me in dichloromethane results ultimately in the correspond- ing 4-trimethylsilylmethyl derivative of 1,2,3,4-tetrahydroquino- line.128 CH2SiMe3 + MeCOOH 3+ CH2OCOMe N N Me Me 4a,b The addition of nitrile oxides to vinyl- and allyltrialkylsilanes 4 gave the corresponding organosilicon derivatives of 4,5-dihy- droisoxazole 5 in 50%± 70% yields.129, 130 R1R2R3Si(CH2)nCH CH2 + ON CR4 R4 R1R2R3Si(CH2)n 5 O N R1=R2=R3=Me (a), Et (b); n=0, 1; R4=Br, Ph, 4-C6H4NO2.The rate of this reaction decreased upon substitution of phenyl or methoxy groups, having a negative inductive effect for methyl or ethyl groups at the silicon atom. Vinyl- and allyltrialkylsilanes 4 react with nitroethane or 1-nitropropane in the presence of phenyl isocyanate and catalytic amounts of Et3N in benzene to give the corresponding 3-alkyl-5- trialkylsilylisoxazolines 5 in 64%± 88% yields.131 R4 R4CH2NO2 NEt3 R1R2R3Si(CH2)n 5 O N R1R2R3Si(CH2)nCH CH2 4 R1=R2=R3=Alk; n=0, 1; R4=Me, Et. The reaction of vinyl- and allyltrialkyl(aryl)silanes [R1= R2=R3=Me (4a), Ph (4c)] with hydroxyamoyl halides proceeds regiospecifically and yields only one isomer.R1R2R3Si(CH2)nCH CH2+R4C NOH 4a,c X R4 R1R2R3Si(CH2)n 5 O N R1=R2=R3=Me (a), Ph (c); n=0, 1; R4=Ph, COOEt, Br; X=Cl, Br. The reaction of trinitromethane O-methyl ester with vinyl- and allyltrimethylsilanes (4a) results in N-methoxy-3,3-dinitro-5- (trimethylsilyl)- and -5-(trimethylsilylmethyl)isoxazolidine.130 Me3Si(CH2)nCH CH2 + (O2N)2C NOMe 4a O NO2 Me3Si(CH2)n NO2 O N n=0, 1. OMe The reaction of these silanes with diethyl nitromalonate O-methyl ester proceeds in a similar way.132Alkoxy(alkyl)silylalkyl derivatives of nitrogen-containing heterocycles The reaction of dinitromethane O-methyl ester with allyl(tri- methyl)silane is also accompanied by the formation of a cyclic adduct.However, 3-nitro-5-(trimethylsilylmethyl)isox-azoline is formed in high yield instead of the expected product, N-methoxy- 3-nitro-5-(trimethylsilylmethyl)isoxazolidine. O2N NOMe C Me3SiCH2CH CH2+ 7HOMe H 3 O NO2 Me3SiCH2 O N It can be inferred from these data that the cyclisation is regiospecific, viz., the oxygen atom always attacks the least hydrogenated carbon atom. At 50 ± 75 8C, triorganylsilylalkylamines react with divinyl sulfoxide to give 4-(triorganylsilylalkyl)tetrahydro-1,4-thiazine oxides (in 62%± 80% yields).133 At lower temperatures (30 ± 50 8C), a linear monoadduct is predominantly formed. R1R22 Si(CH2)nNH2+OS(CH CH2)2 O SO R1R22 Si(CH2)nNHCH2CH2S R1R22 Si(CH2)nN CH CH2 R1=Me: R2=Me, Et, Bu; R1=R2 =Et, EtO; n=1, 3.Me S Si NCCH2CH2 Cyclisation of methyl(2-cyanoethyl)diethoxysilane with ethyl- enediamine in the presence of sulfur as a catalyst gives 2-(2- methyldiethoxysilylethyl)-4,5-dihydroimidazole.134 OEt+H2NCH2CH2NH2 OEt NH CH2CH2SiMe(OEt)2 N 5. Transsilylation reactions The reactions of halogeno- and alkoxydimethyl(chloro-methyl)- silanes ClCH2SiMe2X with N-trimethylsilyl derivatives of 2- piperidone,135 ± 144 pyrrolidone,81, 136, 138 ± 148 caprolac- tam,81, 138, 139, 141 ± 144, 148 butyrolactam 139 and morpholinone 149 occur in three steps: (a) transsilylation (substitution of CH2Si- Me2Cl for SiMe3); (b) intramolecular silylmethylation of the oxygen with migration of the chlorine atom from the carbon atom to silicon and (c) O,N-migration of the silylmethyl group.For instance: a b +ClCH2SiMe2X O O N N 7Me3SiX SiMe3 Me2SiCH2Cl A c O O N N Me Me Si Si CH2 H2C Me Me Cl Cl C B X=F, Cl, Br, I, OR. Data from X-ray analysis148 confirmed the conclusion that the silicon atom in O- (compound B) and N-alkylation (compound C) products is five-coordinate. It should be noted that N-trimethyl- silyl derivatives of piperidone and caprolactam react with ClCH2SiMe2X at room temperature, whereas the N-trimethylsilyl derivative of butyrolactam reacts with these silanes at 110 ± 130 8C.139 This reaction is catalysed by AlCl3, Me3 SiO- SO2CF3 or PhNEt2. In this case, the reaction time decreases 291 from 3 to 0.5 h but the yield of the final product does not change (32% ± 71%).142 In the reaction of ClCH2SiR1n (OR2)37n with N-trimethylsilyl- substituted 3,5-dimethylpyrazole, imidazole, benzoimida- zole 90, 150, 151 and 2,20-dipyridylamine,152 the main N-silylmeth- ylation reaction (reaction a) is accompanied by transsilylation (reaction b): NSiMe3+ClCH2SiR1n (OR2)37n a NCH2SiR1n (OR2)37n +ClSiMe3 b NSiR1n (OR2)27m +R2OSiMe3 CH2Cl R1, R2 =Me, Et; n=073; m=0, 2.Thus in the case of 3(5)-methylpyrazole, the ratio of silylme- thylation and transsilylation products is 85 : 15.102 The reaction of 8-trimethylsiloxyquinoline (6) with dimethyl(- chloromethyl)chlorosilane proceeds according to the following scheme:153, 154 +ClMe2SiCH2Cl 7Me3SiCl N + OSiMe3 6 N Cl¡ .N O OSiMe2CH2Cl Si Me Me Methyl(chloromethyl)dihalogenosilanes react with 8-tri- methylsiloxyquinoline to give a spirocyclic ionic derivative of five-coordinate silicon. 6+ F2MeSiCH2Cl 7Me3SiF + 6 N Cl¡ Me 7Me3SiF N O Si Me O Si N O CH2Cl F This review provides only a superficial description of trans- silylation reactions resulting in heterocyclic derivatives of hyper- valent silicon, because they have been surveyed in other reviews.141, 142, 146, 148 6. Miscellaneous reactions 2-(30-Trimethylsilylpropyl)benzothiazole was obtained by the reaction of 2-aminobenzenethiol with 3-trimethylsilylbutyryl chloride (7) in a polar solvent and in the presence of triethylamine (50 ± 150 8C).155 O NH2 N + Me3Si(CH2)3C (CH2)3SiMe3 S 7HCl, Cl 7H2O 7 SH 1,2,3,4-Tetrahydroquinoline, 1,2,3,4-tetrahydroisoquinoline and N-methylpiperazine are more reactive than 8-hydroxy- quinoline with respect to the acid chloride 7 in inert solvents (ether, hexane) at 0 ± 10 8C.156292 O NH +7 N C(CH2)3SiMe3 N N O +7 OH OC(CH2)3SiMe3 Thermal homolytic addition of 2-, 3- and 4-methylpyridines to vinyltrimethylsilane in the presence of (ButO)2 at 350 8C gives 2-, 3- and 4-(3-trimethylsilylpropyl)pyridines in low yields (12% ± 28%).157 (CH2)3SiMe3 Me +H2C CHSiMe3 N N O The reaction of 2,4-bis(trimethylsilyl)uracil with aromatic (benzaldehyde) and heteroaromatic (furfural, 5-nitrofurfural, furylacrolein) aldehydes gave N-substituted siloxymethyluracil derivatives in 16% yield.158 OSiMe3 X X N HN +RCHO N N O Me3SiO Me3SiOCHR X=H, F; R=Ph, 2-C4H3O, 2-C4H3OCH CH, 2-(5-NO2C4H3O). (3-mercapto-1,2,4-triazole,159 compounds Heterocyclic 2-mercapto derivatives of 1-methylimidazole,160 benzoimidazole, benzothiazole,161 N-substituted benzoimidazoles,162, 163 benzo- triazoles 164 and 3-amino-1,2,4-triazole 165) containing active hydrogen atoms react at 120 8C with 3-glycidoxypropyl-(alkox- y)alkylsilanes to give the corresponding azoles 8.BH+ CH2O(CH2)3SiR13¡n(OR2)n OBCH2CHCH2O(CH2)3SiR13¡n(OR2)n OH 8 HN BH=HetSH, ; R1, R2 =Alk(C17C3); n=073. For R2=Me and n=3, a cyclic intramolecular transester- ification product is formed in addition to the azole. O Si(OMe)2 O BH2C The zwitter-ionic spirocyclic bis(2,3-naphthylenediolato)[2- (pyrrolidino)ethyl]silicate was obtained by the reaction of 2,3- dihydroxynaphthalene with (2-pyrrolidinoethyl)silanes.166 OH+ R1R2R3Si(CH2)2N OH O O Si 7 O O + (CH2)2NH R1=OMe, R2=Ph, R3=OMe, C6H11; R1=R2=R3=OMe. In the case of silanes with R1=OMe, R2=Ph and R3=C6H11, the formation of the zwitter-ionic silicate (yield OM Trofimova, N F Chernov,M G Voronkov 81%) is accompanied by two unusual reactions involving cleavage of the Si7C bonds [Si7C(Ph) and Si7C(C6H11)] under mild conditions.166 III.Chemical properties 1. Reduction Reduction of silicon-substituted heterylalkylsilanes containing reactive substituents at the silicon atom was used to obtain the corresponding derivatives having the Si7H bond.Thus the reaction of alkoxy(alkyl)(2-aziridinoethyl)silanes with lithium aluminium hydride occurs under mild conditions at equimolar ratios of the reagents.75, 167 LiAlH4 R1n (R2O)37nSi(CH2)mN(CH2)x 7R2OH R1n H37nSi(CH2)mN(CH2)x R1, R2=H, Alk; n=0±2; m=073, 5; x=2, 5. The reactivity of the functional groups at the silicon atom (OR2 and H) in the starting compounds and reaction products strongly depends on the relative remoteness of the silicon and nitrogen atoms. When the nitrogen atom is in the a-position relative to the silicon atom, the yield of the reduction products drops drastically. Thus the yields of R1n H37nSi(CH2)mN(CH2)5 are 12%± 15% for m=1, whereas for m=3 and 5 the yields are 55%± 60%.N-substituted 3-trialkylsilylalkylpyrrolidones are reduced with lithium aluminium hydride to the corresponding pyrrolidine derivatives (yields 58%± 60%).146 (CH2)nSiR2R32 (CH2)nSiR2R32 LiAlH4 O N N R1 R1 R1=Me: R2=Me, R3=Ph; R2=R3=Me, Et; n=0, 1. 2. Desilylation The Si7CH2 bond in benzyltrimethylsilane and 1-(trimethyl- silylmethyl)pyrrole is cleaved with alcoholic alkali; this latter reaction occurs with greater difficulty.8 OH7 RMe + EtOSiMe3 RCH2SiMe3+HOEt . R=Ph,N At 550 8C, 1-(trimethylsilylmethyl)pyrrole is isomerised to 2-(trimethylsilylmethyl)pyrrole in 39% yield.8 550 8C NH NCH2SiMe3 CH2SiMe3 The Si7CH2 bond in 2-trimethylsilylmethylpyridine is cleaved even with 95% EtOH to give 2-methylpyridine and hexamethyldisiloxane (82%).EtOH +0.5H2O +0.5Me3SiOSiMe3 CH3 N N CH2SiMe3 Apparently, this reaction is initiated by the water present in the alcohol and proceeds autocatalytically and in contrast with 2-trimethylsilylpyridine it needs prolonged (48 h) heating.9 This reaction is catalysed by alkalis and acids.168 Acetic acid can be used instead of 95% ethyl alcohol.8 The rate of alkaline hydrolysis of the Si7CH2 bonds in isomeric trimethylsilylmethyl-substituted pyridines (Py) and qui- nolines (Q) was determined in aqueous methanol at 50 8C.Alkoxy(alkyl)silylalkyl derivatives of nitrogen-containing heterocycles Depending on the position of the substituent (CH2SiMe3) in the heterocycle, the reactivity decreases in the following order (the relative reaction rates are given in parentheses): 2-QCH2SiMe3 (41)>4-QCH2SiMe3 (37)>4-PyCH2SiMe3 (8.9)>2-PyCH2 ± SiMe3 (1.0)>3-QCH2SiMe3 (0.161)>3-PyCH2SiMe3 (0.03).54 These data suggest that quinoline derivatives are desilylated faster than the corresponding pyridine derivatives.In the presence of tetrabutylammonium fluoride in DMF or CsF in HMPA, N-trimethylsilylmethyl-substituted phthalimide,11 2-piperidone,37 2-mercaptobenzothiazole,60 2-benzothiazole,61 1,2,4-triazole 83, 85, 169 and 4-methylpyridine 170 are smoothly desi- lylated with aldehydes in THF (20 ± 25 8C) to give the correspond- ing heterocyclic alcohols. Similar reactions of acid chlorides give the corresponding heterocyclic ketones.37 For example: R1CHO NCH2CHR1+Me3SiF OH F7 O NCH2SiMe3 R2COCl O NCH2CR2+Me3SiCl O O R1 =Prn, Pri, Ph; R2 =Prn, 4-MeC6H4, PhO.Oxidative desilylation of trimethylsilylmethyl derivatives of pyridine and quinoline with PhI(OCOCF3)2 yields the corres- ponding alcohols in good yields.171 + + PhI(OCOCF3)2 NCHR NCHR OH SiMe3 CsF-Induced desilylation of trimethyl[3-(2-trimethylsilyl- methylpyridyl)methyl]ammonium bromide in acetonitrile (55 8C) affords a pyridinium analogue of o-quinodi- methane.172, 173+ CH2 CH2NMe3Br7 F7 N N CH2 CH2SiMe3 The reaction of 2-(trimethylsilylmethyl)pyridine with per- fluoro(2-methylprop-1-enylmethyl ether) and perfluoro(2-meth- ylpent-2-ene) gave 2-[2-methoxy-3-(trifluromethyl)but-1- enyl]pyridine (yield 50%) and 2-pentafluoroethyl-3-trifluoro- methyl-4H-quinolizin-4-one, respectively.174 3. Reactions with functional substituents at the silicon atom KOH-Catalysed transesterification of (heterylmethyl)trialk- oxysilanes with triethanolamine results in the corresponding For heterylmethylsilatranes.40 ± 42, 72, 89, 91, 117, 118, 133, 142, 175 ± 178 example: HO7 N +(HOCH2CH2)3N S SCH2Si(OMe)3 N +3MeOH.S O Si SCH2OO N 9 The molecular and crystal structures of 1-(2-benzothiazolyl- thiomethyl)silatrane was established by high-resolution X-ray analysis.178 293 The reactions of trimethoxysilylmethyl- and methyldimeth- oxysilylmethyl derivatives of pyridine, 8-mercaptoquino- line, 8-hydroxyquinoline, 2-mercaptobenzooxazole, 2-mer- captobenzothiazole, pyrrolidine and pyridine with HF, BF3 .Et2O or SbF3 give the corresponding heterylalkyltrifluoro- and methyl(heterylalkyl)difluorosilanes in 61% ±72% yields.117, 118, 179 ± 183 For example: N BF3 . Et2O 7B(OMe)3 O SCH2SiMen(OMe)37n N . O SCH2SiMenF37n According to X-ray analysis data, the molecules of (2-ben- zooxazolylthiomethyl)- and (2-benzothiazolylthiomethyl)-tri- fluorosilanes contain an intramolecular N?Si coordination bond, which closes the five-membered ring.117, 181 F F F Si CH2 N S Y Y=O, S. Etherification of the corresponding chlorides in the presence of triethylamine as the HCl acceptor is the most versatile method for the synthesis of N-(dimethylalkoxysilylmethyl)lactams.184, 185 NEt3 O O N N 7HCl +HOR Me Si CH2SiMe2OR CH2 Me (64% ± 93%) Cl R=Me, Pri, C10H21, CH2Ph.The O?Si coordination bond is destroyed in the synthesis of alkoxy derivatives. With substitution of an RONa± PhMe for an ROH± Et3N system, the yields of N-(dimethylalkoxysilyl- methyl)lactams (R=Me and Pri) are only 46% and 38%, respectively. This is due to the cleavage of the Si7CH2 bond, which occurs simultaneously with the formation of N-methyl- lactams. Trialkylalkoxystannanes can also be used instead of sodium alkoxides. This method was used to prepare N-(dimethylalkoxy- silylmethyl)-substituted pyrrolidones and 2-azepinones in 79%± 96% yields.186 N-Chlorodimethylsilyllactams react with the Grignard reagents (MeMgI, PhCH2MgCl) at the Si7Cl bond with high chemoselectivity to give the corresponding N-(trimethyl- silylmethyl)- and N-(benzyldimethylsilylmethyl)-lactam deri- vatives.187 (CH2)n (CH2)n O O N N +RMgX Me CH2SiMe2R CH2 Si Me Cl R=Me, CH2Ph; X =Cl, I; n=173. 4.Hydrolytic reactions The hydrolysis of N-(methoxydiphenylsilylmethyl)-1,2,4-tria- zole,28 N-(methoxydimethylsilylmethyl)-3,5-dimethylpyrazole,90 N-(chlorodimethylsilylmethyl)-188 and N-(alkoxydimethylsilyl- methyl)lactams 189 gives the corresponding linear 1,3-bis(N- heterylmethyl)tetraorganyldisiloxanes in 60%± 82% yields. For example:294 Me Me 2 NCH2SiOMe +H2O N Me Me Me Me Me Me +2MeOH. O SiCH2N NCH2Si N N Me Me Me Me The hydrolytic polycondensation of N-[3-(diethoxy)methyl- silylpropyl] derivatives of uracil, thymine and adenine gives rise to the corresponding polyorganylsiloxanes.36 X Me3SiOEt O N(CH2)3Si(OEt)2 H2O, H7 HN Me O X OSiMe3 Si O O SiMe3 N(CH2)3 HN n Me O The hydrolysis of 4-(trialkoxysilylalkyl)tetrahydro-1,4-thia- zine oxide,133 2-(2-trimethoxysilylmethylthio)benzoimidazole, -benzooxazole and -benzothiazole,40 ± 42, 190 as well as of (N-tri- alkoxysilylpropyl)morpholine 191 proceeds with the formation of in polyheterylalkylsilylsesquioxanes the corresponding 10%± 63% yields. For example: N +1.5H2O S SCH2Si(OMe)3 N +3MeOH.1n S SCH2SiO1.5 n 5. Complex formation 2-[3-(Triethylsilylpropyl)methyl]quinoline,91 N-trimethylsilyl- methyl-1,2,3,4-tetrahydroisoquinoline,75, 93, 192 N-[3-(diphenyl- methylsilyl)propyl]morpholine and piperazine 110 and N-[3- (trialkylsilyl)propargyl]pyrrolidine and -piperidine 124 react with a saturated solution of hydrogen chloride in ether to yield the corresponding hydrochlorides. The reaction of (8-quinolyl- thiomethyl)trimethylsilanes, -trimethoxysilanes and -silatrane with CuCl2, ZnCl2, PtCl2 and SnCl4 193 ± 195 gave various types of coordination compounds the structure of which depended on the nature of the metal and substituents at the silicon atom.Thus the reaction of (8-quinolylthiomethyl)trimethylsilane with potassium tetrachloroplatinate results in a planar-tetragonal chelate com- plex with PtCl2. N N +MCln SCH2SiR3 .MCln SCH2SiR3 R=Me, OMe; R3=(OCH2CH2)3N; MCln=CuCl2, ZnCl2, PtCl2, SnCl4, HCl.IV. Biological activities and practical applications Many of the compounds considered in this review possess highly specific biological activities which are determined by both the presence of a heterocyclic system and the silicon atom flanked with the corresponding substituents. Therefore, such compounds OM Trofimova, N F Chernov,M G Voronkov 1,2,4-triazoles,12, 13, 20 ± 24, 26 ± 31, 84, 85, 196 ± 206 have attracted considerable attention in the past decade. N-(Tri- organylsilylalkyl)imidazoles,12, 13, 20, 22, 23, 26, 30, 31, 196, 197 and - 8-(trimethoxy- silylpropylamino)quinoline and -5,7-dibromoquinoline,207 as well as 2-(trimethylsilyl)methylpyridines 208 possess a broad spec- trum of bactericidal and fungicidal activities. Used as fungicides (20 ± 100 g hectare71), these compounds inhibit the growth of Puccinia recondita, Sphaerotheca fuliginea, Erysiphe graminis and Podosphaera leucotricha.Thus 1-[2-(4-bromophenyl)ethyldi- methylsilylmethyl]imidazole (50 ± 200 mg litre71) exhibits a fun- gicidal activity against Erysiphe cichoracearum, Erysiphe graminis, Puccinia recondita, Puccinia coronata and Phalososphaeria nodo- rum.26 Substituted (trimethylsilyl)-3,5-bisaminomethyl-1,2,4-tri- azole and 2-(trimethylsilylmethoxy)pyrrolidone manifest high insecticidal activity.94 N-[3-(4-Chlorophenyl)dimethylsilyl- propyl]piperidine (2 and 5 g kg71) inhibits the growth of tobacco sucking discs.15 (4-Halogenophenyl)methyl-bis(1,2,4-triazol-1-ylmethyl)silane (Hal=F, Cl),24 3-[bis-(4-fluorophenyl)methylsilyl]imidazole 34 and 7-chloro-4-(4-trimethylsilylethynylpyrazolo)quinoline 70 used at a concentration of 500 mg litre71 exert catalytic systemic effects against various diseases of wheat, rice, barley, oats, maize, cotton, soybean, coffee, sugar cane, apple trees, etc.N-Trialkylsi- lylmethyl-2-pyrrolidones and -caprolactams inhibit the growth of certain bacteria inducing diseases in vine and cucurbitaceous plants.80 N-Trimethylsilylmethylbenzooxazine is an active and non-phytotoxic (for culture plants) component of herbicidal preparations which are commonly used in doses of 0.06 ± 1.00 kg hectare71 (see Ref. 209).3,5-Diamino-6-(trime- thylsilylethyl)-1,2,4-triazine is used for elimination of organisms attacking cabbage, beetroot and tobacco seedlings.210 Poly-[2- methyl-5-vinylpyridinium 1-pentamethyldisiloxymethylide] pos- sesses high pesticidal and growth-regulating activities.211, 212 CH CH2 + N 7CHSiMe2OSiMe3 n Me 4-[3-(Trimethylsilyl)propylamino]quinolines manifest not only herbicidal but also selective antimicrobial activities,97, 99 viz., they efficiently suppress pathogenic fungi and exhibit moderate inhibiting action on the growth of gram-positive bacteria without any effect on gram-negative bacteria. 4-[3- (Trialkylsilyl)propylamino]-7-chloroquinolines exhibit high fun- gistatic activity. Incorporation of a methoxy group at position 6 of these compounds markedly increases their bacteriostatic activ- ity.98, 99 Flusilazole, 1-[bis(4-fluorophenyl)methylsilylmethyl]-1,2,4- triazole, is an efficient organosilicon ergosterol-like fungicide able to suppress various biosynthetic reactions.25, 213 ± 231 F Me Si N N CH2 N F At present, flusilazole is one of the most widely used broad- spectrum agricultural fungicides.It is used against a complex of diseases in cereals, vine, seed fruits, sugar beet and peanut induced by asco-, basidio- and deuteromycetes (also in combination with other fungicides) in the doses of 80 ± 240 g hectare71.Alkoxy(alkyl)silylalkyl derivatives of nitrogen-containing heterocycles (N-Methylpiperazinylmethyl)phenylcyclohexylsilanol sulfo- methylate exerts a potent and highly selective antimuscarinic effect and is used in experimental pharmacology for classification of various subtypes of muscarine receptors.74 N-(Triethylsilylpropargyl)piperidine and -pyrrolidine hydro- chlorides have a neurotropic effect on animals.124 6-[4-(Trime- thylsilyl)butyrylamino]quinoline hydrochloride manifests an antiviral activity against influenza A virus.92 1-(2-Chlorophe- nyldiphenyl]methyl-3-(dimethylphenylsilyl)methylimidazolium chloride,77 N-[3-(trialkylsilyl)propyl]imidazole,86, 87 N-[3-(tri- organylsilyl)propyl]piperazine and -morpholine,110 N-[1-(trime- thylsilylmethyl)]-1,2,4-triazole,209 as well as 4-trialkylsilyl- propylaminoquinoline 91, 93, 156 and -pyridine 232 possess high anti- microbial activities.These compounds display high fungistatic and cytotoxic activities. 4-(Triorganylsilylalkyl)tetrahydro-1,4-thiazine 1-oxides pro- duce a potent effect on the central and peripheral nervous systems and possess a bacteriostatic activity.133 Weakly toxic [1-(2-oxopyrrolidino)ethyl]triethoxysilane hydrochlorides N-(tri- exerts antishock and tranquillising effects.116 Methyldibutyl-(3- piperidinopropyl)silane and 2-(3-trimethylsilylpropargyloxy)- pyrazine-6-thiocarboxamide and ethylpropargylsilylmethyl)piperidine manifest a tuberculostatic activity in vitro against M. tuberculosis and a bacteriostatic activity against Staphylococcus aureus haemolyticus 209.38, 233 4-[3-(Trialkylsilyl)propylamino]quinolines, 1-(trialkylsilyl- propyl)fluorouracil,234 N-trimethylsilylmethyl-1,2,3,4-tetrahyd- roisoquinoline hydrochloride,93 4-quinolylaminoalkyl-, 1-(1- tetrahydroquinolylmethyl)- and 1-[1-(4-quinolylamino)propyl]- silatranes 235 manifest an antitumour activity, Ehrlich ascites tumour and leukemia LD 5178 cells being especially sensitive to the cancerostatic effects of these compounds.(Heteryl- alkyl)trialkylsilanes are less active than the corresponding sila- trane derivatives. 1-(3-Trialkylsilylpropyl)piperidine is used as an active com- ponent of a disinfectant used for the treatment of textiles.236 4-(2-Trimethoxysilyl)ethyl-N-alkylpyridinium bromide, which has the property to increase the volume and softness of textile fibres, also manifests an antimicrobial activity.237 (Triorganylsilyl)benzotriazole derivatives are used as addi- tives to sun protection lotions.112 N-(Trimethoxysilylpropyl)maleimide 238 and 3-(triorganyl- silylalkyl)-2-pyrrolidone 239 are added to polymer-based pharma- ceuticals in order to improve their mechanical properties.5-[(Trimethylsilyl)methylthio]- and 5-[(diethylmethylsilyl)- methylthio]-8-mercaptoquinolines are used as organic analytical reagents.18, 240, 241 2-(20-Trimethoxysilylethyl)pyridine is used for the prepara- tion of rhodium carbonyl complexes. The latter are immobilised on silica gel and used as catalysts.242 1-(Trialkoxysilylalkyl)-3,5-diaminotriazine,243 -piperidine 244 and -2-(4-triazolyl)benzoimidazole 245 derivatives are used for treatment of fibre glass fabrics in order to improve their coupling with the polymeric binders.N-Substituted organosilicon deriva- tives of imidazole,246 benzoimidazole 247 and triazine 248 are used to protect metal surfaces owing to their ability to form highly thermostable films that withstand 100 heating cycles. 2-(Trialkylsilylalkyl)benzothiazole has been patented as a binder in the production of siliceous fillers for rubber tyres.78, 249 ± 253 Polysilanes containingN-alkylpyrrole groups 254 andN-trime- thoxysilylpropyl imidazole derivatives 255 are used in the produc- tion of conducting materials. References 1. E Ya Lukevics, O A Pudova, N P Erchak, in Advances in Organo- silicon Chemistry (Moscow: Mir, 1985) p. 153 295 2. G S Zaitseva, O P Novikova, L I Livantsova, Yu I Baukov Vestn.Mosk. Univ., Ser. 2, Khim. 31 107 (1990) a 3. E Lukevits, L Borisova Izv. Akad. Nauk Latv. SSR, Ser. Khim. 515 (1990) 4. K Hensen, G Klebe J. Organomet. Chem. 209 17 (1981) 5. G Klebe,M Nix, K Hensen Chem. Ber. 117 797 (1984) 6. G Klebe J. Organomet. Chem. 293 147 (1985) 7. H Appler J. Organomet. Chem. 350 217 (1988) 8. E Ya Lukevics, A E Pestunovich Usp. Khim. 41 1994 (1972) [Russ. Chem. Rev. 41 938 (1972)] 9. E Lukevits, I D Segal Khim. Geterotsikl. Soedin. 5 (1987) b 10. E Lukevics, I D Segal Organomet. Chem. Rev. 69 (1988) 11. O Tsuge, J Tanaka, S Kanemasa Bull. Chem. Soc. Jpn. 58 1991 (1985) 12. Eur. P. 148 026; Chem. Abstr. 103 215 540 (1985) 13. WO PCT 8 706 430; Chem. Abstr. 108 150 712 (1988) 14.A Marfat, M P Carta Synthesis 515 (1987) 15. Eur. P. 507 565; Chem. Abstr. 118 81 172 (1993) 16. E Alksnis, M Lidak, E Lukevits Khim. Geterotsikl. Soedin. 654 (1995) b 17. Blg. P. 875 801; Chem. Abstr. 92 6685 (1980) 18. A P Sturis, Yu A Bankovskii, Ya E Leeis, R S Miezere, E Ya Lukevits Latv. Khim. Zh. 142 (1995) 19. E Vedejs, S Larsen, F G West J. Org. Chem. 50 2170 (1985) 20. Eur. P. 68 813; Chem. Abstr. 98 198 430 (1983) 21. US P. 4 510 136; Chem. Abstr. 104 207 438 (1986) 22. Jpn. P. 6 308 388; Chem. Abstr. 109 190 564 (1988) 23. BRD P. 3 723 246; Chem. Abstr. 110 173 465 (1989) 24. Jpn. P. 6 305 092; Chem. Abstr. 109 73 650 (1988) 25. R Tacke, B Becker, D Schomburg Appl. Organomet. Chem. 3 133 (1989) 26.Aust. P. 389 702; Chem. Abstr. 113 59 527 (1990) 27. BRD P. 4 213 257 FRG; Chem. Abstr. 118 102 237 (1993) 28. F Liebner,U Bankwitz,K RuÈ hlmann Liebigs Ann. Chem., 145 (1994) 29. Jpn. P. 06 256 357; Chem. Abstr. 123 199 137 (1995) 30. Eur. P. 609 099; Chem. Abstr. 121 173 058 (1994) 31. WO PCT 9 508 552; Chem. Abstr. 123 112 400 (1995) 32. J P Whitten, D P Matthews, J R McCarthy J. Org. Chem. 51 1891 (1986) 33. D P Matthews, J P Whitten, J R McCarthy J. Heterocycl. Chem., 24 689 (1987) 34. BRD P. 3 832 075; Chem. Abstr. 113 115 553 (1990) 35. S FoÈ ldea k, M Molna r,M Loà koÈ s Liebigs Ann. Chem. 211 (1994) 36. R Zhuo, G Liu, Y Zhou Chin. J. Polym. Sci. 2 148 (1986) 37. A R Katritzky, S Sengupta Tetrahedron Lett. 28 5419 (1987) 38.B Milczarska,H Foks,M Otfinowski,M Janowiec Acta Pol. Pharm. 45 201 (1988); Ref. Zh. Khim. 14 Zh 343 (1989) 39. A R Katritzky, J N Lam Heteroatom. Chem. 1 21 (1990) 40. M G Voronkov, N F Chernov, O M Trofimova, Yu E Ovchinnikov, Yu T Struchkov, G A Gavrilova Izv. Akad. Nauk, Ser. Khim. 758 (1993) c 41. M G Voronkov,N F Chernov,O M Trofimova, T N Aksamentova Izv. Akad. Nauk, Ser. Khim. 1965 (1993) c 42. OMTrofimova, Candidate Thesis in Chemical Sciences, Irkutsk Institute of Organic Chemistry, Siberian Branch of Russian Academy 43. R A Simon, A J Ricco,M S Wrighton J. Am. Chem. Soc. 104 2031 of Sciences, Irkutsk, 1995 (1982) 44. S P Bruekelman, S E Leach, G D Meakins, M D Tirel J. Chem. Soc., Perkin Trans. 1 2801 (1984) 45. E J Corey, D E Cane J.Org. Chem. 35 3405 (1970) 46. W K Musker, R L Scholl J. Organomet. Chem. 27 37 (1971) 47. N V Bac, Y Langlois J. Am. Chem. Soc. 104 7666 (1982) 48. R I Papasergio, C L Raston, A H White J. Chem. Soc., Chem. Comm. 1419 (1983) 49. Y Fall, N V Bac, Y Langlois Tetrahedron Lett. 27 3611 (1986) 50. G P Gisby, S E Royall, P G Sammes J. Chem. Soc., Perkin Trans. 1 169 (1982) 51. S F Martin,M T DuPriest Tetrahedron Lett. 3925 (1977) 52. R J P Corriu, V Huynh, J J E Moreau J. Organomet. Chem. 259 283 (1983) 53. V D Sheludyakov, V I Zhun', V G Lakhtin, V N Bochkarev, T F Slyusarenko, V M Nosova, A V Kisin, N V Alekseev Zh. Obshch. Khim. 52 2574 (1982) d296 54. A Fischer,M W Morgan, C Eaborn J. Organomet. Chem. 136 323 (1977) 55.E Ya Lukevits, I D Segal, T V Lapina Izv. Akad. Nauk Latv. SSR, Ser. Khim. 371 (1978) 56. E Lukevics, E Liepin , I Segal, M Fleisher J. Organomet. Chem. 406 283 (1991) 57. R Nesi, A Ricci, M Taddei, P Tedeschi, G Seconi J. Organomet. Chem. 195 275 (1980) 58. M Borth, K D Bowles, L Schlicksupp, N R Natale J. Organomet. Chem. 331 1 (1987) 59. A R Katritzky, J M Aurrecoechea, L M Vazquez-de Miguel J. Chem. Soc., Perkin Trans. 1 769 (1987) 60. A R Katritzky, W Kuzmierkiewicz, J M Aurrecoechea J. Org. Chem. 52 844 (1987) 61. E Epifani, S Florio, G Ingrosso Tetrahedron 43 1937 (1987) 62. A Padwa, G E Fryxell, J R Gasdaska,M K Venkatramanan, G S K Wong J. Org. Chem. 54 644 (1989) 63. C J Moody, C W Rees, R G Young Synlett 413 (1990) 64.D Kummer, S H A Halim,W Kuhs, G Mattern J. Organomet. Chem. 446 51 (1993) 65. A R Katritzky, Q Hong, Z Yang Organometallics 14 734 (1995) 66. K Tamao, S Kodama, I Nakajima,M Kumada, A Minato, K Suzuki Tetrahedron 38 3347 (1982) 67. A Minato, K Suzuki, K Tamao,M Kumada Tetrahedron Lett. 25 83 (1984) 68. V N Kalinin Usp. Khim. 60 339 (1991) [Russ. Chem. Rev. 60 173 (1991)] 69. R Yamaguchi, Y Nakazono,M Kawanisi Tetrahedron Lett. 24 1801 (1983) 70. Eur. P. 703 234; Chem. Abstr. 124 343 296 (1996) 71. E Ya Lukevits, A E Pestunovich, M G Voronkov Izv. Akad. Nauk Latv. SSR, Ser. Khim. 447 (1972) 72. E Lukevits, R Ya Moskovich, E Liepin'sh, I S Yankovskaya Zh. Obshch. Khim. 46 604 (1976) d 73. E Lukevits, V Luse, I Zitsmane, E Liepin'sh, M Trushule, S Germane, I Augustane, V N Verovskii, N G Prodanchuk, S E Deineka, V N Nivalov Khim.Geterotsikl. Soedin. 1653 (1991) b 74. R Tacke, H Linoh, K Rafeiner, G Lambrecht, E Mutschler J. Organomet. Chem. 359 159 (1989) 75. E Lukevits, I Sleiksha, E Liepin'sh, R D Shatts, I Zitsmane, A Purvinya Khim. Geterotsikl. Soedin. 1644 (1991) b 76. T H Chan, D Wang Tetrahedron Lett. 30 3041 (1989) 77. Jpn. P. 01 319 420; Chem. Abstr. 113 91 447 (1991) 78. Jpn. P. 06 287 198; Chem. Abstr. 123 169 878 (1995) 79. USSR P. 726 099; Byull. Izobret. (13) 129 1980 80. L M Khananashvili, D Sh Akhobadze, L K Dzhaniashvili, Z Sh Lomtatidze Khim.-Farm. Zh. 16 560 (1982) e 81. L M Khananashvili, D Sh Akhobadze, L K Dzhaniashvili, Yu I Baukov, E P Kramarova Zh.Obshch. Khim. 52 2095 (1982) d 82. E Lukevits, E Liepin'sh, E P Popova, V D Shatts, V A Belikov Zh. Obshch. Khim. 50 388 (1980) d 83. S Shimizu, M Ogata J. Org. Chem. 52 2314 (1987) 84. WO PCT 8 602 071; Chem. Abstr. 105 74 389 (1986) 85. BRD P. 3 539 993; Chem. Abstr. 107 59 043 (1987) 86. R Ya Sturkovich, Yu Sh Gol'dberg, N G Prodanchuk, E Lukevits, in Khimiya i Prakticheskoe Primenenie Kremniiorganicheskikh Soedi- nenii (Tez. Dokl. 7-go Soveshch.), Leningrad, 1989 [The Chemistry and Applications of Organosilicon Compounds (Abstracts of Reports of the Seventh Meeting), Leningrad, 1989] p. 23 87. R Sturkovich, Yu Goldberg, V Verovsky, I Augustane, N Prodanchuk, S Deineka, E Lukevics Appl. Organomet. Chem. 3 393 (1989) 88.A Werner, G Albrecht, B Karin Z. Chem. 30 285 (1990) 89. E Ya Lukevits, E P Popova Izv. Akad. Nauk Latv. SSR, Ser. Khim. 207 (1978) 90. V D Sheludyakov, N A Viktorov, A S Tkachev, V F Mironov Zh. Obshch. Khim. 47 90 (1977) d 91. E Lukevits, A A Ziderman, A Zh Dauvarte, T V Lapina, L N Khokhlova, I D Segal Khim.-Farm. Zh. 12 (7) 62 (1978) e 92. E Lukevits, I D Segal, T V Lapina, E I Boreko, G V Vladyko, L V Korobchenko, A N Evstropov Izv. Akad. Nauk Latv. SSR, Ser. Khim. 720 (1986) 93. E Lukevits, T V Lapina, I D Segal, I S Augustane, V N Verovskii Khim.-Farm. Zh. 22 947 (1988) e OM Trofimova, N F Chernov,M G Voronkov 94. Jpn. P. 61 207 392; Chem. Abstr. 106 50 440 (1987) 95. N A Kalashnikova, E P Kramarova, O B Artamkina, A G Shipov, Yu I Baukov Zh.Obshch. Khim. 63 1193 (1993)d 96. R Osman, D Gertner, A Shenhar, A Zilkha Isr. J. Chem. 10 799 (1972); Chem. Abstr. 78 71 883 (1973) 97. E Lukevits, T V Lapina Khim. Geterotsikl. Soedin. 807 (1975) b 98. USSR P. 492 166; Byull. Izobret. (45) 225 (1976) 99. E Ya Lukevits, A E Aleksandrova, T V Lapina, B I Vishnevskii, L D Tsarapkina Izv. Akad. Nauk Latv. SSR, Ser. Khim. 707 (1982) 100. J H Wengrovius, V M Powell, J L Webb J. Org. Chem. 59 2813 (1994) 101. V D Sheludyakov, N A Viktorov, G V Ryasin, V F Mironov Zh. Obshch. Khim. 42 364 (1972) d 102. V D Sheludyakov, S V Sheludyakova, A V Kisin, M G Kuznetsova, V F Mironov Zh. Obshch. Khim. 50 871 (1980) d 103. N S Nametkin, V N Perchenko, I A Grushevenko, M E Kuzovkina Dokl.Akad. Nauk SSSR 186 1089 (1969) f 104. E Lukevics, V Dirnens, in Frontiers of Organosilicon Chemistry. (Proceedings of International Symposium on Organosilicon Chemistry), 1991 p. 378; Chem. Abstr. 115 114 570 (1991) 105. E Lukevits, V V Dirnens Latv. Khim. Zh. 2 131 (1992) 106. L E Ledina, V N Perchenko, N S Nametkin, A M Krapivin Dokl. Akad. Nauk SSSR 243 1200 (1978) f 107. E Ya Lukevits, T V Lapina, E E Liepin'sh, I D Segal Khim. Geterotsikl. Soedin. 962 (1977) b 108. W Caseri, P S Pregosin Organometallics 7 1373 (1988) 109. E Ya Lukevits, A E Pestunovich, M G Voronkov, T M Kupch Khim. Geterotsikl. Soedin. 485 (1972) b 110. E Lukevits, S K Germane, N P Erchak, E P Popova Khim.-Farm. Zh. 12 (2) 67 (1978) e 111. E Lukevics, L Ignatovich, Yu Goldberg, F Polyak, A Gaukhman, S Rozite, J Popelis J.Organomet. Chem. 348 11 (1988) 112. Eur. P. 711 778 Evropa; Chem. Abstr. 125 67 187 (1996) 113. USSR P. 1 073 248; Byull. Izobret. (6) 77 (1984) 114. Jpn. P. 76-26 289; Chem. Abstr. 85 44 931 (1976) 115. Jpn. P. 77-42 873; Chem. Abstr. 87 117 773 (1977) 116. T G Shchekina, V M Kopylov, L M Shmuilovich, F P Krendal', L V Levina,M G Voronkov Khim.-Farm. Zh. 19 165 (1985) e 117. V E Shklover, Yu E Ovchinnikov, Yu T Struchkov, V M Kopylov, T G Kovyazina,M G Voronkov Dokl. Akad. Nauk SSSR 284 131 (1985) f 118. M G Voronkov Izv. Akad. Nauk SSSR, Ser. Khim. 2664 (1991) c 119. M G Voronkov, G I Zelchan, E Ya Lukevits Kremnii i Zhizn' (Silicon and Life) (Riga: Zinatne, 1978) 120.V B Pukhnarevich, L I Kopylova, S E Korostova,A I Mikhaleva, L N Balabanova, A N Vasil'ev, M V Sigalov, B A Trofimov, M G Voronkov Zh. Obshch. Khim. 49 116 (1979) d 121. L I Kopylova, S E Korostova, L N Sobenina, R N Nesterenko, M V Sigalov, A I Mikhaleva, B A Trofimov, M G Voronkov Zh. Obshch. Khim. 51 1778 (1981) d 122. V B Pukhnarevich, E Lukevits, L I Kopylova, M G Voronkov Perspektivy Gidrosililirovaniya (Prospects of Hydrosilylation) (Riga: Institute of Organic Synthesis, Latvian Academy of Sciences, 1992) 123. L I Kopylova, S E Korostova, V B Pukhnarevich, M G Voron- kov Zh. Obshch. Khim. 66 86 (1996) d 124. E Lukevits, A E Pestunovich, V A Pestunovich,M G Voronkov Zh. Obshch. Khim. 40 624 (1970) d 125. E Lukevits, A E Pestunovich, V A Pestunovich, E E Liepin'sh, M G Voronkov Zh.Obshch. Khim. 41 1585 (1971) d 126. G S Gol'din, M V Maksakova, V G Poddubnyi, A N Kol'tsova, A V Kisin, V N Torocheshnikov, A A Simonova Zh. Obshch. Khim. 44 115 (1974) d 127. E Lukevics, V V Dirnens, Y S Goldberg, E E Liepinsh, I Ya Kalvinsh,M V Shimanska J. Organomet. Chem., 268 C29 (1984) 128. S-i Murahashi, T Naota, T Nakato Synlett 835 (1992) 129. E Lukevits, V V Dirnens Izv. Akad. Nauk Latv. SSR, Ser. Khim., 236 (1990) 130. E Lukevits, V V Dirnens Latv. Khim. Zh. 282 (1992) 131. E Lukevics, V Dirnens, A Kemme, J Popelis J. Organomet. Chem. 521 235 (1996) 132. D D Dhavale, C Trombini Heterocycles 34 2253 (1992)Alkoxy(alkyl)silylalkyl derivatives of nitrogen-containing heterocycles 133.M G Voronkov, A E Pestunovich, N N Vlasova, T V Kashik, T I Nikiforova, A I Albanov, Yu N Pozhidaev, S V Amosova Zh. Obshch. Khim. 63 869 (1993) d 134. S M Deng, X Li Chin. Chem. Lett. 6 271 (1995); Chem. Abstr. 123 83 453 (1995) 135. A I Albanov, Yu I Baukov, M G Voronkov, E P Kramarova, M F Larin, V A Pestunovich Zh. Obshch. Khim. 53 246 (1983) d 136. M G Voronkov, V A Pestunovich, Yu L Frolov, in Advances in Organosilicon Chemistry (Moscow: Mir, 1985) p. 54 137. E P Kramarova, G I Oleneva, A G Shipov, A A Macharashvili, V E Shklover, Yu T Struchkov, Yu I Baukov Izv. Akad. Nauk SSSR, Ser. Khim. 2156 (1986) c 138. I D Kalikhman, A I Albanov, O B Bannikova, L I Belousova, M G Voronkov, V A Pestunovich, A G Shipov, E P Kramarova, Yu I Baukov J.Organomet. Chem. 361 147 (1989) 139. Yu I Baukov, E P Kramarova, A G Shipov, G I Oleneva, O B Artamkina, A I Albanov, M G Voronkov, V A Pestunovich Zh. Obshch. Khim. 59 127 (1989) d 140. A G Shipov, E P Kramarova, O B Artamkina, Yu I Baukov Zh. Obshch. Khim. 59 2629 (1989) d 141. M G Voronkov, V A Pestunovich, Yu I Baukov Metalloorg. Khim. 4 1210 (1991) g 142. E P Kramarova, A G Shipov, Yu I Baukov Zh. Obshch. Khim. 62 2559 (1992) d 143. A G Shipov, E P Kramarova, Yu I Baukov Zh. Obshch. Khim. 64 1220 (1994) d 144. Yu I Baukov, A G Shipov, E P Kramarova, L S Smirnova, S Yu Bylikin, Vad V Negrebetsky, Yu E Ovchinnikov, in The 146. E P Kramarova,N A Anisimova, Yu I Baukov Zh. Obshch. Khim. XIIth Fechem Conference on Organometallic Chemistry (Abstracts of Reports), Prague, 1997 p.49 145. M G Voronkov, A I Albanov, A E Pestunovich, V N Sergeev, S V Pestunovich, I I Kandror, Yu I Baukov Metalloorg. Khim. 1 1435 (1988) g 61 1406 (1991) d 147. E P Kramarova, N A Anisimova, T A Zharkovskaya, A G Shipov, N M Goloshchapov, Yu I Baukov, in Biologi- cheskaya Aktivnost' Soedinenii Kremniya, Germaniya i Olova (Tez. Dokl. 4-i Vsesoyuz. Konf.), Irkutsk, 1990 [Biological Activity of Compounds of Silicon, Germanium, and Tin (Abstracts of Reports of the Fourth All-Union Conference), Irkutsk, 1990] p. 17 148. E P Kramarova, L S Smirnova, O B Artamkina, A G Shipov, Yu I Baukov, Yu E Ovchinnikov, A O Mozzhukhin, Yu T Struchkov Zh. Obshch. Khim. 63 2275 (1993) d 149.N A Orlova, A G Shipov, Yu I Baukov, A O Mozzhukhin, M Yu Antipin, Yu T Struchkov Metalloorg. Khim. 5 666 (1992) g 150. USSR P. 346 306; Byull. Izobret. (23) 100 (1972) 151. V D Sheludyakov, in The Xth International Symposium on Organosilicon Chemistry (Abstracts of Reports), Poznan, 1993 p. 257 152. D Kummer, S C Chaudhry, J Seifert, B Deppisch, G Mattern J. Organomet. Chem. 382 345 (1990) 153. A I Albanov, V A Pestunovich, O M Trofimova, N F Chernov, M G Voronkov, A G Shipov, E P Kramarova, Yu I Baukov, in Stroenie i Reaktsionnaya Sposobnost' Kremniiorganicheskikh Soedi- nenii (Tez. Dokl. IV Vsesoyuz. Konf.), Irkutsk, 1989 [The Structure and Reactivity of Organosilicon Compounds (Abstracts of Reports of the Fourth All-Union Conference), Irkutsk, 1989] p.59 154. A I Albanov, V A Pestunovich, O M Trofimova, N F Chernov, M G Voronkov Zh. Obshch. Khim. 66 1949 (1996) d 155. BRD P. 3 034 723; Chem. Abstr. 95 43 091 (1981) 156. E Ya Lukevits, T V Lapina, I D Segal Izv. Akad. Nauk Latv. SSR, Ser. Khim. 111 (1987) 157. T V Balabanova, E A Il'yasov,G G Galust'yan Uzb. Khim. Zh. (3) 43 (1991) 158. E Lukevits, M Trushule Khim. Geterotsikl. Soedin. 1653 (1996) b 159. Jpn. P. 06 279 461; Chem. Abstr. 123 116 230 (1995) 160. Jpn. P. 06 279 456; Chem. Abstr. 123 116 232 (1995) 161. Jpn. P. 06 279 464; Chem. Abstr. 123 116 233 (1995) 162. Jpn. P. 06 279 458; Chem. Abstr. 123 116 231 (1995) 163. H J Hoorn, P de Joode, W L Driessen, J Reedijk React. Funkt. Polym. 27 223 (1995); Chem.Abstr. 124 38 543 (1996) 164. Jpn. P. 06 279 463; Chem. Abstr. 123 116 234 (1995) 165. Jpn. P. 06 279 462; Chem. Abstr. 123 202 912 (1995) 297 167. I E Saratov, I V Shpak, V O Reikhsfel'd Zh. Obshch. Khim. 51 396 166. C Strohmann, R Tacke, G Mattern, W F Kuhs J. Organomet. Chem. 403 63 (1991) (1981) d 168. T Kondo, K Yamamoto,M Kumada J. Organomet. Chem. 35 S30 (1972) 169. S Shimizu, M Ogata J. Org. Chem. 51 3897 (1986) 170. A Ricci, A Degl'Innocenti,M Florenza,M Taddei,M A Spartera, D R M Walton Tetrahedron Lett. 23 577 (1982) 171. I P Andrews, N J Lewis, A McKillop, A S Wells Heterocycles 43 1151 (1996) 172. Y Ito, S Miyata, M Nakatsuka, T Saegusa J. Am. Chem. Soc. 103 5250 (1981) 173. G G Yakobson, V V Bardin Ftorid-ion v Organicheskoi Khimii (Fluoride Ion in Organic Chemistry) (Novosibirsk: Nauka, 1986) 174.T Konakahara, Y Ono, S Tamuza Electron. Conference on Heterocyclic Chemistry, Cambridge, UK, 1997; Chem. Abstr. 127 205 459 (1997) 175. E Ya Lukevits, L I Libert,M G Voronkov Izv. Akad. Nauk Latv. SSR, Ser. Khim. 451 (1972) 176. USSR P. 579 275; Byull. Izobret. (41) 86 (1977) 177. Yu E Ovchinnikov, V E Shklover, Yu T Struchkov, V M Kopylov, T G Kovyazina,M G Voronkov Zh. Strukt. Khim. 27 133 (1986) h 178. Yu E Ovchinnikov, Yu T Struchkov, N F Chernov, O M Trofimova,M G Voronkov Dokl. Akad. Nauk 328 330 (1993) f 179. R Krebs, D Schomburg, R Schmutzler Z. Naturforsch, B Chem. Sci. 40 282 (1985) 180. O M Trofimova, N F Chernov, A I Albanov, V A Pestunovich, M G Voronkov, in Stroenie i Reaktsionnaya Sposobnost' Krem- niiorganicheskikh Soedinenii (Tez.Dokl. IV Vsesoyuz. Konf.), Irkutsk, 1989 [The Structure and Reactivity of Organosilicon Com- pounds (Abstracts of Reports of the Fourth All-Union Conference), Irkutsk, 1989] p. 63 181. Yu E Ovchinnikov, Yu T Struchkov, N F Chernov, O M Trofimova,M G Voronkov J. Organomet. Chem. 461 27 (1993) 182. R Tacke, J Becht, A Lopez-Mras, W S Sheldrick, A Sebald Inorg. Chem. 32 2761 (1993) 183. R Tacke, A Lopez-Mras, J Becht, W S Sheldrick Z. Anorg. Allg. Chem. 619 1012 (1993) 184. O B Artamkina, E P Kramarova, A G Shipov, Yu I Baukov, A A Macharashvili, Yu E Ovchinnikov, Yu T Struchkov Zh. Obshch. Khim. 63 2289 (1993) d 185. A G Shipov, E P Kramarova, O B Artamkina, G I Oleneva, N A Nepomnyashchaya, Yu I Baukov Zh.Obshch. Khim. 65 272 (1995) d 186. O B Artamkina, A G Shipov,M Nasim, D P Krut'ko, G S Zaitseva, Yu I Baukov Metalloorg. Khim. 4 694 (1991) g 187. A G Shipov, E P Kramarova, O B Artamkina, Yu I Baukov Metalloorg. Khim. 4 1101 (1991) g 188. O B Artamkina, E P Kramarova, A G Shipov, Yu I Baukov, A A Macharashvili, Yu E Ovchinnikov, Yu T Struchkov 189. O B Artamkina, A G Shipov, Yu I Baukov Zh. Obshch. Khim. 65 Zh. Obshch. Khim. 64 263 (1994) d 2005 (1995) d 190. M G Voronkov, Yu N Pozhidaev, N F Chernov, O M Trofimova Dokl. Akad. Nauk 326 827 (1992) f 191. BRD P. 2 629 136; Chem. Abstr. 86 140 987 (1977) 192. E E Liepin'sh, I D Segal, E Lukevits Izv.Akad. Nauk Latv. SSR, Ser. Khim. 454 (1990) 193. N F Chernov, O M Trofimova,M G Voronkov, in The 16th International Conference on Organometallic Chemistry (Abstracts of Reports), London, 1994 p. 282 194. N K Skvortsov, N F Chernov, O M Trofimova, V K Bel'skii, V M Svetlichnaya, M G Voronkov Zh. Obshch. Khim. 64 54 (1994) d 195. N N Chipanina, L V Sherstyannikova, O M Trofimova, N F Chernov, M G Voronkov, V K Turchaninov Zh. Obshch. Khim. (1999) (in the press) d 196. BRD P. 4 412 332; Chem. Abstr. 124 87 355 (1996) 197. Jpn. P. 08 231 541; Chem. Abstr. 125 328 710 (1996)298 198. W K Moberg, G S Basarab, J Cuomo, P H Liang Pestic. Sci. Bio- technol., Proc. Int. Congr. Pestic. Chem., 6th, 1986 p. 57; Chem. Abstr. 107 213 470 (1987) 199.H Takano, T Kato Pestic. Sci. Biotechnol., Proc. Int. Congr. Pestic. Chem., 6th, 1986 p. 197; Chem. Abstr. 107 213 471 (1987) 200. BRD P. 3 609 645; Chem. Abstr. 108 70 626 (1988) 201. Jpn. P. 06 279 455; Chem. Abstr. 123 169 880 (1995) 202. Jpn. P. 07 149 769; Chem. Abstr. 123 804 646 (1995) 203. Z Xia,W Zhu, Z Zhang Zhongnan Gongye Daxue Xuebao, 26 522 (1995); Chem. Abstr. 124 176 256 (1995) 204. Jpn. P. 07 101 961; Chem. Abstr. 123 199 141 (1995) 205. Jpn. P. 08 059 675; Chem. Abstr. 125 10 821 (1996) 206. Jpn. P. 08 143 579; Chem. Abstr. 125 496 977 (1996) 207. US P. 4 339 581; Chem. Abstr. 98 34 755 (1983) 208. BRD P. 3 221 214; Chem. Abstr. 100 175 060 (1984) 209. Eur. P. 263 299; Chem. Abstr. 109 73 459 (1988) 210. US P. 5 502 054; Chem.Abstr 125 10 859 (1996) 211. US P. 4 352 833; Chem. Abstr. 98 12 951 (1983) 212. Yu R Kolesnik, O K Grib, L A Uskova, Yu V Svetkin Fiziol. 213. R Tacke, B Becker, D Berg, W Brandes, S Dutzmann, K Schaller 214. T M Fort,W K Moberg Proc.-Br. Crop Prot. Conf.-Pests Dis., (2) 215. J H Lonsdale, J M Kotze Plant Dis. 77 558 (1993); Chem. Abstr. 216. K B Johnson, J W Pscheidt, J N Pinkerton Plant Dis. 77 813 217. B S Watters, S R Sturgeon Tests Agrochem. Cultiv. 14 26 (1993); 218. R A Guinivan, M R Gagnon J. AOAC Int. 77 728 (1994); Chem. Aktiv. Vesh. 21 92 (1989) J. Organomet. Chem. 438 45 (1992) 413 (1984); Chem. Abstr. 103 136 973 (1985) 119 175 772 (1993) (1993) Chem. Abstr. 119 197 672 (1993) Chem. Abstr. 119 197 677 (1993) Abstr. 121 52 240 (1994) 219. N W McLaren, S Aft J. Plant Soil 11 30 (1994); Chem. Abstr. 121 52 254 (1994) 220. WO PCT 9 413 784; Chem. Abstr. 121 101 991 (1994) 221. E A Milus, C E Parsons Plant Dis. (78) 697 (1994); Chem. Abstr. 222. G L Bateman, D Hornby, R W Payne, P H Nicholls Ann. Appl. 223. H Hindorf, C Pohl BCPC Monogr. 60 121 (1994); Chem. Abstr. 121 121 172 941 (1994) Biol. 124 241 (1994) ; Chem. Abstr. 121 294 976 (1994) 296 986 (1994) 224. P L Sholberg, P Haag, D A Gaudet Can. J. Plant Sci. 75 515 (1995); Chem. Abstr. 123 81 989 (1995) 225. Eur. P. 663 148;Chem. Abstr. 123 105 275 (1995) 226. A Balinova Anal. Chim. Acta 311 423 (1995) 227. J-W Huang, J-H Chen, W-C Chung, S-H Yang Guoli Zhongxing Daxue Nonglin Xuebao 44 13 (1995); Chem. Abstr. 123 163 207 228. C Grant, R Kennedy Tests Agrochem. Cultiv. 16 16 (1995); Chem. 229. P C Mercer, A Ruddock Tests Agrochem. Cultiv. 16 32 (1995); (1995) Abstr. 124 23 813 (1996) Chem. Abstr. 124 23 819 (1996) 230. K P Dawson BCPC Symp. Proc. 63 379 (1995); Chem. Abstr. 124 138 538 (1996) 231. Lit. P. 4128; Chem. Abstr. 127 81 454 (1997) 232. Jpn. P. 08 259 855; Chem. Abstr. 126 76 227 (1997) 233. E Ya Lukevits, M G Voronkov Dokl. Akad. Nauk SSSR 216 103 (1974) f 234. Jpn. P. 63 170 387; Chem. Abstr. 111 96 984 (1989) 235. USSR P. 540 459 SSSR Byull. Izobret. (9) 252 (1978) 236. USSR P. 2 465 246; Ref. Zh. Khim. 2 R 435 P (1981) 237. D S Im, M Y Sohn, G S Cho, H J Chae Han guk Somyu Konghakhoechi 29 273 (1992); Chem. Abstr. 119 205 370 (1993) 238. Jpn. P. 0 129 385; Chem. Abstr. 111 98 796 (1989) 239. Jpn. P. 07 233 177; Chem. Abstr. 124 66 585 (1995) 240. A P Sturis, Yu A Bankovskii, R S Miezere Latv. Khim. Zh. 144 (1995) 241. US P. 4 379 931; Chem. Abstr. 99 5816 (1983) 242. M CÏ apka, U Schubert, B Heinrich, J Hjortkjaer Coll. Czech. Chem. Commun. 57 2615 (1992) 243. Jpn Appl. 62 100 462; Ref. Zh. Khim. 23 U 326 P (1989) 244. Eur. P. 665 233; Chem. Abstr. 123 316 811 (1995) 245. Jpn. P. 0 967 383; Chem. Abstr. 126 277 596 (1997) 246. Jpn. P. 0 539 295; Chem. Abstr. 119 107 509 (1993) OM Trofimova, N F Chernov,M G Voronkov 247. Jpn. P. 94-106 871; Chem. Abstr. 124 343 651 (1996) 248. Jpn. P. 0 873 746; Chem. Abstr. 125 35 566 (1996) 249. US P. 4 820 751; Ref. Zh. Khim. 6 U 62 P (1990) 250. Jpn. P. 0 551 484; Chem. Abstr. 119 119 294 (1993) 251. Eur. P. 683 203; Chem. Abstr. 124 119 884 (1996) 252. Y Akutsu,M Kumagai Koen Yoshishu-Nippon Setchaku Gakkai Nenji Taikai, 34 th, 1996 p. 99; Chem. Abstr. 125 223 406 (1996) 253. Jpn. P. 08 311 078; Chem. Abstr. 126 118 075 (1997) 254. Jpn. P. 07 53 721; Chem. Abstr. 123 199 766 (1995) 255. Jpn. P. 94 144 121; Chem. Abstr. 125 12 409 (1996) a�Moscow Univ. Bull. (Engl. Transl.) b�Chem. Heterocycl. Compd. (Engl. Transl.) c�Russ. Chem. Bull. (Engl. Transl.) d�Russ. J. Gen. Chem. (Engl. Transl.) e�Pharm. Chem. J. (Engl. Transl.) f�Dokl. Chem. Technol., Dokl. Chem. (Engl. Transl.) g�Russ. Organomet. Chem. (Engl. Transl.) h�J. Struct. Chem.

ISSN:0036-021X    

出版商:RSC    

年代:1999

数据来源: RSC

摘要:

Russian Chemical Reviews 68 (4) 299 ± 316 (1999) Electron density and traditional structural chemistry of silicates E L Belokoneva Contents I. Introduction II. Orthosilicates III. Ring silicates IV. Chain and band silicates V. Sheet silicates VI. Framework silicates VII. Quantum-chemical calculations of selected framework structures VIII. Determination of charges on atoms in silicates IX. Conclusion Abstract. New results of studies on the electron density of silicates are considered in accordance with the traditional structural classification. Precision X-ray diffraction data and results of structure refinement based on high-angle and multipole models are discussed. Bonded radii, charges on atoms and bond ionicities in Si, Al, B and Be tetrahedra are estimated from the deformation electron density maps in relation to the electronic structures of the atoms and their electronegativities.New possibilities for the solution of problems of isomorphism, for investigations on hydrogen bonds and for the classification are demonstrated. It is noted that the electron density distributions allow one to consider fundamentals of traditional structural chemistry of silicates on the electronic level. For selected compounds, the results of experi- mental studies of the electron density and of quantum-chemical calculations are compared. The bibliography includes 97 refer- ences. I. Introduction Silicates are substances whose structures contain different combi- nations of silicon-oxygen tetrahedra as the major anionic compo- nents. Their negative charges are compensated for by charges of cations bulkier than silicon (for example, by magnesium, iron, calcium, sodium or potassium cations).Silicates belong to rock- forming minerals, which account for 90% of the Earth's crust. Virtually all elements of the Periodic table ranging from hydrogen to uranium and transuranium elements are the components of these minerals. Many silicates are mined and used as sources of raw materials. The discovery of X-ray diffraction and the development of a fundamentally new method for studying compounds, viz., X-ray diffraction analysis, have had a crucial effect on the studies of silicate structures. Before this method had been developed, numerous `salts of polysilicic acids,' which are virtually insoluble in strong acids, had presented a puzzle for chemists.In the first E L Belokoneva Department of Geology,MV Lomonosov Moscow State University, Leninskie gory, 119899 Moscow, Russian Federation. Fax (7-095) 932 88 89. Tel. (7-095) 939 49 26. E-mail: elbel@geol.msu.ru Received 11 September 1998 Uspekhi Khimii 68 (4) 331 ± 348 (1999); translated by T N Safonova #1999 Russian Academy of Sciences and Turpion Ltd UDC 548.736 299 300 303 308 308 310 313 313 314 studies performed in the mid-1920s, the structures of garnet (the first silicate), quartz, olivine, sphene, zircon, diopside, topaz, phenakite, willemite, beryl, vesuvianite, benitoite, hypersthene, staurolite, hemimorphite and thortveitite were solved.1, 2 Abun- dant data on silicate structures have now been accumulated. Russian scientists, namely, Academician N V Belov and his followers, have contributed significantly to the development of the notion of silicate structures.3 The advent of automated diffractometers and programme packages for special data processing marked the beginning of precision X-ray diffraction studies.The review by Tsirelson 4 was the first Russian publication in which the current state of precision X-ray diffraction investigations and the modern notion of the electron density distribution in crystals have been covered most comprehensively. Examples of structural studies of organic and inorganic compounds, including silicates, were also reported in the cited review. Presently, studies on the electron density are among intensively developing lines of investigation in the struc- tural chemistry. The principles and methods of investigations of the electron density are considered in detail in the monographs.4 ±7 Classical (traditional) investigations in the field of structural chemistry of silicates were most completely surveyed in the monograph by Liebau.8 In this monograph, precision X-ray diffraction studies of silicates were briefly considered and the deformation electron density maps for orthoenstatite and coesite were presented.However, the currently available factual data are substantially more abundant. The publications by Tsirelson et al.,9, 10 can be considered as the first reviews devoted to the studies on the electron density of silicates. In the latter review, the major concepts, including principles of interpretation of electron density maps, were reported.A total of about 20 structures were discussed in these publications. The present review surveys the results of studies on the electron density distribution in silicates published in recent years. Taking into account new data, crystal-chemical notions, such as the bond ionicity, the effective radius and the charge on the atom, as well as principles of the classification of silicate structures, which are compared with the classical views, are considered.8 For selected structures, the results of experimental studies on the electron density are compared with the results of quantum- chemical calculations.300 In the analysis of the results of investigations of silicate structures by the precision X-ray diffraction method, particular attention is given to the chemical bonds (especially, to those in silicon ¡¾ oxygen tetrahedra).The data on these bonds can be obtained from electron density maps. The experimental electron density maps constructed with the use of the known proce- dures 4 ¡¾7 revealed regions of concentration of the electron density which were identified with overlapping orbitals. The silicon atom in the [SiO4] tetrahedron possesses four equivalent sp3-hybrid orbitals corresponding to single covalent s-bonds.11, 12 In sili- cates, the experimental average SiO distance is shorter than that calculated with the use of Shomaker ¡¾ Stevenson' equation taking into account the covalent radii of the silicon and oxygen atoms for the single bond. Cruickshank suggested 11 that the remaining p- orbitals of the oxygen atoms overlap with the d-orbitals of the silicon atoms to form additional p-bonds, which impart a some- what double character to Si7O interactions.This fact was noted by Liebau 8 and Tsirelson et al.10 Most studies on the chemical bonds in silicates involved calculations of deformation electron density distribution maps on the basis of an independent spherical-atom model (IAM), which is refined based on high-angle reflections (high-angle refinement), and the determination of the deformation compo- nent of the density (dr) responsible for the chemical bond with the use of difference Fourier series 4¡¾ 7 [Fexp(s)7FIAM(s)]exp(72pisr), dr(r)= 1VX where V is the unit cell volume, Fexp is the experimental structure amplitude, FIAM is the calculated structure amplitude of the independent spherical model, s is the scattering vector of the reciprocal lattice, which describes the reflection of the hkl node, and r is the radius vector.Therefore, the deformation electron density dr characterises the electron density redistribution upon the involvement of atoms in chemical bonding. The method of the multipole analysis of the electron density differs fundamentally from that of the high-angle refine- from the following formula: ment.4 ¡¾ 7, 10, 13, 14 The atomic scattering factor can be calculated q f(q)=Pcfc(q)+Pvfv ,

ISSN:0036-021X    

出版商:RSC    

年代:1999

数据来源: RSC

摘要:

Russian Chemical Reviews 68 (4) 317 ¡¾ 331 (1999) The effect of strong intermolecular and chemical interactions on the compatibility of polymers A A Askadskii Contents I. Introduction II. Criteria for the compatibility of polymers III. The effect of strong intermolecular interaction on the compatibility of polymers IV. The effect of hydrogen bonding and strong dipole ¡¾ dipole interactions on the glass transition temperature of compatible polymer blends V. Formation of chemical bonds between components of polymer blends VI. Conclusion Abstract. The data on compatibility and on the properties of polymer blends are generalised. The emphasis is placed on the formation of strong intermolecular interactions (dipole ¡¾ dipole interaction and hydrogen bonding) between the components of blends, as well as on the chemical reactions between them.A criterion for the prediction of compatibility of polymers is described in detail. Different cases of compatibility are considered and the dependences of the glass transition temperatures on the composition of blends are analysed. The published data on the effect of strong intermolecular interactions between the blend components on the glass transition temperature are considered. The preparation of interpolymers is described whose macromole- cules are composed of incompatible polymers, which leads to the so-called `forced compatibility.' The bibliography includes 80 references. I. Introduction In the studies of polymer blends much attention is currently given to the effect of strong intermolecular and chemical interactions between the polymer blend components on their compatibility.Investigation of compatibility of polymers is of importance from both scientific and practical points of view.1¡¾3 In one of the concepts, it is proposed to analyse compatibility of polymers using the solubility parameter (the density of cohesive energy). The equation used to assess the parameter of the polymer ¡¾ polymer interaction (w) includes the solubility parameters of each polymer where Vis the molar volume of the rubber-like phase per repeating unit of the polymer; d1 and d2 are the solubility parameters of the polymers 1 and 2, respectively; R is the universal gas constant and T is the absolute temperature. A A Askadskii A N Nesmeyanov Institute of Organoelement Compounds of the Russian Academy of Sciences, ul.Vavilova 28, 117813 Moscow, Russian Federation. Fax (7-095) 135 50 85. Tel. (7-095) 135 93 98. E-mail: andrey@ineos.ac.ru Received 11 December 1998 Uspekhi Khimii 68 (4) 349 ¡¾ 364 (1999); translated by AMRaevsky 1999 Russian Academy of Sciences and Turpion Ltd According to this concept, polymers are compatible if the interaction parameter is positive and its value is close to zero. Limitations of this approach have been analysed.4 One of the limitations is associated with the necessity to calculate and measure the solubility parameter to a high accuracy. This is impossible for polymers since this parameter is assessed indirectly using determination of intrinsic viscosity of polymer solutions in various solvents followed by construction of the dependence of the intrinsic viscosity on the solubility parameter of the solvent in which the measurements have been carried out; construction of the dependence of the degree of swelling on the solubility parameter of the solvent in which swelling occurs, etc.The critical value of the parameter w, viz., the upper limit of solubility, is determined from the following relationship 5 where N1 and N2 are the degrees of polymerisation of the components 1 and 2, respectively. Calculations or experimental measurements of the solubility parameters should be carried out with an accuracy of 0.1 (J cm73)1/2. A concept of compatibility of polymers using the solubility parameter has been developed in detail.4 In this study, individual contributions of the components into the solubility parameter were considered and the compatibility parameter (introduced previously 6), which is the difference between the cohesive energy (2) m < 1:374F Fdensities of the components, was used.Let us consider other approaches to the prediction of the compatibility of polymers and the properties of blends obtained. According to the reported data the solubility of polymers occurs if the following inequality holds p/d2s , where dp is the solubility parameter of the polymer, ds is the solubility parameter of the solvent; the F value where Vp and Vs are the molar volumes of the polymer and the solvent, respectively, and the a value is calculated using the formula (4) a a gsp , gs form 2rb, where r =1.374/2 and b=FOFwhere gsp is the interface tension and gs is the surface tension of the solvent.The right part of the criterion (2) is represented in the (5) , gsp a gs a gp ¢§ 2F gsgp The interface tension is defined as follows: 1=2 where gp is the surface energy of the polymer. An attempt to analyse the compatibility of polymers using the criterion for the polymer solubility in organic solvents, viz., relationship (2), has been undertaken.11 Let us consider this criterion in detail. II. Criteria for the compatibility of polymers If a small amount of a polymer 1 is introduced into a polymer 2, the polymer 1 and the polymer 2 are considered as the `polymer' and the `solvent', respectively.The following cases are possible when using criterion (2). 1. Polymers 1 and 2 are incompatible. A small amount of a polymer 1 is introduced into a polymer 2 and, v.v., a small amount of a polymer 2 is introduced into a polymer 1. Then the compatibility criterion has the form (where gp1,p2 is the tension at the polymer 1 ¡¾ polymer 2 interface and gp1 and gp2 are the surface energies of the polymers 1 and 2, respectively. Since the values of the left sides of the criteria (6) and (7) are larger than those of their right sides, polymers 1 and 2 are completely incompatible. 2. If a small amounts of a polymer 1 is introduced into a polymer 2, criterion (2) indicates that the `solubility' of the first polymer in the second polymer occurs, i.e., qAAAAAAAAAAAAAAAAAAAAAAAA However, as indicated by calculations using the criterion (2), no `solubility' of the second polymer in the first polymer should occur A A Askadskii on introduction of the polymer 2 into the polymer 1, i.e., inequal- ity (7) holds.Usually, compatibility of two polymers is judged by the glass transition temperature of a blend. A blend of completely compat- ible polymers is characterised by one glass transition temperature, which is intermediate between those of the initial components. Blends of completely incompatible polymers are characterised by two glass transition temperatures corresponding to those of the initial components.In the case of partial compatibility, where both components are present in each microphase in different amounts, two glass transition temperatures are also observed; however, they are shifted `towards each other' as compared to the glass transition temperatures of the initial components. The dependence of the glass transition temperature on com- position for the case where a polymer 1 is soluble in a polymer 2, whereas the polymer 2 is insoluble in the polymer 1, is shown in Fig. 1. As can be seen, initially the introduction of the polymer 2 into the polymer 1 affects slightly the glass transition temperature of the blend (curve 1). Such a shape of the curve will be rationalised below taking a particular system as an example.It should be noted that in this case one glass transition temperature is observed for each blend, which suggests that the components are compatible. This behaviour of the blend can be associated with the microphase separation, which is characteristic of even homoge- neous systems.12 Tg /K 2 1 a /mole fraction Figure 1. Dependences of the glass transition temperature on the com- position for a system that meets criteria (7) and (12) (1) and for a blend of two completely compatible polymers (2). 3. Complete compatibility of the polymers occurs, i.e., the polymer 1 is soluble in the polymer 2, which is soluble in the polymer 1. In this case, the blend prepared is completely homoge- neous, no microphase separation occurs and the `property ¡¾ com- position' dependences are analogous to those of random copolymers.The criteria for compatibility take the form: The effect of strong intermolecular and chemical interactions on the compatibility of polymers volumes of repeating units of the polymers 1 and 2, respectively; and Tg1 and Tg2 are their glass transition temperatures (calculated or experimental), respectively. Let us consider the behaviour of polymer blends taking a number of well studied polymer blends as examples. The first of them is a blend of polystyrene (PS) (polymer 1) with poly(vinyl methyl ether) (PVME) (polymer 2). The characteristics of this blend of various compositions have been studied in detail.13 ¡¾ 19 It is clearly seen in the plot of the dependence of the glass transition temperature on composition (Fig.2, curve 2) that the Tg value changes only slightly and is virtually independent of the blend composition as the PS content increases from 0 to 0.4. This dependence is not described by Eqn (15), which can be applied to random copolymers and homogeneous polymer blends. Tg /K 340 300 1 260 2 220 0.6 0.4 0.2 0 0.8 a /mole fraction Figure 2. Dependence of the glass transition temperature of the PS blend on the PS content; (1) calculations using Eqn (15); (2) calculations using Eqns (22) and (23). Let us analyse in detail the compatibility of PS and PVME using criterion (2). First, we assume that PS is the solvent for , the van der Waals volumes DV , and glassPVME. The initial characteristics [solubility parameters (d), sur- face energies (g), molar volumes (Vm), cohesive energies X X transition temperatures (Tg)] required to calculate the values of the left and right sides of the criterion (2), are listed in Table 1.By substituting the corresponding values into criterion (14) we obtain in this case m2=0.684<1.218=2rb2 . The value of the left side of the criterion is smaller then that of the right side; hence PVME is readily soluble in PS. Let us assume now that PVME is the solvent for PS. Using the compatibility criterion (6) and the data listed in Table 1, we get m1=1.462>1.175=2rb1 . The value of the left side of the criterion is larger than that of its right side; hence PS is insoluble in PVME.Hence introduction of PS intoPVMEcan lead to microphase separation and the blend i i Table 1. Values of d (J cm73)1/2, g (mJ m72), Vm (cm3 mol71), XDEi (J mol71),XDVi (A3) and Tg (K) for PS, PVME and poly(2,6- dimethyl-1,4-phenylene oxide) (PPO). is expected to have one glass transition temperature. This is due to the fact that a portion of PVME will be compatible with PS. As a result, two microphases can be formed, one of which will contain only PVME, while the other will be a PVME¡¾ PS blend. The compatibility of the latter microphase with PVME will be improved as the PVME concentration in the second microphase is increased and at a certain PVME concentration, the second microphase will be completely compatible with PVME.Let us assess this critical PVME concentration. The relationship for calculating the solubility parameter of this polymer blend, which follows from the general relationship (see a monograph 10), has the To perform further analysis, it is necessary to estimate the molar volume of the blend V=a . 53.68+(17a) . 97.08 . To calculate the values of the left and right sides of the criterion (2), let us use expressions (17), (19) and (20). In this case, we will consider a two-component blend in which one of the components is PVME, while the second component is a PVME¡¾ PS blend (microphase) with various mole fractions of PVME (a). The results of calculations are shown in Fig. 3 in the form of two dependences of both parts of the criterion (2) on a.The intersection point of the dependences corresponds to the PVME content in the microphase at which PVME becomes compatible with this microphase. The threshold concentration (acr) is equal to 0.62. At this PVME concentration, the van der Figure 3. Dependence of m and b on the PVME content in the micro- phase. Now we can calculate the glass transition temperature of the blend with acr=0.62. To this end, let us use the following equation 10 T DV DV DV a i i i cr g a 1 1 2 i i i )6 #a ( " X X X ¢§ T DV DV i i Tg1 cr g2 ¢§ 1 2 i i ( 6 a #a (21) . . " X X ¢§1 T . DVi a 1 i g1 a 2acrO1 ¢§ acrU60:03) . X T DV DV DV 6 i i i g a cr cr 2 Substitution of the parameters for the components of the system (see Table 1) into relationship (21) gives Tg cr=284 K.To find the dependence of Tg on composition of the blend formed by PVME and the critical blend, i.e., by a blend composed of PS and where a is the mole fraction of PVME. Relationship (22) is suitable only in the range 0.62<a<1. The dependence plotted using Eqn (22) is shown in Fig. 2 (curve 2). It can be seen that this dependence fits well the experimental points. To describe the dependence of Tg on the composition of the PVME¡¾ PS blend on the interval 0<a<0.62, first of all it is necessary to calculate the van der Waals volume of the blend with i Substituting the required values (see Table 1) into this equation, we get XThe dependence of Tg on the composition of the blend, one of the components of which is PS and the second component is a microphase with Tg=248 K, is as follows: where a 0 is the effective mole fraction of PS (from 1 to 0.38).Actual mole fraction of PS in the blend is found from the following equation (17a)=0.38+a 00.62 , where a is the mole fraction of PVME and (17a) is the mole fraction of PS in the combined blend. Substituting the right part of the equality a0 a O1 ¢§ aU ¢§ 0:38 0:62 into relationship (25), one can find the dependences of Tg on the blend composition at high PS content, i.e., on the interval 0<a<0.62 (see Fig. 2). Thus, the solubility criterion (2) can be used to describe the dependence of the glass transition temperature of a polymer blend in which one of the components is a good solvent for the second component, but the second component is a poor solvent for the first component.Let us consider a simpler case where two polymers are completely compatible with each other taking a well studied 20 ¡¾ 24 PS ¡¾ PPO blend as an example. Let us assume that PS is the solvent for PPO. Using the solubility criterion (2) and the values of the physical characteristics of the blend components (see Table 1), we obtain: m2=d22 /d21 =0.959; F=1.0; g1,2=0.0456; a=0.001096 and 2rb2=1.328 (d1 and d2 are the solubility parameters of PS and PPO, respectively). Since m2<2rb2, then, according to criterion (2), PS is a good solvent for PPO. Let us assume now that PS is the solvent for PPO, then m1=d21 /d22 =1.043, F=1.0, g1,2=0.0456, a=0.00103 and 2rb1=1.33.In this case, the value of the left side of the criterion (2) is smaller than its right side, i.e., compatibility can also occur. Experiments confirm that this pair of polymers is completely compatible, therefore the dependence of the glass transition temperature on composition of the PS ¡¾ PPO blend is the same as that for random copolymers [i.e., it is described by relationship (21)]. The plot of this dependence is shown in Fig. 4. As can be seen, the calculated curve fits well the experimental points. Tg /K 480 440 400 360 0.4 0.2 0.6 0 0.8 a2 /mole fraction Figure 4. Dependence of the glass transition temperature of the PS ¡¾PPO blend on the content of the second component.It should be noted that this approach used to predict compat- ibility of polymers has the advantage that no introduction of fitting parameters is required. In other words, to analyse compat- ibility of polymers using the approach considered, one needs to know only the chemical structure of the components, which makes it possible to calculate the necessary physical characteristics of the polymers.The effect of strong intermolecular and chemical interactions on the compatibility of polymers III. The effect of strong intermolecular interaction on the compatibility of polymers Mixing of two and more polymers can be accompanied by addi- tional strong intermolecular interaction between their chains, e.g., by hydrogen bonding or strong dipole-dipole interactions, which does not occur between the macromolecules of individual poly- mers.In studies concerned with the analysis of the compatibility of polymers and properties of the blends prepared, primary emphasis is placed on these specific interactions. The scheme below illus- trates an example of such an interaction: CF3 O O H CCF3 This interesting phenomenon is observed, e.g., in blends of poly[styrene-co-p-(hexafluoro-2-hydroxy-2-propyl)styrene] (STHFPS) with such polymers as a polycarbonate based on bisphenol A, poly(butyl methacrylate) and PPO.25 Due to the presence of hydroxyl groups in this copolymer, hydrogen bonds between the copolymer and polycarbonate are formed, which determines substantial improvement of their compatibility.Two glass transition temperatures (which suggests incompatibility) are clearly seen in the thermograms obtained by the DSC method for PS ± polycarbonate blends. The situation becomes quite different when the above copolymer is introduced into the blend instead of PS; in this case, one glass transition temperature (which suggests compatibility) is observed in the thermograms and the Tg value increases as the polycarbonate concentration increases. This effect is also observed in a blend of STHFPS and crystalline poly(ethylene oxide) (PEO).26 The degree of crystal- linity of PEO in the blend changes in such a manner that the melting temperature of the blend decreases. The formation of hydrogen bonds between PEO and the copolymer was studied as a function of temperature.Hydrogen bonds dissociate as temper- ature increases; however, they reform on cooling. Even in the case of crystalline polymer such as PEO, hydrogen bonding between chains of polymers mixed leads to the improvement of their compatibility, the suppression of crystallisation and to the for- mation of a homogeneous system. The behaviour of blends of STHFPS with such polymers as poly(vinyl acetate), poly(methyl methacrylate) (PMMA), poly(ethyl methacrylate), poly(n-butyl methacrylate) (PBMA), PVME, PPO, polycarbonate based on bisphenol A, poly(styrene-co-acrylonitrile), as well as with amorphous and crystalline esters and polyamides has been studied.27 The effect of intermolecular interaction between macromolecules of the blend components on their compatibility was confirmed by measurements of the glass transition temperatures and by FT-IR spectroscopy.Compatibility of STHFPS with a number of aliphatic poly- amides such as nylon-6,12 and N,N0-dimethyl-nylon-6,12 was studied in detail.28 Observation of one glass transition temper- ature for a blend was considered as the compatibility criterion. Polymers with glass transition temperatures that differ appreci- ably from Tg of PS and the copolymer were used. For instance, nylon-6,12 has a Tg of 46 8C, whereas its melting temperature lies in the interval 206 ± 215 8C. To estimate the effect of crystallinity on the compatibility, nylon-6,12, N,N0-dimethyl-nylon-6,12 and copolymers with variable content of the latter were used.It has been shown that (i) hydrogen bonds are formed between the blend components; (ii) they dissociate on heating and restore on cooling and (iii) the introduction of a small amount of hydroxyl groups into PS improves compatibility of such incompatible polymers as 321 PS and polyamide. Hence, the copolymer considered can serve as a compatibiliser. Compatibility of substituted phenol condensation resins with PMMA was studied 29 and it was shown that the formation of hydrogen bonds between the blend components plays an impor- tant role for the improvement of compatibility. Thermodynamic parameters (enthalpy and entropy) of hydrogen bond dissociation were determined.The strongest effect on the compatibility have such substituents as NO2 and Cl. All blends of these phenol resins with PMMA had one glass transition temperature, which indi- cated that the components were compatible. Dependences of the glass transition temperature on composition of the blends consid- ered corresponded to three different cases. 1. The glass transition temperatures of blends are higher than the averaged glass transition temperature. 2. The glass transition temperatures of blends are lower than the averaged glass transition temperature. 3. The dependence of the glass transition temperature on the composition is S-shaped. It was suggested that the behaviour of the blend correspond- ing to the first and the second case be describes using the following relationship:29 (24) Tg=W1Tg1+W2Tg2+qW1W2 , where Tg1 and Tg2 are the glass transition temperatures of the polymers 1 and 2, respectively;W1 andW2 are the weight fractions of the polymers 1 and 2, respectively; the parameter q characterises the strength of hydrogen bonding and can be interpreted as the contribution of hydrogen bonds, which can be considered as pseudocross-links. It was found experimentally that the q values are negative and approximately equal in absolute values forNO2 and But groups as substituents and positive for the Cl substituent.If F and Cl atoms are used as substituents, the q values are positive. (All the aforesaid is true in the case of para-substitution of the aromatic nucleus.) Hence, the dependences of the glass transition temper- ature on the composition of blends of phenol resins containing 4-tert-butyl or 4-nitro groups in the aromatic nucleus withPMMA correspond to the second case.For unsubstituted resins, these dependences correspond to the third case. Finally, for chlorine- substituted resins, the dependences correspond to the first case. The S-like shape of the curve of the Tg dependence on the composition can be described by the following expression, which is more general than relationship (24) T (25) g à W1Tg1 á kW2Tg2 á qW1W2 , W1 á kW2 where k is a coefficient. Relationship (25) was used to describe the dependence of the glass transition temperature on the concentration of components in blends of substituted phenol resins (see above) with poly(ethyl methacrylate) andPMMA(F and But were used as substituents in the resin) and in blends based on the unsubstituted phenol resin.30 All three above-mentioned cases of changes in the glass transition temperature of the blends were established and all the parameters of Eqn (25) were found.Hydrogen bonding of macromolecules in these polymer blends was studied by FT-IR spectroscopy,31, 32 using the Patter- son and Robard theory 33 and by construction of lower critical solution temperature (LCST) diagrams. Solubility and compati- bility of poly(2-ethyl-2-oxazoline) was studied. To assess the compatibility of poly(ethyloxazoline) with other polymers, two series of experiments were carried out.In the first series, films were studied based on blends of pairs of polymers, one of which was poly(ethyloxazoline), while in the second series the complexes were studied based on the same pairs of polymers. These complexes were prepared by mixing polymer solutions, separating the precipitate and drying it in vacuo to constant weight. It was established that the composition of the complex322 differs from that of the initial blend, the former being determined by the ratio of polar groups responsible for the strong intermo- lecular interaction. The glass transition temperatures of blends of poly(ethyloxazoline) with polyacrylic acid are lower, whereas those of the complexes are higher than the additive values. The authors believe that this is due to the formation of a network of physical bonds in the complexes.When studying the compatibility of PVME and styrene ± methyl methacrylate copolymers, a critical composition of the copolymer was found 34 at which compatibility was observed. The PS content in such a copolymer must be *60 mol. %. Phase diagrams were constructed on which the so-called `compatibility windows' of these blends were determined. In addition to the glass transition temperature, thermal stability of blends was also studied taking blends of poly(p- hydroxystyrene) with poly(vinylpyrrolidone) and poly(ethyl- oxazoline) as examples.35 It was established that a small weight loss of poly(p-hydroxystyrene) (6%) on heating in the temperature interval 200 ± 250 8C is due to the cross-linking reaction with the formation of ether bonds.It was mentioned that hydrogen bonds between the polymer chains affect the compatibility of the polymers. Intermolecular complexes can be formed directly in the course of polymerisation.36 For instance, they are formed upon photo- polymerisation of acrylic acid in which PEO is dissolved. The glass transition temperatures of intermolecular complexes are higher not only than those of blends, but also than those of the initial components. These complexes are soluble in such solvents as dimethylformamide and dimethyl sulfoxide and swell to a certain degree in water and methanol; however, they do not swell in dioxane. A decrease in the number of groups capable of forming hydrogen bonds, e.g., by copolymerising acrylic acid with methyl methacrylate, reduces the ability for complexation.The stability to thermal oxidation also depends on the formation of hydrogen bonds between the polymer chains (e.g., for blends of PVME with modified PS).37 The modified PS was a copolymer of styrene and p-(hexafluoro-2-hydroxy-2-propyl)styr- ene (2.5 mol. %), i.e., it contained functional groups prone to form hydrogen bonds. However, due to the presence of hydroxyl groups in the copolymer, the stability of the system to thermal oxidation was enhanced (i.e., these groups `operated' as antiox- idants). This resulted in lengthening of the induction period of the thermal oxidation of PVME and in a decrease in the rate of the process.The above-mentioned formation of intermolecular complexes was also observed for poly(N,N0-dimethylacrylamide) and a phenol ± formaldehyde (PF) resin.38 The complexes were precipi- tated from solutions in acetone, ethyl acetate and dioxane. As before, the compositions of the complexes corresponded to the molar ratios of the components. The glass transition temperatures of the complexes were higher than those of the initial components. Complexes of poly-N,N0-dimethylacrylamide with p-methoxy- phenol ± formaldehyde resin were also formed; their glass tran- sition temperatures were much higher than that of each component.39, 40 Synthesis of interpenetrating polymer networks (IPN) based on compatible polymers, viz., poly(1-hydroxy-2,6-methylpheny- lene) and PMMA, was reported.41 Hexamethylenetetramine and 1,3-dioxolane were used as the cross-linking agents at different temperatures.The strength of hydrogen bonding in blends and IPN was shown to be determined by the change in the cross- linking temperature and by the decrease in the concentration of the groups capable of forming hydrogen bonds. The concentra- tions of these groups were varied by using methyl methacryla- te ± styrene copolymers. It was shown by FT-IR spectroscopy that the compatibility in these blends is retained unless the intermo- lecular interaction due to hydrogen bonds is lower than a certain critical value. Hydrogen bonding affects the phase behaviour of polymer blends.42 This study was performed with blends of poly(methyl A A Askadskii methacrylate-co-styrene) with a PF resin in which hydroxyl groups were partially methylated.Compatibility diagrams were constructed and the so-called `compatibility windows' were found, i.e., regions of the diagram corresponding to complete compatibility or to the microphase separation. The compatibility of homopolymer ± copolymer blends was studied.43 The first pair was a blend of poly(4-hydroxystyrene) with poly(n-butyl acrylate-co-tert-butyl acrylate). These blends are compatible when the butyl methacrylate content in the copolymer is 564%. The second pair was poly(tert-butyl acryl- ate) and poly(styrene-co-4-hydroxystyrene). The `compatibility window' for this pair was observed at a concentration of 4-hydroxystyrene in the copolymer between 28 mol.% and 66 mol.%. The glass transition temperatures of compatible blends of poly(tert-butyl acrylate) and poly(styrene-co-4-hydr- oxystyrene) are much lower than the additive values and, which is the most interesting, they depend only slightly on the blend composition and are approximately equal to the glass transition temperatures of the copolymers. This can be explained only by the formation of hydrogen bonds between the blend components, which was experimentally confirmed by IR spectroscopy. The concepts of the effect of strong intermolecular interac- tions on the compatibility of polymers were developed by Kim, Kwei and Pearce 44 who studied hydrogen bonding in IPN prepared from a compatible polymer blend of poly(1-hydroxy- 2,6-methylphenylene) and PMMA.To decrease the number of carbonyl groups, poly(methyl methacrylate-co-styrene) at differ- ent monomer ratios was also used. Different cross-linking agents, e.g., hexamethylenetetramine and 1,3-dioxolane, were used to prepare IPN. The strength of hydrogen bonding in IPN was varied by varying the conditions of the cross-linking reaction (in particular, temperature). Hydrogen bonding in the compatible blend of two above-mentioned polymers demonstrated reversible temperature dependence. In the case of semi-IPN and IPN prepared at temperatures higher than the Tg of the blend, the number of hydrogen bonds after cooling to room temperature differed from that in the initial blend.If poly(PMMA-co-styrene) was used instead of PMMA (i.e., the number of carbonyl groups was appreciably decreased), semi-IPN did not form a single phase. However, semi-IPN and IPN synthesised at relatively low temper- atures (below Tg of the blend) were homogeneous and contained a larger number of hydrogen bonds as compared with semi-IPN and IPN synthesised at high temperatures.45 Makhija et al.46 studied poly[2,2 0-(5,5 0-bibenzoimid- azole)diyl-m-phenylene] (PBI). Its blends with poly(4-vinyl- pyridine) of various monomer ratios were characterised by one glass transition temperature, which indicated that the components were compatible, and the Tg values were higher than the additive values. As in the previous studies, the authors explained this fact by the formation of the N7H7N hydrogen bonds.This was confirmed experimentally by FT-IR spectroscopy. Based on the aforesaid, the following practically significant conclusion can be drawn, viz., the compatibility of polymers in a blend can be improved by introducing a small number of func- tional groups (e.g., hydroxyl groups) into one of the blend components; this will lead to the formation of hydrogen bonds between the blend components. In this case, domains of different size can be formed. To reduce the size of domains, it is sufficient to introduce a certain number of hydroxyl groups. For instance, compatibility of PS with poly(n-butyl acrylate) is achieved by introducing 4.4 mol.%of hydroxyl groups. Relaxation times and domain size were assessed by NMR spectroscopy.47 ± 52 Complexes based on poly(4-hydroxystyrene) and poly-N,N- dimethylacrylamide were studied by 13C CPMAS NMR spectro- scopy.The size of inhomogeneous domains determined by this method was *2.5 nm.51 Analogous study of inhomogeneous domains in IPN has shown that the domain size in this case is smaller (*2.2 nm).50 The effect of microtacticity of PMMA on its compatibility with poly(styrene-co-4-hydroxystyrene) was studied by NMRThe effect of strong intermolecular and chemical interactions on the compatibility of polymers spectroscopy.48 It turned out that syndiotactic PMMA possesses better compatibility with the above copolymer and that the blend based on both methyl methacrylates is homogeneous over a wide range of compositions. The size of inhomogeneous domains for most blends established by NMR spectroscopy was *2 nm.Analogous studies of poly[(4-vinylphenyl)dimethylsilanol] (PVPDMS) and its copolymers with styrene 49, 50 also showed a strong effect of hydrogen bonding between the phenol and phosphate groups, which was confirmed by IR and 13C and 31P NMR spectroscopy.53 Blends were studied 54 of PEO and poly(butyl methacrylate) with modified poly(butyl methacrylate) that contained groups capable of forming hydrogen bonds.55 ¡À 60 Introduction of 4-hydroxy-4,4-bis(trifluoromethyl)butyl group even in the silox- ane polymer CH3 Si O (CH2)3 C(CF3)2OH n , possessing low surface energy, makes it possible to prepare compatible blends with PEO and PBMA.The parameter of the polymer ¡À polymer interaction was assessed on the basis of studies of steam diffusion and solubility in blends.61 In all cases its value was negative and became more negative on introduction of hydroxyl groups into the polymer, thus indicating better compatibility. Correlations between the diffusion coefficient and the specific free volume of the polymer were found. Functionalisation of polystyrene due to introduction of hydroxyfluoroalkyl (or hydroxyl) groups enhances its thermal stability, oxidation stability, retards combustion and improves compatibility with other polymers.62 The compatibility of a number of polyamides in blends was studied.63 ¡À 65 Huang et al.64 studied the sulfonated poly(p-phenyl- eneterephthalamide) CO NH CO NH SO3H n Based on its blends with poly(vinylpyrrolidone), poly(4-vinyl- pyridine) and poly(vinyl alcohol) (PVA), the so-called molecular composites were prepared in which the rigid-chain sulfonated polyamide was used as reinforcing element.It was established that hydrogen bonding between the elements of the molecular compo- site has a strong effect on its properties. The glass transition temperatures of blends with poly(vinylpyridine) and PVA were lower than the additive values, which, according to the authors' opinion, indicates a small number of contacts between the macro- molecules. Modifications of nylon-6, viz., its blends with small amount of PF resins, were studied.65 The addition of 1.2% of PF resins results in an increase in the modulus of elasticity and in lowering of moisture absorption.In this case, spherolites of larger size are formed. Further increase in the content of PF resins in the blend does not improve its properties. It was thus concluded that the compatibility of nylon-6 with PF resins is limited (to 3% of PF resins). The mechanism was studied 63 of polymer-analogous reac- tions of poly(trichlorobutadiene) (PTCB) with aliphatic amines, viz., tert-butylamine, diethylamine and triethylamine, which sim- ulate chemical processes occurring in individual fragments of polymer chains in the reaction of PTCB with branched poly(- ethyleneimine). Using FT-IR and electronic spectroscopy, it was shown that hydrogen-bonded ionic charge-transfer complexes are formed in the reaction of poly(1,1,2-trichlorobutadiene) with amines in 323 parallel to the substitution reactions of the chlorine atom of the allyl group by the amino group and dehydrogenation reactions.The contribution of each of these processes to the overall conversion of functional groups of the polymer depends on the nature of the amine (the degree of N-substitution) and on the type of the solvent. Primary and secondary amines are more prone to form stable hydrogen-bonded complexes with the polymer, whereas the tertiary amine causes mostly dehydrochlorination of the polymer and the formation of polyene fragments of various length. If dioxane is used as solvent, then dehydrochlorination predominates, whereas substitution and complexation predom- inate in chloroform.A model in the framework of the Flory theory was devel- oped 66 that makes it possible to describe self-association and inter-association of the molecules of the components in the case of hydrogen bonding between them. This model was experimentally tested in studies of poly(4-hydroxystyrene) ¡ÀPMMA blends. These studies have been extended.67 This model uses the equili- brium constants that are determined from the IR spectral data, so there is no need to use fitting parameters for the description of the phase properties. In studies of compatibility of poly(vinylpyridine) and a poly- ethylene ¡ÀPVA copolymer, this model was used to analyse the equilibrium association of hydroxyl groups present in the copoly- mer with the pyridine fragment.68 Thus, to predict compatibility of polymers and to establish the reasons for the compatibility, one should pay attention not only to the properties of individual components, but also to the specific intermolecular interaction between them.IV. The effect of hydrogen bonding and strong dipole ¡À dipole interactions on the glass transition temperature of compatible polymer blends If no specific intermolecular interaction occurs between cross- linked polymers, the glass transition temperature of a homoge- neous blend of compatible polymers is calculated using Eqn (15) in which the glass transition temperatures of homopolymers based on the components 1 and 2 (Tg1 and Tg2, respectively) appear.The Tg value of the blend can be assessed using either calculated or experimental values of Tg1 and Tg2. Equation (15) can be written in another form where ai and bj are constants related to the energy of the weak dispersion forces and strong intermolecular interaction (dipole ¡À - dipole interaction, hydrogen bonding), respectively. b a Then, the term should contain an addend j iDVi �¢ j i !1 Let us assume that the addition of polymer 2 to polymer 1 gives rise to hydrogen bonding.X X (a constant) characterising the contribution of hydrogen bonds, viz.,bh=714061073 A3 K71 , since a portion of repeating units of the polymer 1 becomes bonded to the component 2 by hydrogen bonds.In this case we constant is rather large. From Eqns (27) and (28) it can be seen that the smaller the van der Waals volume, the higher the glass transition temperature of the blend and the larger the difference between Tg of the blend and that of a blend in which no additional specific interactionbetweencomponents occurs [see Eqns (15) and (26), i.e., Tg>T0g ]. This affects the shape of the dependences of Tg ona2 (see Fig. 5a). If the vander Waals volumes of repeating units The initial values of Figure 5. Dependences of the glass transition temperatures on the content of the second component for blends of compatible polymers in which the components are bonded by hydrogen bonds. Relationship (29) (a), (30) (b) and (31) (c) holds.The values of initial parameters for constructing curves (1 ¡¾4) are listed in Table 2. Curves (1 0 ¡¾ 4 0) correspond to the case where no additional hydrogen bonding between the components occurs.The effect of strong intermolecular and chemical interactions on the compatibility of polymers Figure 6. Dependences of the glass transition temperature on the content of the second component for blends of compatible polymers in which dipole ¡¾ dipole interaction between the components occurs. Relationship (29) (a), (30) (b) and (31) (c) holds. decreases and the glass transition temperatures of blends are only slightly higher than the Tg values calculated using Eqns (15) and (26).The dependences shown in Fig. 5 b illustrate the second case. Here Tg>T0 g .Even if no additional hydrogen bonding occurs, the Tg values are higher than those of blends calculated on the basis of the mole fractions of the components. In the third case [see relationship (31) and Fig. 5 c], the effect of additional hydrogen bonding decreases, since the total energy of dispersion interaction is appreciably higher than that of the hydrogen bonding. A similar situation is observed when mixing of blend compo- nents gives rise to additional dipole ¡¾ dipole intermolecular inter- action due to the presence of polar groups in repeating units. This interaction is characterised by the bd constant. In this case, to calculate the Tg values of the blend, one should use the bd constant instead of bh in Eqns (27) and (28).If relationship (29) is valid, the effect of additional intermo- lecular interaction on the dependence of Tg on composition is much weaker than in the case of hydrogen bonding betweenhe components (Fig. 6 a), since bd<bh. If inequality (30) holds, the deviation of Tg of blends from the average values is positive (Fig. 6 b); however, it is not as large as in the case of hydrogen bonding. If condition (31) is met, the effect of additional intermolecular interaction is not so strong (Fig. 6 c) and the Tg of blends are rather close to T0 g . The curves of dependences of the glass transition temperature on the blend composition may have maxima, minima and be S-shaped (Fig. 7). This is due to the fact that one of the blend components is a copolymer containing a limited number of polar groups capable of forming hydrogen bonds.Let us assume that the copolymer 2 whose formula is as follows A B(OH) , n m Figure 7. Dependences of the glass transition temperature on the com- position of blends of compatible polymers: convex (1), S-shaped (2) and concave (3) curves. Tg2 a 2O1 ¢§ a # 2Ua260:03 bj=293 and DVi=110 and 115A3, aiDVi a j i i Let us consider the cases where conditions (29) ¡¾ (31) are met. If the van der Waals volumes of repeating units are approx- imately equal, the initial parameters for calculating the glass transition temperature of the blend are Tg=376 and 426 K, X X X260A36K71 for the polymer 1 and the copolymer 2, respectively. The content of the B(OH) component in the copolymer 2 was varied in calculations. The results of calculations are shown in Fig.8 a. The S-like shape of the dependences of the glass tran- sition temperature of blends on composition is observed as b varies from 0.1 to 0.4.23, 26, 27, 38, 46, 54, 56 If strong dipole ¡¾ dipole interactions occur between the copolymer 2 and the polymer 1 [the condition (30) is met], the glass transition temperature is calculated using Eqns (32) and (33); however, the bd constant is used in this case instead of bh. The initial parameters required to calculate the dependence of Tg on the composition are the same as in the former case. The results of calculations are shown in Fig. 8 b. It should be noted that theFigure 8. Dependence of the glass transition temperature on the content of the second component for a blend of compatible homopolymer and copolymer in the case of hydrogen bonding (a) and strong dipole ± dipole interaction (b) between the blend components; b: (1) 0.1; (2) 0.2; (3) 0.3; and (4) 0.4.B(OH) S-like shape of the curves is observed only if the content of the component in the copolymer 2 is high. In all cases, these dependences differ from those obtained without considera- tion of an additional dipole ± dipole interaction between the blend components. Calculations of changes in glass transition tempera- tures due to the additional intermolecular interaction between the components show that these interactions play a significant role. The Tg values differ from the T0 g values.It should be emphasised that the equations used for analysing the dependences of the glass transition temperature on the blend composition contain no fitting parameter and all calculations are performed using only the data on the chemical structure of the blend components. Let us consider particular blends of compatible polymers taking PBMA± poly(styrene-co-VPDMS) blends 56 as the first example. It is required to calculate the glass transition temperature of poly(styrene ± VPDMS) at different content of the second compo- nent. The results of calculations performed using Eqn (15) and experimental Tg values are listed in Table 3. To calculate the glass bj PBMA These values for copolymers of different compositions are also listed in Table 3.They were used to calculate the glass transition temperatures of a number of PBMA± poly(styrene-co-VPDMS) A A Askadskii Table 3. Composition and characteristics of PS ±PVPDMS copolymers. Specimen a DVi/ I a Figures denote the content of silanol groups (%) in PVPDMS. blends. The results of calculations for two blends are shown in Fig. 9 in the form of dependences of the glass transition temper- ature on the composition. These dependences for compatible blends containing poly(styrene-co-VPDMS-34) and poly(styr- ene-co-VPDMS-9) were obtained using Eqn (32). For each blend, the calculated values are in fairly good agreement with experimental data (see Figs 9 a,b). In addition, let us analyse the dependence of Tg on the composition for the PBMA± poly(styr- ene-co-VPDMS-9) blend using Eqn (33) and experimental Tg values.As a result, good agreement is observed between the calculated and experimental data (Fig. 9 b). If the content of modified polystyrene [i.e., poly(styrene-co- VPDMS)] in the blend is low, the glass transition temperatures of blends are lower than the additive values. As the content of this component in the blend increases, the glass transition tempe- ratures appear to be higher than the average values. This is explained by the formation of a large number of hydrogen bonds between the components on their mixing. Blends of PBI and poly(4-vinylpyridine) have been studied.46 It was shown that hydrogen bonds are formed between the 4-vinylpyridine residues and the NH groups in PBI.Therefore homogeneous blends based on these polymers are formed. The dependences of experimental and calculated glass transition temperatures on blend compositions are shown in Fig. 10. Glass transition temperatures of the blends are higher than the Tg values of the initial components. The calculated curve fits well the experimental points if the mole fraction of PBI in the blends does not exceed 0.3. Deviation of the experimental points from the calculated curve at high PBI content is associated with the fact that destruction of poly(4-vinylpyridine) begins above 375 8C. It should be noted once again that calculations were carried out using the equations containing no fitting parameters.Thus, the aforesaid makes it possible to draw the following conclusions. In the case of compatible blends of two homopol- ymers, the shape of the dependence of the glass transition temper- ature on the blend composition can be different. If the van der Waals volumes of repeating units of the homopolymers are approximately equal and no additional strong intermolecular interaction between the components occurs, the glass transition temperature is lower than the average values. If the van der Waals volume of the unit of a homopolymer 1 is substantially smaller than that of the unit of a homopolymer 2, the glass transition temperature is slightly higher than the average values (even in the absence of additional intermolecular interactions).If these inter- actions occur, the Tg value of the blend is always higher than the average values. For blends of a homopolymer with a copolymer containing a limited number of polar groups that can participate in strong intermolecular interaction with the other component (dipole ± di- pole interaction, hydrogen bonding), the dependences of Tg onThe effect of strong intermolecular and chemical interactions on the compatibility of polymers 0 0.6 0.4 0.2 Figure 9. Dependences of the glass transition temperature on the content of the second component for compatible poly(styrene-co-VPDMS- 34) ±PBMA (a, c) and poly(styrene-co-VPDMS-9) ±PBMA (b, d) blends; calculations using Eqns (32) (a, b) and (33) (c, d); (1) calculations; (2) average values; and (3) experiment.composition are S-shaped. The above peculiarities of changes in the characteristics of compatible blends can be described by the equations given above which contain the parameters obtained using the data on the chemical structure of the components. It is needless to say that this approach is not versatile and further investigations are needed to understand how should, e.g., the effects of various specific interactions and peculiarities of the structure of blend components on their thermomechanical behav- iour be taken into account. Figure 10. Dependence of the glass transition temperature for compatible polyvinylpyridine ± polybenzoimidazole blends; (1) calculations; (2) average values; and (3) experiment. V. Formation of chemical bonds between components of polymer blends Processing of polymers often results in the formation of chemical bonds between the components, which improves their compati- bility.69 Let us consider a case of the so-called `forced mixing' of two incompatible polymers by synthesising interpolymers.{ The reaction is conducted in solution and repeating units of the polymers contain functional groups capable of chemical reaction { Interpolymers are polymacromolecular compounds formed in a chem- ical reaction occurring in a solution of two polymers.70 ± 78 with one another.Such an approach makes it possible to prepare macromolecules composed of finished polymers whose repeating units cannot be united in the course of synthesis.In Fig. 11, the structures of various polymers are represented schematically. The difference between interpolymers and random copolymers is obvious and needs no special explanation. The difference between interpolymers and block copolymers lies in the fact that the chemical reaction between two unlike macromole- cules (blocks), resulting in the addition of one block to another one, involves functional groups within the repeating units of macromolecular chains rather than the end functional groups. Figure 11. Different types of structures of polymers and copolymers: (a) random copolymer; (b) graft copolymer; (c) block copolymer; (d) a fragment of interpolymer; (e) a polymer network; and (f) a macromolec- ular interpolymer coil. Graft copolymers and interpolymers differ not only in the structure, but also in the procedure for preparation.Grafting of chains in solution is due to the interactions of the end functional groups in repeating units of the polymers. Grafting from the gas phase on the surface of a polymeric product is carried out by polymerisation of a monomer on this surface and the product obtained has nothing to do with an interpolymer. Additional explanation is required as to cross-linking reac- tions, even in the case where one polymer is cross-linked by the other polymer (e.g., curing of epoxide resin with polyanhydride belongs to this type of reaction). In this case, branched products are formed in the first stage of curing due to the interaction of one or several polymer (or oligomer) macromolecules with those of the curing agent, whereas in the second stage the reaction proceeds in such a way that an increase in the degree of conversion leads to an increase in the degree of cross-linking up to complete insolubility of the product.In the synthesis of interpolymers, chemical reactions between functional groups in repeating units of unlike macromolecules occur in a different manner. The conditions of reaction in solution are chosen so that the increase in the degree of conversion is due to consumption of functional groups in the chemically bonded macromolecules rather than to the formation of cross-links. In this case, conversion of functional groups is not accompanied by an increase in the molecular weight of the system and the reaction occurs in the region of mutual penetration of unlike coils (see Fig.11d). Such a reaction results in the formation of soluble products, viz., interpolymers. It should be noted that the degree of conversion of functional groups does not exceed 10%. Without dwelling on peculiarities of chemical reactions between two unlike polymers in dilute solutions, we should note that the degree of conversion of the same functional groups in the case of two polymers is always much lower than in the case of one polymer and a low-molecular weight substance. Chemical reac- tion between polymers can occur only in the region of their mutual penetration and the role of excluded volume is of particular importance in those cases where functional groups are arranged in the repeating units along the chain.Preparation of interpolymers can be exemplified taking the reaction of PTCB with PS. It should be noted that if AlCl3 is used as catalyst, PTCB readily reacts with the aromatic nuclei of low- molecular weight compounds, e.g., with benzene and its deriva- tives, and the degree of conversion can be very high. In the reaction of PTCB with PS using the same catalyst, interaction with the aromatic nucleus of PS also occurs + CH CH2 CH CCl CCl2 CH2 AlCl3 CCl CH CCl CH2 CH CH2 The reaction between PTCB and PS is carried out in nitro- benzene at a low blend concentration (from 0.5 to 5 g dl71). Fractionation of the interpolymer obtained gives several fractions (A ¡¾D) that can be isolated and characterised.Fractions A and B are soluble in the same solvents as the initial polymers; however, unlike fraction A, fraction B is insoluble in carbon tetrachloride. Fraction C is soluble only in tetrachloroethane and nitrobenzene on heating. Finally, fraction D is insoluble. It should be noted that the increase in the degree of conversion is virtually not accompanied by the increase in the molecular weight of the product, which indicates that the chemical process occurs in the region of mutual penetration of two bonded macro- molecules formed in the first reaction stage. In other words, interpolymers are the products of reactions between two or several unlike macromolecules; the molecular weight of the interpolymer is approximately equal to the sum of those of the macromolecules that had reacted.The aforesaid can be contrasted with the following. First, the molecular weight mentioned above is the apparent molecular weight rather than the true molecular weight, since the experi- ments have been carried out in one solvent.73, 74 However, the true molecular weight can only be lower than the apparent molecular weight; therefore, one cannot say that the process occurs as conventional chaotic branching resulting in a considerable increase in the molecular weight. A A Askadskii Second, it can be assumed that in the case of polydisperse specimens, substantial enlargement of individual macromolecules can be accompanied by a slight increase in the weight-average molecular weight.This issue requires a special consideration. Let us perform such an analysis in the general form. The weight-average molecular weight is determined from the relationship where ni is the number of macromolecules with the molecular weightMi. Let us assume that both reacting polymers have equal molec- ular weights, which can be calculated using formula (35), and the same molecular weight distributions (MWD). Different variants of chemical reactions can be considered. Let small macromole- cules of different types react respectively in pairs with one another and let the same be true for medium-size and large macromole- cules. Then the formula for calculating the Mw of the reaction product will have the form i.e., the weight-average molecular weight of the reaction product is equal to the number of macromolecules that had reacted multi- plied by the initial molecular weight. In other words, in this case the weight-average molecular weight of the reaction product is equal to the sum of those of the initial macromolecules. If the smallest and the largest macromolecules react in pairs (cross reaction), the formula for calculating theMw of the product has the form is the molecular weight of the final fraction x.The dependence of the molecular weight of a fraction on its number can be linear:Mi=M1i, whereM1 is the molecular weight of the first fraction and i is the fraction number. In this case, from Eqn (38) it follows that Rw=R1+Rx , i.e., a monodisperse specimen is obtained.Thus, in all cases considered above, the weight-average molecular weight of the reaction product is equal to the sum of the molecular weights of the macromolecules that had reacted. Clearly, if initial specimens and reaction products are monodis- perse, theMw of the reaction product will be equal to nM0w, where n is the number of the macromolecules that had reacted. Experiments shows that the reaction product has a very broad MWD.73, 74 Let us consider a case of exaggerately broad MWD where all fractions are present in equal proportions, i.e., each fraction also contains an equal number of macromolecules (n1=n2=...= nx=n). In this case, the weight-average molecular weight M0w of the initial products is The number-average molecular weight M0n of the initial product isThe effect of strong intermolecular and chemical interactions on the compatibility of polymers Let us assess the polydispersity of the initial system, which is characterised by a linear dependence of the molecular weight of a fraction on the fraction number, Mi=M1i.The formulae for calculating theTherefore, if the conditionMi=M1i is met, the polydispersity index cannot be high and for x?? its value approaches 1.33. This also holds for the reaction products. The polydispersity index can be high (as is observed in the experiment) if the dependence of the molecular weights fractions on their numbers is nonlinear. Let us consider the modes of reactions between unlike polymers to form highly polydisperse specimens, assuming that the initial specimens are monodisperse. If the products of reaction between such polymers also are monodisperse, their weight-average molecular weights will be equal to the sum of the molecular weights of the chains that had reacted with one another.This statement requires no special proofs. To prepare specimens with high polydispersity index, it is necessary that the molecular weights of the final fractions be markedly different. Let us consider the exaggerately broadMWD once again. Let us assume that the number of chemically bonded macromolecules in each fraction is n1610 i, where n1 is a constant for each fraction and i is the fraction number. Then the molecular weight of the macromolecules in the first fraction will be M1n1610, that of the macromolecules in the second fraction will be M1n16102, etc., where M1 is the weight-average molecular weight of the initial monodisperse specimens.Then the weight- average molecular weight of specimens obtained will be "Xx OM # Xx . 10i 102i a 1 1 M1n1 ¢§1 Xx Xx After simplification of this formula we get (to some approx- imation)Mw&M1n1610x. IfM0w=M1, thenMw/M0w&n1610x, i.e., this ratio is equal to the number of chemically bonded macromolecules in each frac- tion. Therefore, the weight-average molecular weight of the reaction products must be equal to the sum of the molecular weights of the macromolecules constituting the interpolymer.Let the dependence of the molecular weight of a fraction on its number be of power type, which means that the number of bonded 329 macromolecules in each fraction is ni1. Then, the molecular weight i.e., in this case the weight-average molecular weight of the reaction product is also equal to that of the initial specimen M1 multiplied by the number of macromolecules in each fraction. Let us assume now that the initial specimens of two polymers are polydisperse. The weight-average molecular weight of a blend of such macromolecules is calculated using relationship (35). A polydisperse reaction product can be prepared using different procedures. One of them was considered above, viz., small macro- molecules should react in pairs with one another and large macromolecules should react in pairs with large macromolecules.In this case the weight-average molecular weight of the reaction products formed is higher than that of the initial specimens. The Let us consider an exaggerated case where all large macro- molecules in the fraction x, as well as all other macromolecules in other fractions, react with one another. As a result, only two giant macromolecules are formed. Analogous situation is also observed upon completion of the network formation. The weight-average molecular weight of such a reaction product will be 2 ! # Xx¢§1 " Xx¢§1 The ratio of this weight to that of the initial specimens,M0where i is the fraction number. Then Mw M0 i.e., in this case the ratio of the weight-average molecular weight to that of the initial specimens is also equal to the number of macromolecules that are chemically bound to one another.Thus, in both cases of (i) initially monodisperse and exagger- ately polydisperse specimens and (ii) monodisperse and exagger- ately polydisperse reaction products, the ratio of the weight- average molecular weights of the reaction products to those of the initial specimens is equal to the number of macromolecules in the interpolymer. In studies of fractions A and B of interpolymers by dynamic mechanical analysis 75 it was shown that the formation of chemical bonds between the macromolecules decreases the mobility of each macromolecule. In the plot of temperature dependence of the loss factor tan d the peaks or their `shoulders', characteristic of PTCB and PS, are shifted toward higher temperatures as compared to those of the mechanical mixture.The interpolymer is character- ised by a large storage modulus E 0 and a higher glass transition330 temperature as compared to that of each of the polymers and of their mechanical mixture. Studies of thermomechanical properties of interpolymers 76 have shown that their glass transition temperatures increase from 58 to 100 8C as the polymer blend is converted into the polymer A and then into the polymer B. This effect is analogous to that observed at the formation of a ladder polymer the glass transition temperature of which is higher than that of the strands that form the ladder.The Tg value decreases to 30 8C in the later reaction stages, i.e., as the polymer B is converted into the polymer C and then into the polymer D. In the case of formation of conventional polymer networks, the Tg value monotonically increases as the number of cross-links increases. Blends of PTCB with PS form transparent solutions up to a concentration of 10%; however, in studies of these blends by electron microscopy it was found 75 that phase separation of blend components occurs even in dilute solution. The interpolymer solution is also transparent; however, unlike the polymer blend, no indications of phase separation are observed in this case. Uniformly distributed large spherical particles are clearly seen when analysing the interpolymer using electron microscopy.Interpolymer films are transparent and display no indications of phase separation, whereas films of PTCB ± PS blends are turbid, with distinct phase separation. However, indications of microphase separation were found in the studies of interpolymer films by physical methods.75 Two separated peaks characteristic of PTCB and PS and shifted toward higher temperatures are observed in the plot of the temperature dependence of the loss factor tan d of the interpolymer. Two maxima characteristic of PS are also seen in the X-ray diffraction patterns of interpolymers isolated in the initial reaction stages; however, their intensities decrease as the extent of reaction increases. In the latest stage (polymer D), the maximum completely disappears.76 Most likely, microaggregation of PS and PTCB fragments occurs on solution casting; however, the size of domains built of unlike fragments is small and therefore the films retain transparency.It was also shown 79 that poly(vinyl chloride) (PVC) also can enter into the Friedel ± Crafts reaction with PS; however, it is less reactive than PTCB. From the data in Tables 4 and 5 it can be seen that the mechanical properties of films and moulded blocks of interpolymers based on PVC (and PTCB) with PS depend largely on their composition. The characteristics of mechanical properties of interpolymers are intermediate between those of the initial polymers and in some instances even surpass them. Particularly large is the increase in the impact strength of PVC ± PS interpol- ymers in the range of compositions close to the equimolar composition.The strength of interpolymers is much higher than that of mechanical mixtures of the initial polymers of the same composition (Table 6). Table 4. Tensile strength (st) and percentage elongation at rupture (e) of films of interpolymers based on PTCB and PS. PTCB : PS (mol. %) Parameter Chemical reaction between two unlike macromolecules in solution was theoretically analysed using the Monte Carlo dynamic simulation.74 The major conclusion drawn on the basis of results of the computer experiment is that the reaction between unlike macromolecules occurs by a mechanism of disordered formation of chemical bonds between the macromolecules of the `coil-in-coil' type.The reacting macromolecules are `drawn into' each other (the distance between their centres of gravity is shortened), and the reaction proceeds inside the region of inter- penetration. In actual experiments, changes in the number of chemical bonds between macromolecules were monitored using a specially developed precise refractometric method.80 In the first stage, a very small number of chemical bonds between the macromole- cules is formed; however, most of the macromolecules become bonded in pairs. In the second stage, the reaction proceeds in the macromolecular coils formed in the first stage and consists in an increase in the number of chemical bonds between macromole- cules already bonded, i.e., it is an intramolecular reaction of the first kind.Acceleration of this reaction compared to the interchain reaction is due to the appreciably lower activation energy, which is equal to 96.6 and 37.4 kJ mol71 in the first and in the second stage, respectively. Thus, preparation of interpolymers is an efficient method for the preparation of compatible polymers from initially incompat- ible ones. Such a compatibility can be called `forced compatibil- ity'. Interpolymers should be considered as individual class of polymers which possess the same and even improved properties compared with those of the initial polymers. VI. Conclusion The results of numerous studies show that there are several methods for the improvement of compatibility of polymers.First, it is selection of polymer pairs or modification of polymers. These are performed to give rise to strong intermolec- ular interaction (e.g., hydrogen bonding) between unlike polymer chains. This issue was analysed in detail above. Second, it is conducting of chemical reactions between blend components that result in the formation of interpolymers. Third, it is introduction of compatibilisers into the system. Compatibilisers are low-molecular weight and high-molecular weight compounds whose molecules contain functional groups capable of strengthening specific intermolecular interactions between the chains. Copolymers can be used as compatibilisers. Analysis of compatibility of polymers showed that the dependences of the glass transition temperature of blends on the composition vary in shape and can be described by relationships that require no fitting parameters; only the chemical structure of the components needs to be known to perform such an analysis.It is needless to say that this approach does not cover all possible cases of compatibility of polymers. Further investigations, includ- ing those in the framework of the approach considered, are required in order to take into account all peculiarities of the chemical structure of polymers that strongly affect their compat- ibility and properties.The effect of strong intermolecular and chemical interactions on the compatibility of polymers References 1. DRPaul, S Newman (Eds) Polymer Blends Vol.1 (London: Academic Press, 1987) 2.V N Kuleznev Smesi Polimerov (Polymer Blends) (Moscow: Khimiya, 1980) 3. V N Kuleznev Kolloid. Zh. 49 881 (1987) a 4. D R David, T F Sincock Polymer 33 4505 (1992) 5. S J Krause Polymer Blends Vol. 1 (Eds D R Paul, S Newman) (London: Academic Press, 1987) p. 27 6. A G Shvarts, B N Dinzburg Sovmeshchenie Kauchukov s Plastikami i Sinteticheskimi Smolami (Combining of Caoutchoucs with Plastics and Synthetic Resins) (Moscow: Khimiya, 1972) 7. A A Askadskii, Yu I Matveev, M S Matevosyan Vysokomol. Soedin., Ser. A 32 2157 (1990) b 8. Yu I Matveev, A A Askadskii A A Vysokomol. Soedin., Ser. A 36 436 (1994) b 9. Yu I Matveev, A A Askadskii Vysokomol. Soedin., Ser. A 31 526 (1989) b 10.A A Askadskii Physical Properties of Polymers, Prediction and Con- trol (New York: Gordon and Breach, 1996) 11. A A Askadskii Vysokomol. Soedin., Ser. A 41 (1999) b 12. V N Kuleznev Vysokomol. Soedin., Ser. B 35 391 (1993) b 13. M Bank, J Leffingwell, C Thiess Macromolecules 4 43 (1971) 14. T K Kwei, T Nishi, R F Roberts Macromolecules 7 667 (1974) 15. H A Schneider, N J Brekner Polym. Bull. 14 73 (1985) 16. H E Yang, Ph D Thesis, University of Massachusetts, 1985 17. H A Schneider, B Leikauf Thermochim. Acta 114 165 (1987) 18. J L Halary, F B C Larbi, P Oudin, L Monnerie Makromol. Chem. 189 2117 (1988) 19. K Schmidt-Rohr, J Clauss,H W Spiess Macromolecules 25 273 1992) 20. W M Prest Jr, R S Porter J. Polym. Sci., Polym. Phys., Part A-2 10 1639 (1972) 21.A R Shultz, B M Gendron J. Appl. Polym. Sci. 16 461 (1972) 22. T K Kwei, H L Frish Macromolecules 11 1267 (1978) 23. S P Ting, E M Pearce, T K Kwei J. Polym. Sci., Polym. Lett. Ed. 18 201 (1980) 24. M Kryszewski, J Jachowicz, M Malanga, O Vogl Polymer 23 271 (1982) 25. X Yang, P C Painter, M M Coleman, E M Pearce, T K Kwei Macromolecules 25 2156 (1992) 26. S P Ting, B J Bulkin, E M Pearce, T K Kwei J. Polym. Sci. 19 1451 (1981) 27. E M Pearce, T K Kwei, B Y Min J. Macromol. Sci., Chem. A21 1181 (1984) 28. D L Kotzev, E M Pearce, T K Kwei J. Appl. Polym. Sci. 29 4443 (1984) 29. J R Pennacchia, E M Pearce, T K Kwei, B J Bulkin, J-P Chen Macromolecules 19 973 (1986) 30. K Ogawa, F Tanaka, J Tamura, K Kadowaki, K Okamura Macromolecules 20 1172 (1987) 31.T K Kwei, E M Pearce, B Y Min Macromolecules 18 2326 (1985) 32. T K Kwei, E M Pearce, F Ren, J P Chen J. Polym. Sci., Part B, Polym. Phys. 24 1597 (1986) 33. P Lin, C Clash, E M Pearce, T K Kwei J. Polym. Sci., Part B, Polym. Phys. 26 603 (1988) 34. Y Y Chien, E M Pearce, T K Kwei Macromolecules 21 1616 (1988) 35. E M Pearce, T K Kwei Macromolecules 22 573 (1989) 36. F-L Chen, E M Pearce, T K Kwei Polymer 29 2285 (1988) 37. H Park, E M Pearce, W H Starnes Jr , T K Kwei J. Polym. Sci., Part A, Polym. Chem. 28 1079 (1990) 38. T P Yang, E M Pearce, T K Kwei, M L Yang Macromolecules 22 1813 (1989) 39. L F Wang, E M Pearce, T K Kwei J. Polym. Sci., Part C, Polym. Lett. 28 317 (1990) 40. L F Wang, E M Pearce, T K Kwei J.Polym. Sci., Part B, Polym. Phys. 29 619 (1991) 41. H-I Kim, E M Pearce, T K Kwei Macromolecules 22 3374 (1989) 42. H-I Kim, E M Pearce, T K Kwei Macromolecules 22 3498 (1989) 43. K J Zhu, S F Chen, T Ho, E M Pearce, T K Kwei Macromolecules 23 150 (1990) 44. H-i Kim, T K Kwei, E M Pearce Macromolecules 22 687 (1989) 45. E M Pearce, T K Kwei, S Lu Polym. Adv. Technol. 5 600 (1994) 331 46. S Makhija, E M Pearce, T K Kwei, F Liu Polym. Eng. Sci. 30 798 (1990) 47. L Jong, E M Pearce, T K Kwei, L C Dickinson Macromolecules 23 5071 (1990) 48. T Suzuki, E M Pearce, T K Kwei Polymer 33 198 (1992) 49. E M Pearce, T K Kwei Polymer Solutions, Blends and Interfaces (Eds I Noda, D N Dublingh) (Amsterdam: Elsevier, 1992) p.133 50. L Jong, E M Pearce, T K Kwei Polymer 34 48 (1993) 51. S Lu, E M Pearce, T K Kwei Macromolecules 26 3514 (1993) 52. H Zhuang, E M Pearce, T K Kwei Macromolecules 27 6398 (1994) 53. H Zhuang, E M Pearce, T K Kwei Polymer 36 2237 (1995) 54. E Y Chu, E M Pearce, T K Kwei, T F Yeh, Y Okamoto, Macromol. Chem., Rapid Commun. 12 4 (1991) 55. E M Pearce, T K Kwei J. Polym. Sci., Part A, Polym. Chem. 32 2597 (1994) 56. S Lu, E M Pearce, T K Kwei J. Macromol. Sci., Part A, Pure Appl. Chem. 31 1535 (1994) 57. S Lu,M M Melo, J Zhao, E M Pearce, T K Kwei Macromolecules 28 4908 (1995) 58. S Lu, E M Pearce, T K Kwei Polym. Eng. Sci. 35 1113 (1995) 59. S Lu, E M Pearce, T K Kwei Polym. Adv. Technol. 7 553 (1996) 60. S Lu, E M Pearce, T K Kwei, E Chu J.Polym. Sci., Part A, Polym. Chem. 34 3163 (1996) 61. T C Gsell, E M Pearce, T K Kwei Macromolecules 23 1663 (1990) 62. E M Pearce, T K Kwei J. Macromol. Sci., Part A, Pure Appl. Chem. 28 1207 (1991) 63. Y K Dao, E Y Chu, Z S Xu, E M Pearce, Y Okamoto, T K Kwei J. Polym. Sci., Part A, Polym. Chem. 32 397 (1994) 64. M W Huang, K J Zhu, E M Pearce, T K Kwei J. Appl. Polym. Sci. 48 563 (1993) 65. I I Vointseva,A A Askadskii Interpolymers (Paired Polymers) (Sov. Sci. Rev., B. Chem.) Vol. 16, Part 2 (Ed.M E Vol'pin) (Chur: Harwood Academ. Publ., 1991) 66. P C Painter, B Veytsman,M Coleman J. Polym. Sci., Part A, Polym. Chem. 32 1189 (1994) 67. P C Painter, M Coleman, in European Symposium on Polymer Spec- troscopy (ECOPS-11) (Abstracts of Reports), Valladolid, 1994 p.17 68. J K Isasi, L C Cesteros, I Katime, in European Symposium on Polymer Spectroscopy (ECOPS-11) (Abstracts of Reports), Valladolid, 1994 p. 79 69. A O Baranov, A V Kotova, A N Zelenetskii, E V Prut Usp. Khim. 66 917 (1997) [Russ. Chem. Rev. 66 877 (1997)] 70. USSR P. 717 077: Byull. Izobr. (7) (1980) 71. V V Korshak, A A Askadskii, I I Vointseva, B B Mustafaeva, A P Suprun, G L Slonimskii Vysokomol. Soedin., Ser. A 23 1002 (1981) 72. V V Korshak, A A Askadskii, I I Vointseva, B B Mustafaeva, G L Slonimskii, A P Suprun Dokl. Akad. Nauk SSSR 265 1147 (1982) c 73. B B Mustafaeva, Candidate Thesis in Chemical Sciences, Institute of Organoelement Compounds, Academy of Sciences of the USSR, 1983 74.V V Korshak, A P Suprun, I I Vointseva, B B Mustafaeva, G L Slonimskii, A A Askadskii, T M Birshtein, E N Kaneva Vysokomol. Soedin., Ser. A 26 111 (1984) b 75. V V Korshak, G L Slonimskii, A A Askadskii, O G Nikol'skii, A P Suprun, I I Vointseva, B B Mustafaeva, E M Belavtseva, L G Radchenko Vysokomol. Soedin., Ser. A 26 1929 (1984) b 76. V V Korshak, I I Vointseva, A P Suprun, A A Askadskii, G L Slonimskii Vysokomol. Soedin., Ser. A 29 140 (1987) b 77. VVKorshak,AP Suprun, I I Vointseva, I I Evstifeeva,GL Slonimskii, A A Askadskii Vysokomol. Soedin., Ser. A 29 1257 (1987) b 78. V V Korshak, A P Suprun, G L Slonimskii, A A Askadskii, T M Birshtein, I I Vointseva, B B Mustafaeva, O G Nikol'skii Makromol. Chem. 187B 2153 (1986) 79.V V Korshak, A P Suprun, I I Vointseva, B B Mustafaeva, G L Slonimskii, A A Askadskii, K A Bychko Vysokomol. Soedin., Ser. B 26 376 (1984) b 80. A A Askadskii, I I Vointseva, B B Mustafaeva, V V Kazantseva, G L Slonimskii Vysokomol. Soedin., Ser. A 24 2447 (1982) b a�Colloid. J. (Engl. Transl.) b�Polym. Sci. (Engl. Transl.) c�Dokl. Chem. Technol., Dokl.Chem. (Engl. Transl.) Abstract. The data on compatibility and on the properties of polymer blends are generalised. The emphasis is placed on the formation of strong intermolecular interactions (dipole ¡¾ dipole interaction and hydrogen bonding) between the components of blends, as well as on the chemical reactions between them. A criterion for the prediction of compatibility of polymers is described in detail.Different cases of compatibility are considered and the dependences of the glass transition temperatures on the composition of blends are analysed. The published data on the effect of strong intermolecular interactions between the blend components on the glass transition temperature are considered. The preparation of interpolymers is described whose macromole- cules are composed of incompatible polymers, which leads to the so-called `forced compatibility.' The bibliography includes 80 references. I. Introduction In the studies of polymer blends much attention is currently given to the effect of strong intermolecular and chemical interactions between the polymer blend components on their compatibility. Investigation of compatibility of polymers is of importance from both scientific and practical points of view.1¡¾3 In one of the concepts, it is proposed to analyse compatibility of polymers using the solubility parameter (the density of cohesive energy). The equation used to assess the parameter of the polymer ¡¾ polymer interaction (w) includes the solubility parameters of each polymer w a V RTOd1 ¢§ d2U2, (1) where Vis the molar volume of the rubber-like phase per repeating unit of the polymer; d1 and d2 are the solubility parameters of the polymers 1 and 2, respectively; R is the universal gas constant and T is the absolute temperature. According to this concept, polymers are compatible if the interaction parameter is positive and its value is close to zero. Limitations of this approach have been analysed.4 One of the limitations is associated with the necessity to calculate and measure the solubility parameter to a high accuracy. This is impossible for polymers since this parameter is assessed indirectly using determination of intrinsic viscosity of polymer solutions in various solvents followed by construction of the dependence of the intrinsic viscosity on the solubility parameter of the solvent in which the measurements have been carried out; construction of the dependence of the degree of swelling on the solubility parameter of the solvent in which swelling occurs, etc. The critical value of the parameter w, viz., the upper limit of solubility, is determined from the following relationship 5 wc a 1 2ON¢§1=2 1 a N¢§1=2 2 U2 , where N1 and N2 are the degrees of polymerisation of the components 1 and 2, respectively. Calculations or experimental measurements of the solubility parameters should be carried out with an accuracy of 0.1 (J cm73)1/2. A concept of compatibility of polymers using the solubility parameter has been developed in detail.4 In this study, individual contributions of the components into the solubility parameter were considered and the compatibility parameter (introduced previously 6), which is the difference between the cohesive energy densities of the components, was used. Let us consider other approaches to the prediction of the compatibility of polymers and the properties of blends obtained. According to the reported data,7¡¾11 the solubility of polymers occurs if the following inequality holds m < 1:374FF ¢§ AAAAAAAAAAAAAAAAAAAAAA F2 ¢§ 1 a a p . (2) Here m=d2 p/d2s , where dp is the solubility parameter of the polymer, ds is the solubility parameter of the solvent; the F value is found from the relationship F a 4VsVp 1=3 V1=3 s a V1=3 p 2 , (3) A A Askadskii A N Nesmeyanov Institute of Organoelement Compounds of the Russian Academy of Sciences, ul. Vavilova 28, 117813 Moscow, Russian Federation. Fax (7-095) 135 50 85. Tel. (7-095) 135 93 98. E-mail: andrey@ineos.ac.ru Received 11 December 1998 Uspekhi Khimii 68 (4) 349 ¡¾ 364 (1999); translated by AMRaevsky UDC 541.64 : 536.7 The effect of strong intermolecular and chemical interactions on the compatibility of polymers A A Askadskii Contents I. Introduction 317 II. Criteria for the compatibility of polymers 318 III. The effect of strong intermolecular interaction on the compatibility of polymers 321 IV. The effect of hydrogen bonding and strong dipole ¡¾ dipole interactions on the glass transition 323 temperature of compatible polymer blends V. Formation of chemical bonds between components of polymer blends 327 VI. Conclusion 330 Russian Chemical Reviews 68 (4) 317 ¡¾ 331 (1999) #1999 Russian Academy of Sciences and Turpi

ISSN:0036-021X    

出版商:RSC    

年代:1999

数据来源: RSC

摘要:

Russian Chemical Reviews 68 (4) 333 ± 342 (1999) Chemical approaches to the study of supramolecular biological structures with chromatin as an example D G Knorre, N D Kobets Contents I. Introduction II. Study of interhistone interactions in chromatin III. Study of DNA interactions with histones. `Zero-length cross-linking' IV. Study of functionally active chromatin V. Study of chromatin using reactive oligonucleotide derivatives VI. Conclusion Abstract. Chemical approaches to the study of the chromatin structure and certain aspects of its functioning are reviewed. The main attention is given primarily to those based on the method of `zero-length cross-linking' aimed at the investigation of the structure of histone complexes within nucleosomes and of the interactions of histones and other proteins with chromosomal DNA. The changes in the nucleosome structure during chromatin transcription are discussed.Recent data on the chemical modifi- cation of DNA and several chromatin proteins with reactive oligonucleotide derivatives are considered and analysed. The bibliography includes 89 references. I. Introduction Chromatin is one of the most complex supramolecular structures of eukaryotic cells which is responsible for the storage, multi- plication, repair and expression of genetic information.1 Chroma- tin comprises a great number of constituents and its structure manifests high dynamism associated with dramatic changes both during the cell cycle and as cell responses to incoming (mitogenic, etc.) signals.The eukaryotic nucleus is made up of several molecules of double-stranded DNA distributed between individ- ual chromosomes. The human haploid genome consists of 36109 base pairs (b.p.). Assuming that this DNA exists entirely in the B form where one loop (10 b.p.) has the length of 3.4 nm, the total length of DNA is *1 m, i.e., the whole set of 23 chromosome pairs measures *2 m in length. This DNA is packed into a nucleus with a diameter *20 mm. Thus, the degree of compacti- sation must be of about five orders. In the course of its functioning (replication, transcription, repair, recombination and formation of mitotic chromosomes), DNA is subject to substantial topolog- ical rearrangements, so that the array of proteins interacting with it changes drastically.At the molecular level, the structure and function of chroma- tin cannot be adequately investigated by physical methods alone. Not only the whole chromatin, even its domains are too large to allow their crystallisation for X-ray analysis, NMR studies or D G Knorre, N D Kobets Novosibirsk Institute of Bioorganic Chemistry, Siberian Branch of the Russian Academy of Sciences, prosp. Lavrent'eva 8, 630090 Novosibirsk, Russian Federation. Fax (7-383) 234 36 77. Tel. (7-383) 236 06 32. E-mail: knorre@niboch.nsk.ru (D G Knorre) Received 2 July 1998 Uspekhi Khimii 68 (4) 365 ± 375 (1999); translated by R L Birnova #1999 Russian Academy of Sciences and Turpion Ltd UDC 577.113.7 333 334 334 336 337 340 calculation of the DNA structure by the molecular dynamics method.Therefore, chemical methods appear to be highly suitable for the study of chromatin structure. Affinity modification of chromatin seems to hold especially great promise in gaining information about the structural rearrangements occurring in the nucleus during its functioning. In the first place, this refers to photomodification, which allows specific modifications of definite sites of chromatin over a very short time. The latter circumstance opens up new possibilites for the investigation of events that take place during the functioning of chromatin components. Chromatin represents a nucleoprotein complex of DNA with nuclear proteins, viz., with basic proteins (histones) and nonhi- stone proteins including the most well-studied HMG proteins which are considered in this review.It should be noted that during its functioning the nucleoprotein complex interacts with a large set of proteins involved in matrix synthesis, with nuclear matrix proteins (the structure of the nucleus which remains intact after its dissociation from the central nucleoprotein), etc. These com- pounds may be regarded as chromatin-associated proteins.1 The first level of chromatin organisation is the nucleosomal fibril with a diameter of *10 nm. It represents a DNA chain wound with definite periodicity around a complex made up of four histone pairs (an octamer) designated as H2A, H2B, H3 and H4. These discrete repeat units are obtained by mild treatment of nuclei or isolated chromatin with micrococcal nuclease.A com- plete nucleosome contains DNA of up to 200 b.p. in length. The core particle contains DNA of 145 ± 146 b.p. in length, which forms 1.75 turns of the left superhelix around the histone octamer. The rest of the nucleosome is regarded as a linker. The structure of the core nucleosome has been solved by X-ray analysis with a 7 A resolution.2 The linker region of DNA of a variable length is complexed with histone H1. This histone seems to play an important role in the formation of the next level of the structural organisation of chromatin, viz., the packing of the nucleosomal chain into a solenoid (a fibril which contains six nucleosomes per turn and has a diameter of 30 nm).In addition to histone H1, chromatin of avian, reptilian, amphibian and fish erythrocytes also contains linker histone H5. After removal of all nuclear histones with a concentrated sodium chloride solution containing detergents, DNA remains bound with the nuclear matrix and forms supercoiled loops.3 It was concluded from these data that DNA is attached to the protein backbone of the nucleus (the nuclear matrix) at definite sites. Electron microscopic studies revealed that after treatment of metaphase chromosomes with 2 MNaCl or an ionic detergentDNAforms loop-shaped domains fixed on the proteins of the chromosome backbone (`scaffold').4334 Thus, a fibril with a diameter of 30 nm forms domains appearing as 18 radial loops (each of them has an average length of 60 000 b.p.) that are fixed on the nuclear matrix.These densely stacked rosettes form the next organisational level, viz., the chromatid (Fig. 1).5 Double-stranded DNA Nucleosome chain (10 nm) Solenoid fibril (30 nm) Loop-shaped domains Mini-bend Chromosome 0.84 mm Figure 1. Various levels of chromatin organisation.5 The chemical approaches to the study of nucleosome structure were used to solve three main problems, viz., to establish the structure of histone complexes, to identify the sites of DNA interaction with histones and to study the rearrangements in chromatin resulting from the transition of genes into an active or inactive state. II. Study of interhistone interactions in chromatin The relative arrangement of histones in the octamer was studied using cross-linking with bifunctional reagents.Such bifunctional reagent as dimethyl suberimidate, which has a large `radius of action' (10 ± 20 A), cross-links practically all histone pairs within 2 nm 10 nm 30 nm 30 nm 0.25 mm 18 loops matrix (topoisomerase) matrix (scaffold) 0.84 mm 30 nm D G Knorre, N D Kobets the nucleosome. This finding corroborates the theory according to which the histone octamer is the basic structural element of the nucleosome.6± 8 The use of dimethyl suberimidate has made it possible to establish the following interactions: Lys74(H2A) ± Lys24 and Lys27(H2B), Lys85(H2B) ± Lys115(H3) and Lys77(H4), Lys85(H2B) ± Lys91(H4).9 ±11 How- ever, the radius of action of this lysine-specific reagent was too large to allow one to obtain information about the relative arrangement of histones in the core.Experiments with chemical (tetranitromethane and formaldehyde) and UV-induced cross- linking of nucleosomes gave more extensive information.9,12 ± 14 The strongest contacts were established between histone pairs H2A± H2B, H2B ±H4 and H3± H3. UV irradiation of nucleo- somes has made it possible to detect the interaction of histone H2A (Pro26) with histone H2B (Tyr37, Tyr40, Tyr42).15 Histones H4 and H2B are cross-linked with tetranitromethane and form- aldehyde as well as upon UV irradiation. The strongest contacts are localised in the C-terminal fragment of histone H2B and the N-terminal fragment of histone H4.It was thus concluded that histone H2B has two domains which interact with other histones. One of these domains localised in the C-terminal fragment interacts with histone H4, while the other one localised in the central domain interacts with histone H2A.9 Analysis of a large body of experimental evidence on cross-linking of histones with bifunctional reagents of various lengths did not reveal a single case of histones H4 ±H4 interaction even where `lengthy' cross-linking reagents were used. This prompts a conclusion that a crucial role in the formation of the (H3 ± H4)2 tetramer is played by H3 ±H3 contacts. The use of carbodiimides as the cross-linking reagents has made it possible to establish the presence of H1 ±H2A contacts.16 ± 18 Cross-linking of nucleosomal chain histones with carbodiimide has shown that the 74 ± 106 segment of histone H1 interacted with the 58 ± 129 segment of histone H2A.Moreover, cross-links of histone H1 to all core histones, especially to histone H3, could be obtained through the use of bifunctional reagents.19 ± 22 It may thus be concluded that histones H3 and H2A are localised in the sites where DNA enters and leaves the nucleosomal core, which is consistent with the model of a nucleosome proposed by Mirzabekov at al.23 III. Study of DNA interactions with histones. `Zero-length cross-linking' The works by Mirzabekov et al.23 ± 31 have made a weighty contribution to the study of the fine organisation of nucleosomes by chemical methods.The approach suggested is based on methylation of DNA resulting in 7-methylguanine and 3-methyl- adenine derivatives. Comparison of kinetics of formation of 7-methylguanine and 3-methyladenine derivatives upon methyl- ation of free DNA and DNA within chromatin revealed that histones have no effect on the alkylation of adenine residues from the side of the minor groove. However, the rate of methylation of guanine residues from the side of the major groove of chromatin DNA is by 15% lower in comparison with that of free DNA.27 ± 29 Determination of the length of DNA fragments in chromatin obtained by cleavage of the modified molecule at the sites of methylation revealed that histones do not protect from methyl- ation rather extended regions of DNA in the nucleosomal chains.It was therefore concluded that histones shield the major groove of chromatin DNA uniformly, over its whole length by 15% but do not shield the minor groove. Similar results were obtained in experiments with the binding of antibiotics distamycin A and netropsin with the minor groove of DNA.31 The method used to determine DNA± protein interactions in chromatin is based on chemical cross-linking of definite mono- meric units in the DNA molecule with amino acid residues of histones that directly interact with them. Such cross-linking (Scheme 1) involves: (a) labilisation of glycosidic bonds of deoxyribose residues with purine bases resulting from methylation of the latter at position 7 of guanine or at position 3 of adenine; (b)Chemical approaches to the study of supramolecular biological structures with chromatin as an example R R R O O O + + 7 7 O O P O P O O P NH3R0 NH3R0 O O O CH2 CH2 CH2 G(7Me)[A(3Me)] G(A) O O b a O O O + + 7 7 O O O O O P P P NH3R0 NH3R0 O O O R R R R is the fragment of DNA; R0 is the fragment of a protein molecule; (a) Me2SO4; (b) pH 6.8, 45 8C; (c) formation of the Schiff base; (d) NaBH4 or NaBH3CN.cleavage of the glycosidic bond at the modified residues to yield deoxyribose fragments carrying the aldehyde groups; (c) formation of covalent linkages of partially depurinated DNA with the protein (in particular, the Schiff bases with the e-amino groups of lysine provided these are nearby) followed by cleavage of the polynucleotide chain at the site of formation of these derivatives through the reaction of b-elimination and (d) reduc- tion of the histone ±DNA covalent bond that formed.As the covalent bond is formed directly between the deoxyribose residue of the nucleotide and the amino acid residue of the histone without any spacer, this method was named `zero-length cross-link- ing'.25, 30 Methylation [step (a)] is carried out with dimethyl sulfate. Generation of a positive charge in the 7-methylguanine or 3-methyladenine fragment makes possible hydrolysis of the gly- cosidic bonds of DNA at the sites of modification by gentle heating at neutral pH. The deoxyribose residue that formed exists in an equilibrium between the open aldehyde and cyclic hemiacetal forms.The reaction of the aldehyde group with the neighbouring amines results in covalent addition of the DNA fragment to the histone to yield the Schiff base. The length of the cross-linked fragment is equal to the distance from its 50-end to the cross- linking site. At low degree of DNA modification, when DNA is mostly cross-linked at only one site, the length of the cross-linked fragment indicates the position of the contact site relative to the end of nucleosomal DNA. Since the Schiff bases are rather labile, they should be stabilised by reduction with sodium borohydride or sodium cyanoborohydride to the corresponding alkylamines for further manipulations. If the reduction of the primary cross-links is carried out with NaBH4, the number of cross-links formed will be close to the number of histidine residues in the protein molecule interacting with DNA.Thus, this approach is sometimes referred to as histidine cross-linking. If reduction is performed with NaBH3CN simultaneously with cross-linking, this favours the cross-linking of DNA via lysines. This procedure has been termed the `lysine' protocol.32 The next step is sizing of the DNA fragments that formed and identification of the nature of the histones cross-linked to each of these fragments. This was carried out by two-dimensional diago- nal electrophoresis, which is the second principal element of the approach proposed by Mirzabekov et al.23 ± 31 Polyacrylamide gel electrophoresis of the whole cross-linked material in the first direction was carried out under denaturing conditions in the presence of urea and sodium dodecyl sulfate (SDS). The DNA fragments cross-linked to histones are separated according to the sizes of both the DNA fragment and the protein cross-linked to them.In other words, nucleoproteins containing polynucleotide 335 Scheme 1 R R O O + + + 7 7 7 O O O P O P O NH3R0 NH3R0 NH3R0 O O CH2 CH2 OH OH OH d c NHR0 O NR0 + 7O NH3R0 fragments of identical lengths migrate at different rates, this being the slower the larger is the size of the cross-linked histone. After treatment of the gel with pronase, which hydrolyses completely the proteins, the DNA fragments are fractionated according to their lengths in the second (perpendicular) direction.This proce- dure allows one to determine the lengths of these fragments using the corresponding markers. Identical fragments that had been attached to different histones appear to be displaced relative one another depending on the retardation upon separation in the first direction. On the other hand, each set of DNA fragments of different lengths which corresponds to cross-linking with the same protein is partitioned into diagonal stripes. Such DNA fragments contain no protein and can be regarded as `protein images'. The position of the diagonal points to the relatedness of each DNA fragment of particular size to a definite histone. In most experi- ments, an isotope label has been introduced into the 50-end of DNA by a conventional procedure.It consists in enzymic phos- phorylation of DNA with polynucleotide kinase, which transfers [32P]phosphate from [g-32P]ATP. The separated fragments are identified by autoradiography (for detailed description, see Ref. 33). It was found that the sites ofDNAcontacts with histones on each DNA strand are separated by a distance multiple of 10 nucleotides, which corresponds to the size of one turn of the double helix. This means that the histone octamer with the DNA wound around it interacts with one side of the double helix. Then, the opposite site is exposed to the action of DNAse I. The arrangement of histones on both strands of the nucleoso- mal core DNA established by the above-described method is shown in Fig.2.34 Each histone forms several contacts with DNA; H2A2 H2A2 H31 H31 H42 H41 H41 H32 H32 H32 H2B2 H2B2 H2B1 H2B1 50 30 80 70 60 50 0 10 20 30 40 90 100 110 120 130 140 146 0 30 20 10 146 140 130 120 110 100 90 80 70 60 50 40 50 30 H42 H32 H31 H31 H42 H2B2 H2B2 H32 H2A1 H31 H41 H2B1 H2B1 H2A1 Figure 2. A symmetrical model of arrangement of histones on both strands of DNA within the core nucleosome particle. The numbers from 0 to 146 designate the distance (the number of nucleotide residues) from the 50-end of DNA. Each of the two histone copies in a core particle is marked with a superscript 1 or 2. The histones are arranged along one strand of DNA in the following order: H2B25,35±H455,65±H375,85/ H488±HB105,115 ±H2A118±H3135,145/H2A145.23, 26336 histones H3 and H4 are associated with the centre of the core particle, while histones H2A and H2B are shifted to the periphery of the nucleosomal core.The contacts between the 30-terminal fragment of the core DNA and histones H3 have also been established. The positions of the histone dimers H2A± H2B and the histone octamer (H3 ± H4)2 on the double-helical molecule of the core DNA are rather autonomous (Fig. 2). This is consistent with the leading role of such specific complexes in the nucleosome assembly.35 [Presumably, nucleosomes are assembled during chromatin replication by cross-linking of the (H3 ± H4)2 octamer to DNA to form a primary unstable nucleoprotein particle, to which the H2A± H2B dimer is then attached to stabilise the nucleosome].Thus, the full pattern of interactions of each of the four histones with the DNA molecule within the nucleosomal core emerges. The main structural nucleosome components revealed by this approach are largely identical both in the isolated nucleosomes and within intact chromatin. The similarity of the primary organisation of nucleosomes isolated from different sources provides support for their conservative structure.24, 25, 36 The crucial role of histone H1 in chromatin condensation and maintenance of the 30 nm fibril, which is the next hierarchic level of chromatin organisation, was demonstrated in early studies of Georgiev et al.37 The zero-length cross-linking method allowed one to establish thatDNAof chromatin from Drosophila embryos is bound simultaneously with histone H1 and core histones.38, 39 It is known that the linker histone H1/H5 has three structurally and functionally different domains, viz., a central globular domain which is evolutionarily the most conservative, a relatively short N-terminal domain and a highly basic lengthy C-terminal domain (terminal domains are the most variable parts of the histone).40, 41 Cross-linking revealed that histone H1 interacts with the termini of the core DNA.It was found that the conservative, globular part of the H1 molecule interacts with the termini of the nucleosomal DNA and the nonstructured N- and C-terminal fragments of histone H1 interact with the external regions of the nucleosomal DNA.It was supposed that the H1 molecule serves as a bridge which binds together two neighbouring nucleosomes by folding the nucleosomal chain into a 30-nm fibril.26 Many polycyclic molecules having a rigid planar structure are able to intercalate, i.e., to be incorporated between two adjacent, stacked base pairs in the double helix of DNA. Intercalators, such as acridine, are bound predominantly to the linker site of DNA.42 A photoaffinity reagent based on acridine, viz., AcrNH(CH2)3N(- COC6H4N3-p)-(CH2)3NHAcr, where Acr is the acridine residue, was proposed for elucidation of the contacts of the linker DNA.43 Irradiation of a complex of this reagent with a complete nucleo- some results in photoaffinity modification, predominantly of proteins H1, H2A and H3.These data are in agreement with the results of binding of histone H1 with the linker DNA and corroborate the position of the other two histones on the periph- ery of the nucleosomal core DNA (see Fig. 2). In its original version, the zero-length cross-linking method provided information only about the nature of the nucleotide residue involved in the interaction with one or another histone. However, a methodology of identification of amino acid residues involved in the cross-linking has been exemplified with the interaction of chromosomal DNA with histones H5 44 and H4.45, 46 To this end, the cross-linked product was treated with nucleases or with 66% HCOOH/2% diphenylamine, after which the short oligo- or di-nucleotide fragment which remained bound to the protein was labelled with 32P using polynucleotide kinase. Identification of labelled fragments was carried out by traditional methods of peptide chemistry.It was shown that modifications in histone H5 predominantly affected the histidine residues (His25 and His62) in the globular fragment of the histone molecule and the N-terminal amino group of the threonine residue (Thr1). In histone H4, the cross-linking occurred predominantly at the His18 residue localised in the central globular domain.46 D G Knorre, N D Kobets IV. Study of functionally active chromatin Elucidation of the mechanism of rearrangements of chromatin, which take place during its passage into a functionally active state, primarily as a result of its involvement in transcription, is of considerable importance.Identification of nucleosomes associ- ated with regulatory and transcribed sites is carried out by the method of diagonal electrophoresis with nonlabelled DNA. Then the `protein images' formed are hybridised with the corresponding 32P-labelled probes. Heat shock genes of Drosophila cultured cells the heating of which to 37 8C triggers transcription of heat shock proteins (hsp), are studied in most details. This approach allows one to conduct parallel experiments with transcriptionally active and transcriptionally silent chromatin.32, 47 ± 49 The first investigations of this kind were carried out using zero-length cross-linking approach and employed both the `histi- dine' cross-linking method and the `lysine' protocol.The results of these studies were not identical, though. In the `histidine' method, where cross-linking of DNA to histones mostly occurs in the promoter, structural and 30-flanking sites of heat shock activated Drosophila genes with the central globular protein domain, tran- scription evokes initial reduction of the number of core histones followed by complete removal of the linker histone H1 and, ultimately, of all histones.47 In the case of the `lysine' protocol, cross-linking of histones affects their terminal domains, there was no significant difference in cross-linking of active and silent chromatin.It was concluded from these data that activation of transcription did not result in complete removal of histones from the transcriptionally active site of chromatin with the exception of the promoter site where histone ±DNA interactions are practi- cally absent (at least the sites in the promoter region with the length of up to 200 b.p. are free from histones). With further progress of transcription, the interactions of central globular domains of histones with DNA are weakened but the contacts of histone N- and C-terminal fragments with DNA are preserved.32 Thus, the passage from transcriptionally silent to transcriptionally active chromatin is accompanied by loosening or unfolding of the nucleosome structure, i.e., significant structural rearrangements take place.More recent studies made use of UV irradiation of whole cells for cross-linking of DNA to proteins. Hybridisation with `protein images' was carried out with DNA probes which represent a promoter fragment of hsp70 gene DNA, a fragment with the length of 900 b.p. within the transcribed subunit of the hsp70 gene and a nontranscribed fragment of ribosomal DNA. It was found that interactions of histone H1 with DNA occur even under conditions of active transcription. The exception is the promoter region where DNA± histone H1 contacts are absent. At the same time, in the case of active chromatin the promoter site interacted with two additional proteins with molecular weights of 50 and 100 kDa. Probably, these proteins are the factors responsible for the regulation of transcription. The 100 kDa protein binds predominantly to the encoding strand, whereas the 50 kDa protein binds to the complementary noncoding strand.49 It should be noted that cross-linking of the promoter to these two proteins takes place only upon activation of the heat shock gene and is absent in the inactive gene.It was shown 50 that the set of histones modified with azidoarylbisacridinylspermidine and cross-linkable to the active fraction of chromatin which is prefer- entially split with nucleases is different from that of the total preparation of chromatin. In the active fraction of chromatin, only histone H1 is subject to photoactive labelling, whereas histones H2A and H3 are not.This finding seems to corroborate the conclusion thatDNAin the active fraction of chromatin is less tightly bound to the histone core and the active chromatin has a more loose structure. Among nonhistone proteins of chromatin, HMG proteins with high electrophoretic mobility are studied in most details. HMG14 and HMG17 (10 000 and 9247 kDa, respectively) have been defined as proteins of transcriptionally active chromatin.51Chemical approaches to the study of supramolecular biological structures with chromatin as an example These proteins are known to bind to nucleosomes, this binding being especially tight in the case of active chromatin. Core nucleosomes and nucleosomes containing histone H1 were iso- lated from chicken erythrocyte chromatin, reconstituted with HMG14/17 proteins and then the proteins were cross-linked to DNA.52 Analysis of the cross-linked material by two-dimensional gel electrophoresis revealed that cross-linking of HMG14/17 to nucleosomes does not influence the distribution of histones along the DNA strand either in the core particle or in the complete nucleosome.The main contact sites of these proteins with DNA are at a distance of 25 and 115 nucleotides from the 50-end of the core particle. The contacts of the core histones H2A, H2B and H3 are grouped in the same terminal fragment of core DNA (see Fig. 2). These data are consistent with the results of cross-linking of proteins HMG14/17 and core histones to the lysine-specific bifunctional reagent, 2-iminothiolane.53 The photoactivated reagent, N-hydroxysuccinimide 3-[(4-azidophenyl)dithio]pro- pionate (SADP), cross-linked HMG proteins to the central frag- ment of histone H3.54 The proteins isolated from cell suspensions of chicken blood were used.54 The radioactive label was intro- duced into the proteins by reductive alkylation with [14C]H2CO after which the proteins were derivatised with SADP.Acylation at lysine residues converted the individual proteins HMG14 and HMG17 into their photoactive analogues carrying the N3C6H4SS(CH2)2C(O) fragment at amino groups of several lysine residues.UVirradiation of a complex with nucleosomes generated nitrene from the azide residue, which was cross-linked to one of the neighbouring proteins. After separation of the cross-linked proteins, the disulfide bridge can be cleaved by disulfide exchange with mercaptoethanol, which facilitates identification of histones cross-linked to HMG proteins.A more lengthy reagent, viz., N- hydroxysuccinimide 3-[(1-(2-nitro-4-azidophenyl)-2-aminoethyl)- dithio]propionate (SNAP), preferentially cross-links HMG14/17 to histone H2A.55 Probably, owing to differences in the geometry and size of SNAP and SADP molecules, they interact through their hydrophobic and photoreactive termini with different groups on the histone core surface where histones H2A and H3 are in close proximity to each other. These results suggest that the HMG fragment cross-linked to histone H3 is close to the Cys110 residue of histone H3 localised on the nucleosome surface.The Cys110 residue is in the open state; its conformation is character- istic of transcriptionally active chromatin.56 This finding prompts a conclusion that cross-linking of HMG14/17 proteins to the nucleosome may strengthen this conformation. Experiments with Ehrlich ascites cell nuclei fixed with form- aldehyde and subjected to DNA± protein cross-linking were undertaken to study the distribution of histones in the de novo synthesised DNA strand. The latter was synthesised in the presence of 5-bromodeoxyuridine 50-triphosphate. Thus, it con- tained 5-bromodeoxyuridine residues and could therefore be identified and investigated using polyclonal antibodies against 5-bromodeoxyuridine. It was shown that histones of de novo synthesised chromatin had the same stoichiometry as the original one. Histone H1 binds to the daughter DNA strand simultane- ously with, or immediately after, the cross-linking of core histo- nes, although the cross-linking to the de novo synthesised DNA is weaker in comparison with the original chromatin.57 An important role in the cross-linking of transcription factors to nucleosomes is played by specific proteins, viz., nucleoplasmin, or its yeast analogue, NAP-1 (nucleosome assembly protein).These proteins induce the formation of a ternary complex of the transcription factor (nucleoplasmin or NAP-1). The use of a chemical approach based on cross-linking of histone octamer proteins with dimethyl suberimidate confirmed the fact that the mechanism of action of these proteins consists in elimination of the H2A± H2B dimer followed by elimination of the remaining histone tetramer (H3 ± H4)2. This study made use of the yeast activating factor GAL4-AH, which binds to a definite DNA sequence preceding the lacZ gene.This factor was investigated with the help of a specially designed system which included aDNA 337 fragment (153 b.p.) and a binding site for GAL4 separated by a distance of 35 b.p. from one of the ends of the nucleosomal core. It was found that the stimulating effect of nucleoplasmin or NAP-1 (which under normal conditions stimulate the binding of GAL4-AH to native nucleosomes) was not manifested when nucleosomes with histone octamers cross-linked with dimethylsu- berimidate were used.However, after reconstitution of nucleo- somes from the cross-linked H2A± H2B complex with subsequent introduction of all the other core histones, the functions of nucleoplasmin and NAP-1 were not disturbed. Thus, separate removal of the first pair of histones H2A±H2B from the remain- ing part is problematic.58 According to previous reports, such removal may not be complete but rather result from significant bond loosening. Mapping of DNA± protein contacts along definite sequences of DNA was carried out using a model of ribosomal genes. This model is very convenient for establishing the relationship between the regulation of gene activity and structural rearrangements in chromatin.59, 60 Ribosomal RNA genes are present in Drosophila cells as 250 copies where they are grouped into tandem repeats in which transcription elements are separated by spacers containing repeating sequences (239 b.p.) flanked by recognition sites for AluI restrictase.Restriction enzymes (restrictases) catalyse the cleavage of DNA at tetra- or hexa-nucleotide sequences which are strictly specific for each restrictase. These repeating sequences are homologous to the promoter sites of ribosomal genes and play a prominent role in their transcription. UV-induced cross-linking and hybridisation with `protein images' allowed one to identify two proteins (mol. masses 50 and 70 kDa) associated with the Alu-repeat. V. Study of chromatin using reactive oligonucleotide derivatives Studies of affinity modification of chromatin with various oligo- nucleotide derivatives are of interest as an approach to the investigation of the structure of this most important type of DNA± protein complexes as well as due to the necessity of elaboration of methods for targeted attack on definite genes and mRNA with complementary oligonucleotides aimed at modulat- ing their expression and induction of directed mutagenesis.This approach was first proposed by Grineva et al.61 and exemplified with reactive oligonucleotide derivatives in order to direct (address) a bound reactive group to a definite site in the target nucleic acid with the help of a complementary oligonucleotide. Hence, the original name of this method is `complementarily addressed modification'.At present, the methods based on the reactions of definite sense sites of a target nucleic acid with specific oligonucleotides, their derivatives or analogues are referred to as the antisense approach. This approach is gaining popularity as a helpful tool in molecular-biological studies and the reagents are considered as potential therapeutically valuable compounds, in the first place, antiviral and antitumour preparations which interact with genetic structures.62, 63 In the majority of cases, antisense oligonucleotides are used for cross-linking to single-stranded (matrix or viral) RNA. The possibility to act upon DNA by suppressing the effects of oncogens or integrated viral genomes would significantly extend the range of their therapeutic applications. Therefore, DNA presents an attractive object for application of such oligonucleo- tide derivatives.In this connection, a great deal of effort is given to the design of oligonucleotides able to suppress the DNA function due to the formation of ternary complexes.63 However, an alternative approach consisting in the treatment of unwound regions of DNA that exist in chromatin with oligonucleotide derivatives is also possible. Chromatin DNA of eukaryotic cells is not a strictly double- helical structure over its whole length. In the course of cell functioning (e.g., during replication or transcription), definite338 sites of DNA can be temporarily unwound. The DNA of complex nuclear structures may contain single-stranded regions which can interact with oligonucleotide derivatives.Such single-stranded sites of the DNA molecule can be formed as a result of DNA interaction with specific proteins able to unwind the double helix or due to the presence of superhelical domains in DNA. The possibility of specific chemical modification of DNA within chromatin and in the intact nuclei with complementarily addressed reagents was experimentally studied at the Novosibirsk Institute of Bioorganic Chemistry of the Siberian Branch of the Russian Academy of Sciences (see below).64 ± 68 Repeating sequences, which are abundant in the eukaryote genome and represent a fundamental distinction of the genome organisation in higher eukaryotes, were selected as targets to study the interaction of oligonucleotides with chromatin DNA.69 The human genome contains short (about 300 b.p.) repeats which alternate with unique sites and contain a site recognisable by restrictase AluI.70 These repeats are referred to as Alu-repeats and constitute about 3% of the human genome (36105 copies per genome).The left and the right halves of the Alu-repeat are characterised by a high degree of homology and are flanked with oligoadenylic regions (up to 20 b.p. in length). The dinucleotide repeat (dG-dT)n with its complementary oligonucleotide p(dA-dC)6 comprises about 0.5% of the eukaryotic genome. The occurrence of relatively short (up to 50 b.p.) sites of this repeat occur in the eukaryotic genome in 1 per 30 000 ± 100 000 base pairs, on the average.71, 72 According to numerous reports, the (dG-dT)n repeat was detected in the sites of transition of DNA from the B- to the Z-conformation.73 ± 75 Such a transition may provoke local unwinding of DNA in these sites of chromatin and thus make them accessible to complementary interaction with the corresponding oligonucleotide derivatives, e.g., p(dT)16, p(dA)16, p(dA-dC)6 and pd(TTCTCCTGCCTCAGCCTCTT) (which is complementary to the most conservative site of the Alu-repeat family).In the first series of these investigations, oligonucleotide derivatives, e.g., p(dT)16, were used containing a reactive alkylat- ing group, viz., 4-[(N-2-chloroethyl-N-methyl)amino]benzylamine attached through a phosphamide bond to the 50-terminal phos- phate group.The experiments were carried out on chromatin isolated from rodent and human cells as well as on metaphase chromosomes and intact nuclei. The study of a possibility of specific cross-linking of an oligothymidylate derivative, complementary to the polyA-repeats of DNA widely distributed in the eukaryotic genome, to DNA from the soluble fraction of human placenta chromatin demon- strated that the alkylating derivative modifies chromatin at room temperature.64 Nonmodified p(dT)16 strongly inhibits the mod- ification. At the same time, the oligonucleotides which are not complementary to the polyA-repeats do not influence the modification, which points to the specificity of interaction.Preliminary treatment of chromatin with RNase A under con- ditions ensuring hydrolysis of polyriboadenylate sequences present in the majority of chromatin matrix RNAs does not virtually exert any influence on the degree of modification with the same reagent. Hence, it is DNA that is subjected to modifica- tion.It was shown that reactive oligonucleotide derivatives can specifically modify DNA both within chromatin and in the most densely packaged deoxyribonucleoproteins, viz., metaphase chro- mosomes. However, nuclear DNA was not subjected to modifi- cation under identical conditions.65, 76 In the case of modification of the Alu-repeat, the specificity of modification was additionally confirmed by data from restriction analysis.An oligonucleotide selected for modification was com- plementary to one of the most conservative sites of the Alu-repeat localised inside the 170 b.p. fragment cut out with Sau3A restric- tase. After modification of human HeLa cell chromatin, DNA was isolated and cleaved with restrictase Sau3A. The resulting fragments were separated by electrophoresis in polyacrylamide D G Knorre, N D Kobets gel. Autoradiography of the gel revealed that the radioactivity imparted by the covalently attached oligonucleotide derivative was detected in the 170-b.p. fragment, whereas in control experi- ments where the oligonucleotide derivative had a different sequence, the radioactivity was not found.77 It was shown that preliminary treatment of chromatin preparations with S1-nuclease, which cleaves under mild condi- tions single-stranded regions of DNA with preservation of the general morphology of these specimens, results in practically complete inhibition of chromatin modification with oligonucleo- tide derivatives.76, 77 This indicates that the interaction of oligo- nucleotide derivatives withDNA occurs via the formation of their complementary complexes with unwound regions of chromatin DNA.A study of the interaction of the alkylating oligothymidylate derivative with chromatin isolated from various types of cells (e.g., replicating cells of regenerating rat liver and chicken erythrocyte cells in which chromatin was completely repressed both in tran- scription and replication) made it possible to gain insight into the nature of structural peculiarities of DNA in chromatin that are responsible for the formation of local unwound regions allowing for specific interaction with oligonucleotide derivatives.67, 68 Regenerating rat liver is a classical object for investigation of various processes occurring in the cell during intensive replication.The maximum replication in liver cells is observed 22 ± 24 hours after partial hepatectomy. The nuclei isolated from intact and regenerating rat liver cells were treated with the p(dT)16 alkylating derivative. The relative degrees of modification of DNA appeared to be identical in both cases. This suggests that the formation of replication forks does not cause any significant increase in the number of polydeoxyadenylate sites accessible to the complemen- tarily addressed reagent.Similar results were obtained in the studies designed to compare the degree of modification of DNA at polydeoxyadenylate sequences in the nuclei of both non- synchronised cells and cells synchronised in the S-phase of the cell cycle where DNA synthesis occurs with the greatest intensity. Differentiation of erythroblasts into erythrocytes is accompa- nied by inhibition of replication and transcription. Fully repressed (both in transcription and replication) chicken erythrocyte chro- matin is modified at poly(dA) sequences with the same efficiency as does chromatin isolated from regenerating rat liver. This suggests that activation of replication and transcription does not increase the accessibility of poly(dA) sites of DNA to complemen- tarily addressed modification.68 It has been shown that the presence of a nuclear membrane is not an obstacle to the penetration of the oligonucleotide inside the cell.The degree of modification of DNA in both intact nuclei and the `suspension' chromatin obtained by mechanical disintegration of the nuclear membrane are nearly identical. Therefore, it would be logical to suppose that the existence of unwound sites of DNA containing the targets is most likely determined by the level of superhelisation of DNA and the structural and functional char- acteristics of chromatin. It is known that in contrast with suspension chromatin and intact nuclei, the soluble fraction of chromatin in a buffer containing no bivalent metal ions is largely represented by unwound nucleosome strands. The degree of modification of DNA of the `soluble' fraction was one order of magnitude lower than that of the `suspension' chromatin and intact nuclei.76 This result may be due to the presence in the latter of loop-shaped structures formed by DNA fibrils fixed on the nuclear matrix (which enhances superhelisation of DNA) and nonhistone pro- teins.Evidence for the role of superhelisation of DNA in addressed alkylation of chromatin can be also derived from the dependence of the relative degree of DNA modification in intact nuclei on ionic strength. An increase in NaCl concentration up to 0.15 ± 0.2 M is accompanied by a decrease in the degree of modification of DNA.67 In this concentration range, the activityChemical approaches to the study of supramolecular biological structures with chromatin as an example of endogenous topoisomerase I, which favours relaxation of the superhelical conformation of DNA, is at maximum.The effect of changes in chromatin structure caused by removal of definite protein groups on the degree of accessibility of DNA for affinity modification was studied in experiments with deoxyribonucleoproteins DNP-0.35, DNP-0.6 and DNP-2.0 obtained from chromatin by treatment with 0.35, 0.6 and 2.0 M NaCl, respectively. It is known that treatment of chromatin with 0.35 M NaCl yields a fraction of nonhistone proteins containing HMG-pro- teins.Removal of these proteins from HeLa cell chromatin decreases the relative degree of modification of poly(dA) and (dG-dT)n sites of DNA by addressed reagents. Treatment of chromatin with 0.6 M NaCl results in the removal of histone H1 and some nonhistone proteins. The degree of modification may increase under these conditions because the removal of histone H1, which binds to the linker sites of chromatin DNA, results in their liberation. It is these sites that are potentially more accessible to complementarily addressed modification with the chloroalkyl derivative. Treatment of chromatin with 2 M NaCl results in the removal of the majority of nonhistone proteins and of all histones. The relative degree of modification of poly(dA) and (dG-dT)n sites ofDNAdecreases, but still markedly exceeds that of isolated DNA.Electron microscopy of DNP-2.0 obtained by such treatment revealedDNAfibrils as loops fixed on the nuclear matrix. Our experimental results may testify to the contribution of specific chromatin proteins preserved in the structure of chromatin after its treatment with 0.6 M NaCl but completely removed by treatment with 2 M NaCl to the appear- ance of sites in DNA that are accessible for modification and enriched with poly(dA)- and (dG-dT)n-repeats. get'.76, 77, 79 Among alkylating oligonucleotide derivatives, that with a cholesterol residue at its 30-end manifested the greatest efficiency for modification of DNA from intact nuclei which exceeded that of the oligonucleotide derivative devoid of cholesterol residue by an order of magnitude.78 Later it was shown that the alkylating oligonucleotide deriv- atives modify not only DNA when they form specific complexes with chromatin DNA, but also definite proteins, presumably localised at the site of their interaction with the DNA `tar- Despite intensive investigations into the structure of meta- phase chromosomes and interphase chromatin, the topography of chromosomal proteins is still poorly examined.Most often, specific binding of proteins to definite sequences of DNA is carried out by gel filtration or affinity chromatography on columns with immobilised DNA. However, the conditions for complex formation provided by these methods do not strictly simulate the conditions inside the cell.Moreover, they do not reflect the dependence on the DNA conformation stabilised by superhelisation or DNA± protein interactions. Therefore, the use of these methods for the study of dynamic changes in the protein environment of DNA sequences in chromatin and regulatory processes is limited. In this context, addressed modification may become promising in the study of protein environment of DNA sequences in the unwound regions of chromatin. The chromatin proteins subjected to specific modification with oligonucleotide derivatives that are complementary to pol- y(dA)-, (dG-dT)n- and Alu-repeats were analysed by gradient SDS electrophoresis. Protein specimens were treated with micrococcal nuclease to destroy the oligonucleotide fragment covalently attached to the protein.This fragment might change the mobility of the modified protein in electrophoresis. It has been shown that modification with the p(dT)16 alkylat- ing derivative affects at least two major proteins in intact rat liver nuclei with average molecular weights of 19 ± 20 and 27 ± 28 kDa.79 Addition of a 10-fold excess (with respect to the reagent) of nonlabelled p(dT)16 results in inhibition of alkylation of these proteins. However, an excess of the oligonucleotide pd(CATGCAAAACCTTCCC) having the same length but a 339 random nucleotide sequence does not interfere with the protein alkylation, which points to the specificity of the interaction of the reagent with the proteins.Such interaction may occur in both the complementary complexes of the oligonucleotide with the target DNA and with proteins showing affinity for oligothymidylate. Analysis of the chromatin protein components alkylated with p(dA)16 and p(dT)16 derivatives revealed them to be the same in both cases. These data suggest that this reaction occurs through the formation of a complementary complex between the oligonu- cleotide address of the reagent and the corresponding sites of the unwound chromatin DNA. Interestingly, the protein with the molecular weight of 19 ± 20 kDa is modified with the reagent within both intact chromatin and the DNP complex prepared by treatment of chromatin with 2 M NaCl (DNP-2.0). Hence, this protein can be related to the group of nuclear matrix proteins.79 Alkylation of nuclei with the (dA-dC)6 derivative yields a radically different set of modified proteins.Six proteins (or groups of proteins) are specifically modified with the p(dA-dC)6 deriva- tive. An oligonucleotide having the same length but a different sequence has no effect on their modification. Treatment of HeLa cell nuclei with the p(dA-dC)6 derivative gave a more complex set of modified proteins.76 In addition to proteins presumably analogous to modified proteins from rat liver (19.5, 21, 25.5, 31, 33 and >66 kDa), modification affects a number of other proteins the alkylation of which is not inhibited by an excess of the oligonucleotide. Since inhibition of modifica- tion with an excess of the oligonucleotide of the same sequence does not rule out the possibility of alkylation of proteins that are not associated with local unwinding sites but show affinity for the address oligonucleotide, cell nuclei were treated with S1-nuclease (under conditions of cleavage of single-stranded regions of chro- matin DNA) to demonstrate the specificity of modification of the proteins in the complementary complex.This study showed that seven proteins presumably localised in local unwinding sites were subjected to specific modification.76 Several researchers have demonstrated 80 ± 83 that natural polyamines (spermine and spermidine) induce the transition of DNA from the B- to the Z-conformation and stabilise the left- helical Z-conformation under physiological ionic conditions. The affinity modification of chromatin and intact eukaryotic (human and rat liver) cell nuclei with the p(dA-dC)6 alkylating derivative at the (dG-dT)n-repeats of DNA has been studied under physio- logical conditions and at high concentrations of spermine and spermidine.84 Analysis of chromatin proteins subjected to specific modification with this oligonucleotide derivative revealed that the efficiency of modification of bothDNAand the proteins increases in the presence of high concentrations of spermine and spermidine and sharply decreases after preliminary treatment of chromatin with S1-nuclease under conditions of mild hydrolysis of single- stranded regions of DNA. These data testify to the fact that the B?Z transition is a reason for the presence of unwound sites accessible for the interaction with a complementary oligonucleo- tide in the DNA containing the (dG-dT)n repeating units.Modification of HeLa cell nuclei with the p(dT)16 derivative affects four proteins (19, 47, 61 and >66 kDa). Their modifica- tion is inhibited by an excess of the nonmodified oligonucleotide and by preliminary treatment with S1-nuclease. Treatment of cell nuclei with the alkylating derivative of pd(TTCTCCTGCCTCAGCCTCTT), which is complementary to the most conservative site of the Alu-repeat, allowed one to identify a number of proteins that are modified apparently during the formation of a complementary complex between the oligonu- cleotide address and the unwound regions of chromatin DNA.Data from modification with an excess of the free oligonucleotide and its inhibition upon prior treatment with S1-nuclease testify to specific modification of proteins or groups of proteins with molecular weights of 18, 22, 26, 28, 43, 68 and 93 kDa and of two proteins with molecular weights>94 kDa.340 The transition of chromatin from the interphase state to metaphase chromosomes is accompanied by significant structural rearrangements resulting in structures with the maximum level of DNA compactisation. The use of reactive oligonucleotide deriv- atives for modification of interphase nuclei and metaphase chromosomes clearly demonstrates that the sets of specifically modified proteins for these two chromatin states differ essentially.Thus, the 28 kDa protein is not subjected to modification within chromosomes, while proteins with molecular weights of 27, 31 and 40 kDa, which are not modified within the interphase nuclei, do undergo modification . Comparison of the sets of the alkylated proteins isolated from the nuclei of intact and regenerating rat liver cells has demon- strated the presence in the latter of two additional modified proteins with molecular weights of 22 ± 23 and 29 ± 30 kDa along with 19 ± 20 and 28 ± 29 kDa proteins.79 The differences in the sets of modified proteins can be explained either by changes in their accessibility for alkylation due to the structural rearrangements resulting from activation of chromatin during replication or by changes in the protein environ- ment in the poly(dA) sites of DNA.In order to make sure that the given set of proteins is not directly related to the chemical nature of the reagents used for their modification, analogous experiments were carried out with p(dT)16 derivatives. In this study, photoactivated fragments carrying an azido group, instead of the alkylating group, viz., XC(O)NH(CH2)2NH, where X=2-NO2-5-N3C6H3, 4-N3C6H4 and 4-N3C6F4, have been attached to the 50-ends. The set of modified proteins was practically identical in both cases. The degree of DNA modification with photoactivated reagents was lower, whereas the degree of protein modification was much higher than with the alkylating reagent. In all cases studied, the modification was specific, viz., oligothymidylate, which contained no reactive group, strongly inhibited this process.85 Recently it has been established that reagents with a p-azidoa- niline residue as a photoreactive group stand out among other commonly used photoactivated reagents in terms of specificity.Such reagents have practically no effect on the nucleotide compo- nents.86 Therefore, the spectrum of proteins modified by the oligothymidylate derivatives carrying a photoreactive arylazido group, 2-NO2-5-N3C6H3C(O)NH(CH2)2NH(pdT)16 (1) and 4-N3C6H4NH(CH2)4NH(pdT)16 (2), have been compared.87 Pho- tomodification of intact nuclei isolated from HeLa cells has shown that the degree of modification with the reagent carrying a p-azidoaniline residue (2) is much higher, while the set of modified proteins is practically identical.In the same study,87 the authors compared the sets of proteins photomodified with reagent 1 within the nuclei isolated from HeLa cells and synchronised at the G1/S interface and in the S-phase. In this case, the spectra of modified proteins were different, viz., the 160 kDa protein was present only in the nuclei isolated from cells synchronised at the G1/S interface. This result points to the possibility of usage of photoreactive oligonucleotide derivatives for the analysis of changes in the protein environment in regions containing unwound DNA sequences and for the study of their accessibility in different stages of the cell cycle. A p(dT)16 derivative which contains simultaneously an alky- lating group (ClX) at the 50-end and a biotin residue (Bio) at the 30-end of the oligonucleotide [ClX-p(dT)16-Bio] has been synthes- ised in order to visualise the sites of cross-linking of oligodeoxy- ribothymidylate to chromatin.88 Biotin manifests extremely high affinity for streptavidin and its conjugates.It was demonstrated that the introduction of the biotin residue into the 30-end of the alkylating derivative of the oligonucleotide does not influence its reactivity. The efficiency of DNA modification with both ClX- p(dT)16 and ClX-p(dT)16-Bio is nearly identical. This fact was used to visualise the modification sites by luminescence micro- scopy. The study was carried out on HeLa cells and on cells of hybrid clones containing human and Chinese hamster chromo- D G Knorre, N D Kobets somes.89 Modified cells were treated with the streptavidin ± fluor- escein isothiocyanate conjugate.The specific luminescence of nuclei after treatment of hybrid cells was of two types. The luminescence was the most intense in the nucleoli. However, in some cells point luminescence was observed in the sites that are not directly linked with the nucleoli but are discretely distributed over the nucleus volume. This suggests that the regions of active transcription of chromatin (nucleoli) are subjected to the most intense modification, whereas the densely packaged DNA of heterochromatin is inaccessible. Modification of HeLa cell chromatin has demonstrated that in these cells the common signal elicited by the nucleus is much higher in comparison with hybrid human ± hamster cells, appa- rently as a result of intensive proliferation of HeLa cells.In addition, the genome of a hybrid cell is partly inactivated. Apart from nucleolar and point signals, HeLa cell nuclei display a third type of specific luminescence, namely the luminescence of the near-membrane region of the nucleus where polyA sites are especially abundant. We have developed 89 a procedure for visualisation of mod- ification sites in chromatin which is based on in situ hybridisation but differs essentially from it. In the case of standard technologies, the preparations used for hybridisation are first fixed to preserve the morphology, after which DNA is denatured for further hybridisation with the probe.This method involves specific modification of a target sequence of DNA within the native chromatin or intact nuclei, which affects only those sequences of DNA that are localised in the sites of its local unwinding. VI. Conclusion In-depth studies of chromatin by chemical methods based on molecular resolution and registration of the dynamic events are still in the initial stage. However, one can see from the above data that chemical approaches make it possible to establish the fine structure of nucleoprotein complexes within chromatin, to iden- tify even the interacting amino acid residues in the case of protein ± protein contacts and the interacting amino acid and nucleotide residues in the nucleoproteins.A methodology has been developed for establishing these contacts for one of the most essential functional processes, viz., the transition of chromatin into a transcriptionally active state. There is no doubt that these approaches will gradually progress to hold a central position in the study of other vital processes, such as replication, repair and recombination. Another important feature of chemical methods is the possi- bility to detect new components of nucleoprotein complexes as can be evidenced from the discovery of two novel proteins interacting with the promoter sites of the hsp gene. At present, separation of hundreds of proteins by two-dimensional electro- phoresis does not present any problem. However, establishing of physical and functional contacts between individual proteins and between proteins and nucleic acids (especially those localised directly in the intact nucleus) is a task which can be successfully solved through the use of chemical approaches.Finally, the changes in the spectrum of protein contacts observed during activation of transcription in chromatin and interactions of oligonucleotides with proteins in different phases of the cell cycle provide evidence that chemical approaches offer new possibilities for recording the changes that take place during transitions from one state of chromatin to another. References 1. K E van Holde, in Chromatin (Berlin: Springer, 1988) p.186 2. T J Richmond, J T Finch, B Rushton, D Rhodes, A Klug Nature (London) 311 532 (1984) 3. P R Cook, I A Brazell J. Cell Sci. 19 261 (1975) 4. M Marsden, U K Laemmli Cell 17 849 (1979)Chemical approaches to the study of supramolecular biological structures with chromatin as an example 5. R H Getzenberg, K J Pienta,W S Ward, D S Coffey J. Cell. Biochem. 47 289 (1991) 6. R D Kornberg, J O Thomas Science 184 865 (1974) 7. A Stein, M Bina-Stein, R T Simpson Proc. Natl. Acad. Sci. USA 74 2780 (1977) 8. C W Carter Jr, L F Levinger, F Birinyi J. Biol. Chem. 255 748 (1980) 9. H G Martinson, R True, C K Lau,M Mehrabian Biochemistry 18 1075 (1979) 10. J D McGhee, G Felsenfeld Ann. Rev. Biochem. 49 1115 (1980) 11. J E Callaway, R J DeLange, H G Martinson Biochemistry 24 2686 (1985) 12. H G Martinson, R J True Biochemistry 18 1947 (1979) 13.H G Martinson,M D Shetlar, B J McCarthy Biochemistry 15 2002 (1976) 14. W M Bonner, H B Pollard Biochem. Biophys., Res. Commun. 64 282 (1975) 15. R J DeLange, L C Williams, H G Martinson Biochemistry 18 1942 (1979) 16. W M Bonner, J D Stedman Proc. Natl. Acad. Sci. USA 76 2190 (1979) 17. D Ring, R D Cole J. Biol. Chem. 254 11 688 (1979) 18. T Boulikas, J M Wiseman,W T Garrard Proc. Natl. Acad. Sci. USA 77 127 (1980) 19. B O Glotov, A V Itkes, L G Nikolaev, E S Severin FEBS Lett. 91 149 (1978) 20. R G Hardinson, D P Zeitler, J M Murphy, R Chalkley Cell 12 417 (1977) 21. W M Bonner Nucl. Acids Res. 5 71 (1978) 22.J O Thomas, A J A Khabaza Eur. J. Biochem. 112 501 (1980) 23. A D Mirzabekov, V V Shick, A V Belyavsky, V L Karpov, S G Bavykin Cold Spring Harbor Symp. Quant. Biol. USA 42 149 (1977) 24. V V Shick, A V Belyavsky, S G Bavykin, A D Mirzabekov J. Mol. Biol. 139 491 (1980) 25. A D Mirzabekov, V V Shick, A V Belyavsky, S G Bavykin Proc. Natl. Acad. Sci. USA 75 4184 (1978) 26. A D Mirzabekov, in Obshchie Problemy Fiziko-Khimicheskoi Biologii (Itogi Nauki i Tekhniki) [General Problems of Physicochemical Biology (Advances in Science and Engineering Series)] (Moscow: Izd. VINITI, 1985) Vol. 4, p. 5 27. A D Mirzabekov, A M Kolchinsky Mol. Biol. Rep. 1 379 (1979) 28. A D Mirzabekov, D F San'ko, A M Kolchinsky, A F Melnikova Eur. J. Biochem.75 379 (1977) 29. A M Kolchinskii, D F San'ko, V V Shik, A D Mirzabekov, A Gineitis Mol. Biol. 12 365 (1978) a 30. E S Levina, S G Bavykin, V V Shick, A D Mirzabekov Anal. Biochem. 110 93 (1981) 31. A F Melnikova, A C Zasedatelev, A M Kolchinsky, G V Gursky, A L Zhuse, S L Grohovsky, A D Mirzabekov Mol. Biol. Rep. 2 135 (1975) 32. D V Nacheva, D I Guschin, O V Preobrazhenskaya, V L Nacheva, V L Karpov, K K Ebralidse, A D Mirzabekov Cell 58 27 (1989) 33. A D Mirzabekov, S G Bavykin, A V Belyavsky, V L Karpov, O V Preobrazhenskaya, V V Shick, K K Ebralidse Methods Enzymol. 170 386 (1989) 34. A D Mirzabekov Gene 135 111 (1993) 35. I Isenberg Ann. Rev. Biochem. 48 159 (1979) 36. S G Bavykin, I M Undritsov, S I Usachenko, A A Strokov, Yu F Bogdanov, A D Mirzabekov FEBS Lett.228 149 (1988) 37. A J Varshavsky, V V Bakayev, G P Georgiev Nucl. Acids Res. 3 477 (1976) 38. A V Belyavsky, S G Bavykin, E G Goguadze, A D Mirzabekov J. Mol. Biol. 139 519 (1980) 39. S G Bavykin, S I Usachenko, A O Zalensky, A D Mirzabekov J. Mol. Biol. 212 495 (1990) 40. P G Hartman,G E Chapman, E M Bradbury Eur. J. Biochem. 77 45 (1977) 41. L Bohm, T Mitchell FEBS Lett. 193 1 (1986) 42. J B Hansen, T Koch, O Buchardt, P E Nielsen,M Wirth, B Norden Biochemistry 22 4878 (1983) 43. P E Nielsen Biochemistry 24 2298 (1985) 44. A D Mirzabekov, D V Pruss, K K Ebralidse J. Mol. Biol. 211 479 (1989) 45. K Ebralidse, A Mirzabekov FEBS Lett. 194 69 (1986) 341 46. K Ebralidse, S Grachev, A Mirzabekov Nature (London) 331 365 (1988) 47.V L Karpov, O V Preobrazhenskaya, A D Mirzabekov Cell 36 423 (1984) 48. V M Studinsky, A V Belyavsky, A F Melnikova, A D Mirzabekov Nucl. Acids Res. 16 11187 (1988) 49. S V Belikov, A I Belgovsky, O V Preobrazhenskaya, V L Karpov, A D Mirzabekov Nucl. Acids Res. 21 1031 (1993) 50. P E Nielsen FEBS Lett. 135 173 (1981) 51. R Reeves Biochem. Biophys. Acta 782 343 (1984) 52. V V Shick, A V Belyavsky, A D Mirzabekov J. Mol. Biol. 185 329 (1985) 53. G R Cook, P Yau, H Yasuda, R R Traut, E M Bradbury J. Biol. Chem. 261 16185 (1986) 54. J V Brawley, H G Martinson Biochemistry 31 364 (1992) 55. E Espel, J Bernues, J A Perez-Pons, E Querol Biochem. Biophys. Res. Commun. 132 1031 (1985) 56. T A Chen,R Sterner,A Cozzolino, V G Allfrey J.Mol. Biol. 212 481 (1990) 57. S Bavykin, L Srebreva, T Banchev, R Tsanev, J Zlatanova, A Mirzabekov Proc. Natl. Acad. Sci. USA 90 3918 (1993) 58. P P Walter, T A Owen-Hughes, J Cote, J L Workman Mol. Cell Biol. 15 6178 (1995) 59. S V Belikov, A R Dzherbashyajan, O V Preobrazhenskaya, V L Karpov, A D Mirzabekov FEBS Lett. 273 205 (1990) 60. S V Belikov, A I Belgovsky,M P Partolina, V L Karpov, A D Mirzabekov Nucl. Acids Res. 21 4796 (1993) 61. A M Belikova, V F Zarytova, N I Grineva Tetrahedron Lett. 3557 (1967) 62. D G Knorre, V V Vlassov, V F Zarytova, A V Lebedev, O S Fedorov Design and Targeted Reactions of Oligonucleotide Derivatives (Boca Raton, FL: CRS Press, 1993) 63. D G Knorre, V F Zarytova, A G Badashkeeva, O S Fedorova Biotekhnologiya (Itogi Nauki i Tekhniki) [Biotechnology (Advances in Science and Engineering Series)] (Ed. Z A Shabarova) (Moscow: Izd. VINITI, 1991) Vol. 37, p. 37 64. V V Vlasov, E M Ivanova, N D Kobets, S V Mamaev, S G Shul'zhenko, L A Yakubov Dokl. Akad. Nauk SSSR 282 196 (1985) c 65. N D Belyaev, V V Vlasov, N D Kobets, E M Ivanova, L A Yakubov Dokl. Akad. Nauk SSSR 291 234 (1986) c 66. V V Vlassov, A A Godovikov, N D Kobets, A S Ryte, L V Yurchenko,A G Bukrinskaya Adv. Enzyme Regul. 24 301 (1985) 67. V V Vlasov, N D Kobets, E L Chernolovskaya, E M Ivanova, V M Subbotin, L A Yakubov Biopolim. Kletka 5 49 (1989) 68. V V Vlassov, N D Kobets, E L Chernolovskaya, S G Demidova, R G Borissov, E M Ivanova Mol. Biol. Rep. 14 11 (1990) 69. R J Britten, D E Kohne Science 161 529 (1968) 70. C M Houck, F P Rinehart, C W Schmid J. Mol. Biol. 132 289 (1979) 71. H Hamada, T Kakunaga Nature (London) 298 396 (1982) 72. H Hamada, M G Petrino, T Kakunaga, M Seidman, B D Stollar Mol. Cell. Biol. 4 2610 (1984) 73. A Nordheim,M L Pardue, E M Lafer, A MoÈ ller, B D Stollar, A Rich Nature (London) 294 417 (1981) 74. D B Haniford, D E Pulleyblank Nature (London) 302 632 (1983) 75. D J Arndt-Jovin,M Robert-Nicoud, D A Zarling, C Greider, E Weimer, T M Jovin Proc. Natl. Acad. Sci. USA 80 4344 (1983) 76. E L Chernolovskaya, N D Kobets, R G Borissov, T V Abramova, V V Vlassov FEBS Lett. 303 269 (1992) 77. N D Kobets, R G Borissov, E L Chernolovskaya, V V Gorn, V V Vlassov Antisense Res. Develop. 4 259 (1994) 78. A S Boutorin, L V Gus'kova, E M Ivanova, N D Kobets, V F Zarytova, A S Ryte, L V Yurchenko, V V Vlassov FEBS Lett. 254 129 (1989) 79. N D Kobets, E L Chernolovskaya, E M Ivanova, V V Vlasov Bioorg. Khim. 17 933 (1991) b 80. M Behe, G Felsenfeld Proc. Natl. Acad. Sci. USA 78 1619 (1981) 81. H H Chen,M Behn, D C Rau Nucl. Acids Res. 12 2381 (1984) 82. T J Thomas, R P Messner J. Mol. Biol. 201 463 (1988) 83. T J Thomas, U B Gunnia, T Thomas J. Biol. Chem. 266 6137 (1991) 84. L N Bozhenok, V V Vlasov, E L Chernolovskaya, E M Ivanova, N D Kobets Bioorg. Khim. 24 931 (1998) bD G Knorre, N D Kobets 342 85. E L Chernolovskaya, P P Cherepanov, A V Gorozhankin, M I Dobrikov, V V Vlasov, N D Kobets Bioorg. Khim. 19 889 (1993) b 86. T S Godovikova, M V Berezovskii, D G Knorre Bioorg. Khim. 21 858 (1995) b 87. N D Kobets, A V Gorozhankin, T S Godovikova, V N Sil'nikov, D G Knorre Dokl. Akad. Nauk 349 822 (1996) c 88. A V Gorozhankin, E M Ivanova, N D Kobets Bioorg. Khim. 19 81 (1993) b 89. L N Bozhenok, E L Chernolovskaya, A V Gorozhankin, S I Baiborodin, E I Bolobolova, E V Kiseleva, A Yu Kerkis, N D Kobets Mol. Biol. 29 499 (1995) a a�Russ. J. Mol. Biol. (Engl. Transl) b�Russ. J. Bioorg. Chem. (Engl. Transl.) c�Dokl. Chem. Technol., Dokl. Chem. (Engl. Tr

ISSN:0036-021X    

出版商:RSC    

年代:1999

数据来源: RSC